ID: 1049365240

View in Genome Browser
Species Human (GRCh38)
Location 8:142233897-142233919
Sequence CTGTGCAGGGGGAAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 599}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049365240_1049365252 27 Left 1049365240 8:142233897-142233919 CCTCCCAGCTTCCCCCTGCACAG 0: 1
1: 0
2: 3
3: 74
4: 599
Right 1049365252 8:142233947-142233969 AATCTCACCTCCTTCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049365240 Original CRISPR CTGTGCAGGGGGAAGCTGGG AGG (reversed) Intronic
900244683 1:1631610-1631632 CGGTGGAGGGGGAGGCGGGGAGG - Intergenic
900300353 1:1973868-1973890 CGGTGGAGGAGCAAGCTGGGAGG + Intronic
900977626 1:6027043-6027065 CTGTGCAAGGGGTTGCAGGGTGG - Intronic
901012587 1:6209961-6209983 CTGTGCAGAGGTGAGTTGGGGGG + Exonic
901049702 1:6420021-6420043 CTGCGCAGGGTGGAGCCGGGAGG + Intronic
901178102 1:7319410-7319432 CGGGGCAGGAGGAAGCGGGGTGG - Intronic
901253106 1:7796667-7796689 CTTTGGAGGGGGAAGAAGGGAGG + Intronic
901425173 1:9178060-9178082 CAGGGCAGGGGGTGGCTGGGTGG + Intergenic
901652579 1:10751746-10751768 CTGTGCCGGGAAAGGCTGGGAGG + Intronic
901908415 1:12434345-12434367 CTGTGAAGGGTGCTGCTGGGAGG + Intronic
902082389 1:13829894-13829916 GGGTGCAGGGTGAGGCTGGGGGG - Intergenic
902112962 1:14098596-14098618 CTGGGCAGAGGGATGCTGGAGGG - Intergenic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902756024 1:18549833-18549855 TTGTCCTGGTGGAAGCTGGGAGG - Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903367398 1:22813552-22813574 CTGTGGAGGGGCCATCTGGGAGG + Intronic
903439153 1:23374519-23374541 CTCTGCAGGGGGAAGGGTGGGGG - Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904285054 1:29448694-29448716 CAGAGAAGGGGGAGGCTGGGCGG - Intergenic
904343497 1:29853191-29853213 CTGTCCCGGGGGAGGCTGGCTGG - Intergenic
904599862 1:31667407-31667429 CTGTGGAGGTGGAGGCTGTGAGG - Intronic
904760961 1:32804374-32804396 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
904774594 1:32899012-32899034 CAGTGCAGGGGGAACCTGGCAGG + Intronic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905241125 1:36582247-36582269 CTGTGCAGGGGGACGCAGGATGG + Intergenic
905482093 1:38268644-38268666 CGGTGCAGGGGGGTGGTGGGGGG - Intergenic
906377085 1:45304324-45304346 CTCTGAAGGGGCAGGCTGGGGGG - Intronic
907188364 1:52629373-52629395 CTGGCCAGGGGGAAGCTCGGTGG + Intergenic
907220972 1:52906675-52906697 CTGGGGAGGGGCAAGCTGGTTGG + Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907519814 1:55015798-55015820 CTGAGCAGAGGGAAGCACGGCGG + Intergenic
909026543 1:70487893-70487915 CTGTGCAGAGGCATGCTGGGAGG + Intergenic
910428076 1:87135267-87135289 GTGTGCAGGTGGAGGCTGGCCGG - Intronic
910684660 1:89904028-89904050 CTGAGTAGGGGGAAGTTAGGTGG - Intronic
910950795 1:92645983-92646005 GTTTGCAGGGGGAGCCTGGGAGG - Intronic
911046905 1:93636223-93636245 CTGTGAAGGGAGAAGCTGCAGGG + Intronic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
913451755 1:118997554-118997576 CTTTGCTGGGGGCAGGTGGGAGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915041151 1:152969287-152969309 CTGCTCAGGGTGGAGCTGGGTGG - Intergenic
915300855 1:154950897-154950919 CTGGGCAGAGGGAAGATGGTTGG - Intronic
915317977 1:155040406-155040428 ATTTGCAGAGGGAAGCTGAGCGG + Intronic
915514304 1:156403885-156403907 CTGTGCAGGAGGTCACTGGGTGG - Intergenic
915916073 1:159941756-159941778 CTGGGCAGGCGGAGGCAGGGAGG + Intronic
916358765 1:163943585-163943607 CTGAGGAGGCTGAAGCTGGGAGG + Intergenic
918311298 1:183287410-183287432 TTGTGCTGCGGGAAGCAGGGTGG + Intronic
918524534 1:185451182-185451204 CTGTGAAGGGAGAGGCTAGGGGG + Intergenic
919739400 1:200973102-200973124 CTGGGCTGGGAGAAGCGGGGAGG + Intronic
919785213 1:201254301-201254323 CTCTGCTGGGGGAAGCTCTGGGG + Intergenic
920654203 1:207863431-207863453 ATGTGCAGGAGGAATCTGAGTGG - Intergenic
922179570 1:223223441-223223463 CTGAGCCGGGGTATGCTGGGGGG + Exonic
922203392 1:223425996-223426018 CTATGGAGCGGGAAGGTGGGTGG - Intergenic
922618722 1:226978064-226978086 GTGTGCAGGGGTAAGGTGTGCGG - Intronic
922720357 1:227897061-227897083 CAGTGCTGGGGGACTCTGGGTGG - Intergenic
923045480 1:230352649-230352671 TTGTGAAGGGGAAGGCTGGGAGG + Intronic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
923538182 1:234869218-234869240 CTGTGCAGAGGCAGCCTGGGTGG - Intergenic
1062848699 10:727070-727092 CAGTGCTGGGGGAGGCTGGAGGG + Intergenic
1062857639 10:787228-787250 CTGTGCAGAGGGAAGGCGCGAGG + Intergenic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1063454688 10:6174736-6174758 CTCTGCTGGGGGAAGCTCTGGGG + Intronic
1064193970 10:13230631-13230653 ATGTGCAAGAGGAGGCTGGGGGG + Intronic
1065537010 10:26724819-26724841 CTTTGCAGGGCCAAGGTGGGTGG - Intronic
1065594253 10:27296322-27296344 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1065932432 10:30491481-30491503 CTGTGCAGGAAGAAACTGGGTGG + Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066323674 10:34331330-34331352 CTCTGCTGGGAGAACCTGGGAGG + Exonic
1067079829 10:43206568-43206590 GTGTGCAGCGGGGAGCTGGGAGG + Intronic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1068720227 10:60237038-60237060 CTGTGCAGCTGCAAGCTGGTAGG - Intronic
1069024220 10:63521967-63521989 CTGCGCAGGGAGCAGCTGCGAGG - Intronic
1069122280 10:64581910-64581932 CTGTGGTGGGGGGAGCGGGGAGG - Intergenic
1069807503 10:71135093-71135115 CGCAGTAGGGGGAAGCTGGGAGG - Intergenic
1070334480 10:75442021-75442043 CTGTGCAAAGGGAAACTGGGAGG - Intronic
1070499134 10:77053977-77053999 CTGTGCAGTGGGCAGCAGGATGG - Intronic
1070503438 10:77092635-77092657 CAGTGCAGGAGGAAGCTGAGAGG + Intronic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070639576 10:78158137-78158159 CGGAGCAGGGGGCAGCTGTGTGG - Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1070805722 10:79269654-79269676 GGGTGCAGGGGGAGGCTGGGAGG - Intronic
1070963678 10:80516546-80516568 CTGGGCGGGGGCAGGCTGGGAGG + Intronic
1072326749 10:94306340-94306362 CTTTGCAGAGGGAAGCAGTGAGG + Intronic
1073102615 10:101014561-101014583 GTGTGCTGGGGGAAGCTAAGGGG - Intronic
1073263689 10:102209915-102209937 CTGTGGAGAGGGAAACTTGGGGG - Intergenic
1074445882 10:113520536-113520558 CAGTGCAGGAGGGGGCTGGGAGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075073355 10:119333757-119333779 CTGTCCACGGGGGAGCTGAGCGG + Intronic
1075077931 10:119363686-119363708 CTGGGAAGAGGGAAGCTGGGAGG + Intronic
1075344288 10:121670848-121670870 CTGTCCAGGGGCCAGCAGGGAGG - Intergenic
1075352355 10:121735049-121735071 CTGGGCACGGGGAAGCCAGGGGG - Intergenic
1075811515 10:125227944-125227966 CTGGGCAGTGGGAAGCAGTGGGG + Intergenic
1076107339 10:127834257-127834279 CTGGGCAGGAGGAAGCTGGAGGG - Intergenic
1076364787 10:129914799-129914821 GGGTGCAGGGAGAAGGTGGGGGG - Intronic
1076365556 10:129919322-129919344 CAGTGGAGGCGGAGGCTGGGAGG + Intronic
1076521787 10:131085762-131085784 GTGTGCAGGGGGACTGTGGGAGG - Intergenic
1076773305 10:132679016-132679038 CTGTGCAGGACGTGGCTGGGAGG + Intronic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1077297978 11:1834924-1834946 CTGTGCAGCAGGAAGCTGAAGGG - Intronic
1077801782 11:5546482-5546504 ATGTGTCGGGGGAAGATGGGAGG - Intronic
1078042599 11:7882637-7882659 CAGTGCAAGGGGGAGCAGGGAGG - Intergenic
1078141392 11:8695754-8695776 ATGTGCATGGGGAGGCAGGGTGG - Intronic
1078277093 11:9859801-9859823 CTGTGTAGTTAGAAGCTGGGTGG + Intronic
1078387161 11:10902763-10902785 CTATAAAGGGGGAAGCTGAGTGG + Intergenic
1078439390 11:11351497-11351519 TTGTGCATCGGGAAGCTGTGAGG - Intronic
1078600784 11:12728495-12728517 CTGAGCAGGGGGTATCTGAGGGG + Intronic
1078863782 11:15277855-15277877 CTGAGCAGGGGGATGCTCTGTGG + Intergenic
1078997954 11:16723323-16723345 TTGCGGAGGGGGAAGGTGGGAGG + Intronic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1080384969 11:31805674-31805696 CTGGGCAGAGGAAAGCAGGGAGG + Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1080898089 11:36462605-36462627 TGGGGCGGGGGGAAGCTGGGTGG - Exonic
1081781386 11:45715524-45715546 GTTTGCTGGGGGAAGGTGGGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082899322 11:58228424-58228446 CTGTGCACGCAGATGCTGGGTGG - Exonic
1082983459 11:59145082-59145104 GTGTGCTGGGGGGAGCGGGGCGG + Exonic
1083040463 11:59680546-59680568 CTGTGCAGGGAACTGCTGGGAGG + Intergenic
1083118909 11:60491718-60491740 CCGTCCAGGAGGAAGGTGGGGGG + Intergenic
1083276134 11:61598093-61598115 GTCTGCAGGGGGAAGTGGGGTGG - Intergenic
1083277874 11:61607457-61607479 CTCTGCAGAGGGAAACTGGGTGG - Intergenic
1083732172 11:64658417-64658439 CTCTGCAGGGGAAAGCAGGCTGG - Intronic
1083939066 11:65885390-65885412 ATGGGCAGGGGGAGCCTGGGTGG + Intronic
1083990524 11:66243452-66243474 CTGTGCAGGGGTGGGCTGGAGGG - Exonic
1084209622 11:67615004-67615026 CTGTGATGGGGGGAGCTGGAGGG - Intergenic
1084312945 11:68327157-68327179 CTTTGGAGGGGGAGCCTGGGAGG - Intronic
1084724091 11:70929007-70929029 TTGTGGAGAGAGAAGCTGGGAGG + Intronic
1085040095 11:73321964-73321986 CTGTGGAGCAGGAAGCGGGGAGG + Intronic
1085235931 11:75015510-75015532 TTGTGGAGGGGGAAGCTTGAGGG - Intronic
1085261374 11:75207137-75207159 CTGACCAAGGGGAAGCTGAGTGG - Intergenic
1085507561 11:77068815-77068837 CAGTGCTGGGGGAAGGTAGGTGG + Intronic
1086190104 11:84069093-84069115 CTCTGGAGGGGGAAGCTCAGTGG - Intronic
1087403254 11:97695118-97695140 CAGTGCAGGAGGAAGAGGGGAGG - Intergenic
1089176414 11:116551973-116551995 CTGGTCAGGGGTGAGCTGGGTGG + Intergenic
1089748488 11:120633713-120633735 CTGAGCAGGGAGAGGCTGGGAGG + Intronic
1091286814 11:134412430-134412452 CGGTGCCGGGGGAGGGTGGGGGG - Intergenic
1091300455 11:134503933-134503955 CTGGGGAGGAGGAGGCTGGGAGG + Intergenic
1091306333 11:134538643-134538665 CTGTGCATGGAGAAGCAGGTTGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092746552 12:11677900-11677922 CTGTGCCAGAGGACGCTGGGAGG - Intronic
1092913676 12:13170888-13170910 GTGGGCAGGGGGAAGCGGAGAGG + Intergenic
1093460641 12:19404026-19404048 CTTTACAGGTGGACGCTGGGAGG - Intronic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1095290036 12:40467733-40467755 CTACGCAGGGGGCAGCAGGGAGG - Intronic
1095343965 12:41127067-41127089 ATGGGCAGGGGGAAGCCAGGTGG - Intergenic
1096557285 12:52411185-52411207 CTGGGCAGGGGGAAGAAAGGAGG + Intergenic
1096799974 12:54104024-54104046 CTATGTGGGGGGAGGCTGGGAGG - Intergenic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1098019133 12:66135164-66135186 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1098155545 12:67594070-67594092 CTGAGCAGGGTTCAGCTGGGTGG - Intergenic
1098925215 12:76342006-76342028 CTGAGCAGGTGGGAGGTGGGTGG + Intergenic
1100995117 12:100294576-100294598 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1102015508 12:109645469-109645491 CTGTGCAGGGTGACGTGGGGTGG + Intergenic
1102089308 12:110172972-110172994 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1102183615 12:110931515-110931537 GAGCGCAGGGGGAAGCTGGCGGG - Intergenic
1102643125 12:114383863-114383885 CTGTGCAGGTGGGAGCTGAAGGG - Intronic
1103050956 12:117779056-117779078 CTTTGCAGAGGGAAATTGGGAGG - Intronic
1103611489 12:122126950-122126972 CTCTGCAGAGGGCTGCTGGGAGG - Intronic
1104361618 12:128138490-128138512 CTGTGAGGTAGGAAGCTGGGGGG - Intergenic
1104429391 12:128704570-128704592 CAGTGCAGGGAGAAGAGGGGAGG + Intronic
1104882505 12:132082348-132082370 CTGTGGAGGGAGAGACTGGGGGG + Intergenic
1105423119 13:20270642-20270664 CTGTGCCGGGGGCTGCTGTGAGG - Intergenic
1105451261 13:20502331-20502353 GTGAGGAGGGGGAAGCGGGGAGG - Intronic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1107285167 13:38782088-38782110 CAGCGCAGGGTGAAGCAGGGTGG + Intronic
1107869002 13:44729887-44729909 GTGTGCAGGGGGTGGTTGGGAGG + Intergenic
1108034476 13:46274080-46274102 TAGTGCAGGGGAAGGCTGGGTGG + Intronic
1108484149 13:50908084-50908106 CTTTGCAGGACGAAGCTGGATGG - Intergenic
1112495937 13:99904957-99904979 CTGTTCTGGGGGAGGCAGGGTGG - Intergenic
1112524305 13:100129532-100129554 CTGGTCAGGGAGAAGGTGGGAGG - Intronic
1113595813 13:111530999-111531021 CTGGGCAGAGGGAAGCAGGGTGG - Intergenic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1113750711 13:112774916-112774938 CCGTGACGGGGGAAGGTGGGAGG - Intronic
1113801981 13:113091479-113091501 CCGTGCTGGGTGGAGCTGGGTGG + Intronic
1113814503 13:113161842-113161864 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814532 13:113161926-113161948 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814583 13:113162094-113162116 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814624 13:113162220-113162242 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814803 13:113162766-113162788 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1115536968 14:34382260-34382282 CTTTGCAAGGCTAAGCTGGGTGG - Intronic
1118157888 14:63258581-63258603 TTGGGGAGAGGGAAGCTGGGTGG - Intronic
1118240037 14:64047172-64047194 CAGTGGAGAGGGAAGCTGGAGGG + Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119659475 14:76439964-76439986 CTGTGCATGGGGGAGCTGAGGGG - Intronic
1119711006 14:76822081-76822103 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1119736467 14:76985833-76985855 CTGAGCAGGCAGAAGCTGGGAGG + Intergenic
1119947547 14:78710804-78710826 CTTTGCAGAGGGCAGATGGGTGG + Intronic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121100849 14:91249109-91249131 CTGAGCAAGGGGATGCAGGGTGG + Intronic
1121325978 14:93019797-93019819 CTGTGCAGGGGGATGCCCGGGGG + Intronic
1121359529 14:93243926-93243948 CTGGGGTGGGGGAAGCAGGGAGG + Intronic
1121666998 14:95680170-95680192 CTCTGAAGGAGGAAGCTGGCTGG - Intergenic
1121786918 14:96668873-96668895 CTGGGCAGGAGGAAACTGGGAGG + Intergenic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122358092 14:101136340-101136362 CTGTGCAGGTGGGGGCTGGGAGG - Intergenic
1122574307 14:102732079-102732101 CTCTGCAGGGGGCCGCTGAGGGG - Intergenic
1122790869 14:104183661-104183683 GTGTGCAGGGGCAGGATGGGAGG + Intergenic
1122888034 14:104719228-104719250 CTGGGCAGGGGTAAGCTGGCAGG + Exonic
1122981963 14:105196088-105196110 CTGTGCTGGGCGAACCTGTGGGG + Intergenic
1123583895 15:21740569-21740591 CTGTGCAGGTGGAGGCTGATAGG - Intergenic
1123620545 15:22183172-22183194 CTGTGCAGGTGGAGGCTGATAGG - Intergenic
1124024985 15:25957753-25957775 CTGCGCAGGGGGCAGGTGTGGGG - Intergenic
1124611928 15:31215222-31215244 CTGTGCAGGGGACAGCAGAGGGG + Intergenic
1125202253 15:37110499-37110521 CTGGGCAGGGCCAAGGTGGGAGG - Intergenic
1126858165 15:52859026-52859048 ATGTGCAGGGGGGATCTGTGTGG + Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1128061040 15:64736306-64736328 CTGTGAATGGGAGAGCTGGGTGG + Intergenic
1128677662 15:69623802-69623824 CAGTGCTGGGGGAGGCTAGGAGG - Intergenic
1129269878 15:74413980-74414002 CCCTGCTGGGGGAAGCTGGGTGG - Intronic
1129509739 15:76112586-76112608 CTGTGCTGGGGACAGCTGGGTGG - Intronic
1129892883 15:79083261-79083283 TCGTGCAGGGAGCAGCTGGGAGG - Intronic
1130093646 15:80840606-80840628 CCGTGCAGGGGGAAACTGCAGGG + Intronic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1132090091 15:98941065-98941087 CAGTGCAGGGGGGAGCCAGGTGG + Intronic
1132348449 15:101122441-101122463 CTCTGCAGGGGGAGGCTCAGGGG - Intergenic
1132574349 16:657728-657750 CGGGGCAGGGGTCAGCTGGGTGG - Intronic
1132617283 16:847936-847958 CTAGGCAGGGGAAGGCTGGGGGG - Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132722010 16:1321106-1321128 CAGTGCTGGGGAAAGCAGGGAGG + Intronic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133931593 16:10237152-10237174 CTGAGCAGGGAGAATCTGGGAGG - Intergenic
1136520340 16:30791660-30791682 CTTTGCGGGGTGAAGATGGGAGG - Intergenic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1137496240 16:48971519-48971541 CTGGGGAGGGGGAGGCTGTGAGG - Intergenic
1137710731 16:50564898-50564920 CTCCAAAGGGGGAAGCTGGGAGG - Intronic
1138102888 16:54268661-54268683 CTGGGCAGAGGAGAGCTGGGTGG + Intronic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138350222 16:56342390-56342412 CTGTGGAGGGGGCAGCAGGGAGG - Intronic
1138496411 16:57411831-57411853 CTTTGCAGGGGGACTCTGCGGGG + Intronic
1138597024 16:58034637-58034659 CAGTGATTGGGGAAGCTGGGGGG - Intronic
1138664454 16:58553027-58553049 CTTTGCAGGGCGGAGGTGGGCGG + Intronic
1139078132 16:63480319-63480341 CTGTGCATTGGGATGCTTGGGGG - Intergenic
1139367830 16:66444470-66444492 CAGTGCAGGGGGAGGATGGAGGG + Intronic
1139429608 16:66904118-66904140 CTCAGCAGGGGGAATCTGGAGGG + Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1141054468 16:80803590-80803612 CTGCGAAGGGGGAGGCTGGGTGG - Intronic
1141483095 16:84319699-84319721 CCGGGCAGGGGGAAGATGTGAGG - Intronic
1141609375 16:85172441-85172463 CTGTGCAGGAGGCAGACGGGAGG + Intronic
1141723168 16:85768109-85768131 CTGGGCAGAGGGAAGCAGGCAGG - Intergenic
1141963678 16:87426576-87426598 CTCTGGAGGGGGAGGCTGTGTGG - Intronic
1142158793 16:88546744-88546766 GTGAGCAGGGGGATGCTGCGTGG - Intergenic
1142160494 16:88554966-88554988 ATGGGCAGTGGGCAGCTGGGAGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142972720 17:3623652-3623674 CTTTGCTTGGGGCAGCTGGGAGG - Intronic
1143032987 17:3978031-3978053 CTGTGAAGTGGGAAGCACGGCGG + Intergenic
1143373778 17:6455687-6455709 CAGCGCAGGGGGAAGAAGGGAGG + Intronic
1143723442 17:8829750-8829772 CTGGGCAGGGGAATGCTTGGTGG + Exonic
1145126272 17:20302440-20302462 CTGTGCAGAGGCCACCTGGGAGG - Intronic
1146126835 17:30237246-30237268 AGGTGCAGGGGGATGCTGGAAGG + Intergenic
1146352261 17:32104555-32104577 CAGTTCAGGGGGAGGCAGGGTGG + Intergenic
1146722105 17:35130787-35130809 CTGTCCTGGTGGAAGCTAGGAGG - Intronic
