ID: 1049360321

View in Genome Browser
Species Human (GRCh38)
Location 8:142209685-142209707
Sequence GAGGCTCAGGCTGCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049360321_1049360329 12 Left 1049360321 8:142209685-142209707 CCTCCCACAGCAGCCTGAGCCTC No data
Right 1049360329 8:142209720-142209742 GCTTGTCCATGTCACCCTCCCGG No data
1049360321_1049360333 25 Left 1049360321 8:142209685-142209707 CCTCCCACAGCAGCCTGAGCCTC No data
Right 1049360333 8:142209733-142209755 ACCCTCCCGGGCAGGATTTGAGG No data
1049360321_1049360330 13 Left 1049360321 8:142209685-142209707 CCTCCCACAGCAGCCTGAGCCTC No data
Right 1049360330 8:142209721-142209743 CTTGTCCATGTCACCCTCCCGGG No data
1049360321_1049360331 17 Left 1049360321 8:142209685-142209707 CCTCCCACAGCAGCCTGAGCCTC No data
Right 1049360331 8:142209725-142209747 TCCATGTCACCCTCCCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049360321 Original CRISPR GAGGCTCAGGCTGCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr