ID: 1049360295

View in Genome Browser
Species Human (GRCh38)
Location 8:142209593-142209615
Sequence CTTCCCGGCTGCTGGCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049360295_1049360305 7 Left 1049360295 8:142209593-142209615 CCCTAAGGCCAGCAGCCGGGAAG No data
Right 1049360305 8:142209623-142209645 GCAGTGGGTTCCCCAAGGCACGG No data
1049360295_1049360309 29 Left 1049360295 8:142209593-142209615 CCCTAAGGCCAGCAGCCGGGAAG No data
Right 1049360309 8:142209645-142209667 GTCCCCACAGCTCCCACATGAGG No data
1049360295_1049360300 -9 Left 1049360295 8:142209593-142209615 CCCTAAGGCCAGCAGCCGGGAAG No data
Right 1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG No data
1049360295_1049360302 -8 Left 1049360295 8:142209593-142209615 CCCTAAGGCCAGCAGCCGGGAAG No data
Right 1049360302 8:142209608-142209630 CCGGGAAGTTCCTGGGCAGTGGG No data
1049360295_1049360304 2 Left 1049360295 8:142209593-142209615 CCCTAAGGCCAGCAGCCGGGAAG No data
Right 1049360304 8:142209618-142209640 CCTGGGCAGTGGGTTCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049360295 Original CRISPR CTTCCCGGCTGCTGGCCTTA GGG (reversed) Intergenic
No off target data available for this crispr