1147178979 17:38673417-38673439 CTGTGGAGGTGGCAGATGGGGGG - Exonic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147586477 17:41656223-41656245 CTGGGCAGGTGGATGCTGAGGGG + Intergenic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1147875405 17:43617246-43617268 CTGTGCAGGACGGAGCTGGCAGG + Intergenic
1147971248 17:44219939-44219961 CTCCGCGGGGGGCAGCTGGGAGG + Intronic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148634149 17:49134097-49134119 CTGAAAAGGAGGAAGCTGGGAGG + Intronic
1148677895 17:49455615-49455637 CTGGGCAGGGGGGTGCGGGGAGG + Intronic
1148682562 17:49483098-49483120 CTGGGGAGGGGGCTGCTGGGAGG - Intergenic
1149467739 17:56893096-56893118 CTGGGATCGGGGAAGCTGGGTGG + Intronic
1149545379 17:57499657-57499679 CTGTGGAGCGGGAATTTGGGCGG + Intronic
1150429881 17:65106542-65106564 CTGTACTGGGGGATGCTGAGAGG - Intergenic
1150816571 17:68396688-68396710 GTTTGCTGGGGGAGGCTGGGTGG - Intronic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151529475 17:74695372-74695394 GAGTGAAGGGGGAAGCTGGAGGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152012411 17:77726705-77726727 AGGTGCAGAGTGAAGCTGGGCGG - Intergenic
1152095919 17:78271552-78271574 CGGGGCAGGGGGTACCTGGGTGG + Intergenic
1152113403 17:78369914-78369936 CTGGGCAGGGAGAAGCTGCGGGG + Intergenic
1152124623 17:78438907-78438929 CTCTGCTGGGGTCAGCTGGGTGG - Intronic
1152241868 17:79165154-79165176 CTGTGCAGGAAGATGCTGGAGGG - Intronic
1152284378 17:79403740-79403762 TTGTGCTGGGGGAACCTGAGAGG - Intronic
1152363523 17:79843085-79843107 GCGTGCAGGGGGAGGCTGTGAGG + Intergenic
1152629165 17:81402080-81402102 CTGCGCTTGGGGAGGCTGGGAGG - Intronic
1152753582 17:82077741-82077763 CTGTGCGGGGGGCCGCTGGGTGG - Intergenic
1152892800 17:82892024-82892046 CTGTGCAGGGGGGAAGTGGGGGG - Intronic
1152929112 17:83100940-83100962 TTGAGCAGGGGCAGGCTGGGCGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154932003 18:21008850-21008872 CTCTACTGGGGGAAGCTGAGTGG - Intronic
1155179508 18:23331659-23331681 CTGTCCAGGTGGCAGCTGTGTGG - Intronic
1155911905 18:31513686-31513708 CAGGGCAGAGGGAAGCGGGGAGG - Intronic
1158642576 18:59216296-59216318 CTTTGCAGGGCCAAGGTGGGAGG + Intergenic
1160216780 18:76939514-76939536 GTGGGCAGGGGGAGGCTGGATGG + Intronic
1160313646 18:77820909-77820931 CTGTGCAGGGAGAACCAGAGTGG + Intergenic
1160506207 18:79427953-79427975 CTGTGCAGTGGGTGGCGGGGGGG + Intronic
1160699487 19:498914-498936 CTGTGCTGTGGGGCGCTGGGAGG + Intronic
1161003231 19:1921582-1921604 CTGGCCAGTGGGAAGCTGCGGGG + Intronic
1161045140 19:2130597-2130619 CTGTGGAGGAGGCGGCTGGGAGG - Intronic
1161280472 19:3442862-3442884 CTCTGCACGGGGCAGCTGTGAGG + Intronic
1161370957 19:3910734-3910756 CTGGGGAGGGAGGAGCTGGGTGG - Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162015468 19:7844521-7844543 CTGGGCAGGGAGGGGCTGGGAGG - Intronic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162205900 19:9055801-9055823 CTGGGGATGGGGAAGCCGGGAGG - Intergenic
