ID: 1049358891

View in Genome Browser
Species Human (GRCh38)
Location 8:142202468-142202490
Sequence GGGAGTGCACCCCAGGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358891_1049358901 7 Left 1049358891 8:142202468-142202490 CCGGGGGCCTGGGGTGCACTCCC No data
Right 1049358901 8:142202498-142202520 CAGGGCAGGGCCCCCTCCATGGG No data
1049358891_1049358897 -6 Left 1049358891 8:142202468-142202490 CCGGGGGCCTGGGGTGCACTCCC No data
Right 1049358897 8:142202485-142202507 ACTCCCTGAGTGGCAGGGCAGGG No data
1049358891_1049358896 -7 Left 1049358891 8:142202468-142202490 CCGGGGGCCTGGGGTGCACTCCC No data
Right 1049358896 8:142202484-142202506 CACTCCCTGAGTGGCAGGGCAGG No data
1049358891_1049358908 29 Left 1049358891 8:142202468-142202490 CCGGGGGCCTGGGGTGCACTCCC No data
Right 1049358908 8:142202520-142202542 GGCCTCACTCCTGCTTGTCATGG No data
1049358891_1049358900 6 Left 1049358891 8:142202468-142202490 CCGGGGGCCTGGGGTGCACTCCC No data
Right 1049358900 8:142202497-142202519 GCAGGGCAGGGCCCCCTCCATGG No data
1049358891_1049358902 8 Left 1049358891 8:142202468-142202490 CCGGGGGCCTGGGGTGCACTCCC No data
Right 1049358902 8:142202499-142202521 AGGGCAGGGCCCCCTCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358891 Original CRISPR GGGAGTGCACCCCAGGCCCC CGG (reversed) Intergenic