ID: 1049360300

View in Genome Browser
Species Human (GRCh38)
Location 8:142209607-142209629
Sequence GCCGGGAAGTTCCTGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049360296_1049360300 -10 Left 1049360296 8:142209594-142209616 CCTAAGGCCAGCAGCCGGGAAGT No data
Right 1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG No data
1049360292_1049360300 -2 Left 1049360292 8:142209586-142209608 CCTGGGGCCCTAAGGCCAGCAGC No data
Right 1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG No data
1049360289_1049360300 9 Left 1049360289 8:142209575-142209597 CCCAGCAGTGTCCTGGGGCCCTA No data
Right 1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG No data
1049360295_1049360300 -9 Left 1049360295 8:142209593-142209615 CCCTAAGGCCAGCAGCCGGGAAG No data
Right 1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG No data
1049360290_1049360300 8 Left 1049360290 8:142209576-142209598 CCAGCAGTGTCCTGGGGCCCTAA No data
Right 1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049360300 Original CRISPR GCCGGGAAGTTCCTGGGCAG TGG Intergenic
No off target data available for this crispr