ID: 1049358900

View in Genome Browser
Species Human (GRCh38)
Location 8:142202497-142202519
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358892_1049358900 -1 Left 1049358892 8:142202475-142202497 CCTGGGGTGCACTCCCTGAGTGG No data
Right 1049358900 8:142202497-142202519 GCAGGGCAGGGCCCCCTCCATGG No data
1049358891_1049358900 6 Left 1049358891 8:142202468-142202490 CCGGGGGCCTGGGGTGCACTCCC No data
Right 1049358900 8:142202497-142202519 GCAGGGCAGGGCCCCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358900 Original CRISPR GCAGGGCAGGGCCCCCTCCA TGG Intergenic