ID: 1049360292

View in Genome Browser
Species Human (GRCh38)
Location 8:142209586-142209608
Sequence GCTGCTGGCCTTAGGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049360292_1049360304 9 Left 1049360292 8:142209586-142209608 CCTGGGGCCCTAAGGCCAGCAGC No data
Right 1049360304 8:142209618-142209640 CCTGGGCAGTGGGTTCCCCAAGG No data
1049360292_1049360302 -1 Left 1049360292 8:142209586-142209608 CCTGGGGCCCTAAGGCCAGCAGC No data
Right 1049360302 8:142209608-142209630 CCGGGAAGTTCCTGGGCAGTGGG No data
1049360292_1049360297 -9 Left 1049360292 8:142209586-142209608 CCTGGGGCCCTAAGGCCAGCAGC No data
Right 1049360297 8:142209600-142209622 GCCAGCAGCCGGGAAGTTCCTGG No data
1049360292_1049360299 -8 Left 1049360292 8:142209586-142209608 CCTGGGGCCCTAAGGCCAGCAGC No data
Right 1049360299 8:142209601-142209623 CCAGCAGCCGGGAAGTTCCTGGG No data
1049360292_1049360300 -2 Left 1049360292 8:142209586-142209608 CCTGGGGCCCTAAGGCCAGCAGC No data
Right 1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG No data
1049360292_1049360305 14 Left 1049360292 8:142209586-142209608 CCTGGGGCCCTAAGGCCAGCAGC No data
Right 1049360305 8:142209623-142209645 GCAGTGGGTTCCCCAAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049360292 Original CRISPR GCTGCTGGCCTTAGGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr