ID: 1049358892

View in Genome Browser
Species Human (GRCh38)
Location 8:142202475-142202497
Sequence CCACTCAGGGAGTGCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358892_1049358901 0 Left 1049358892 8:142202475-142202497 CCTGGGGTGCACTCCCTGAGTGG No data
Right 1049358901 8:142202498-142202520 CAGGGCAGGGCCCCCTCCATGGG No data
1049358892_1049358908 22 Left 1049358892 8:142202475-142202497 CCTGGGGTGCACTCCCTGAGTGG No data
Right 1049358908 8:142202520-142202542 GGCCTCACTCCTGCTTGTCATGG No data
1049358892_1049358902 1 Left 1049358892 8:142202475-142202497 CCTGGGGTGCACTCCCTGAGTGG No data
Right 1049358902 8:142202499-142202521 AGGGCAGGGCCCCCTCCATGGGG No data
1049358892_1049358900 -1 Left 1049358892 8:142202475-142202497 CCTGGGGTGCACTCCCTGAGTGG No data
Right 1049358900 8:142202497-142202519 GCAGGGCAGGGCCCCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358892 Original CRISPR CCACTCAGGGAGTGCACCCC AGG (reversed) Intergenic