1163441662 19:17325012-17325034 CTGGGCAGGGGGAGGCCGGGTGG + Exonic
1163758699 19:19121407-19121429 GTGTGCAGGAGGAACCTGGGGGG + Exonic
1164749358 19:30640585-30640607 CGGTGCAGGGAGAAGCCTGGAGG - Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1166180107 19:41102963-41102985 CTGTCCGGGAGGGAGCTGGGGGG + Intergenic
1166191823 19:41180768-41180790 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1166267469 19:41694232-41694254 AAGTGAAGGGTGAAGCTGGGTGG + Intronic
1166313847 19:41977847-41977869 CAGTGCAGAGGGAGGTTGGGGGG + Intronic
1166392877 19:42419661-42419683 CTGAGCAGGGGTAAGGAGGGCGG + Intronic
1166465307 19:43026342-43026364 CTGTGCAGGGAGGGGCTGAGAGG + Exonic
1166471429 19:43082539-43082561 CTGTGCAGGGAGGGGCTGAGAGG + Exonic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166966481 19:46532151-46532173 CTGTGCAGTGGGAAGTAGGCGGG - Intronic
1167107919 19:47441441-47441463 CTGTGCAGGGGGTAAGGGGGAGG + Intronic
1167208930 19:48121237-48121259 CTGGGCCGGGGGAAGCGGGCCGG - Exonic
1167472948 19:49685590-49685612 GTGAGCCGGGTGAAGCTGGGTGG + Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
1167791313 19:51684482-51684504 CTGGGCTGGGGGAAGTGGGGAGG - Intergenic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
925027997 2:624771-624793 CTCTGCAGGGAGGAGCTGGCAGG + Intergenic
925385574 2:3459595-3459617 ATGTGCAGGGGAGAGCAGGGAGG + Intronic
925432423 2:3806788-3806810 CTTTGCAGGGCCAAGGTGGGCGG - Intronic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926106914 2:10158385-10158407 TTGTGCAGGGGGATGATGGAAGG - Intronic
926252739 2:11165164-11165186 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
926297496 2:11579227-11579249 CTGGGCATGGGGAAGCAGTGAGG - Intronic
926699067 2:15790619-15790641 CTGGGCAGAGGGCAGCTGAGTGG - Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927673852 2:25090299-25090321 CAGTGAGGGGTGAAGCTGGGTGG + Intronic
927809206 2:26172745-26172767 CTGGGCGCGGGGAAGCTGGCGGG + Intergenic
927812322 2:26187050-26187072 CTGGGCTGGGGGATGCTGGAAGG + Intronic
927971454 2:27308119-27308141 TGGTGCAGGGGGAGGCTGGGCGG + Intronic
929055706 2:37874523-37874545 CTGGGCAGTGACAAGCTGGGGGG + Intergenic
929484522 2:42342003-42342025 CTAAGCAGGGGGCAGGTGGGAGG + Intronic
929596241 2:43178124-43178146 GTGTGCAGTGGGACGCTGAGGGG - Intergenic
929960278 2:46491001-46491023 CTGAGCAGGGGGACCCTTGGTGG + Intronic
932432619 2:71685034-71685056 CAGTGCAGGGTGCAGCTGGCAGG - Intronic
932448464 2:71794836-71794858 CTGAGCATGGGGAAGCTCAGAGG + Intergenic
933514606 2:83284449-83284471 ATGTACTGGAGGAAGCTGGGGGG - Intergenic
934562950 2:95322728-95322750 CTGTGCCGGGATAAGCGGGGTGG - Intronic
934998509 2:98988903-98988925 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
935208642 2:100919759-100919781 CAGCCCAGGGGAAAGCTGGGTGG - Intronic
935872857 2:107469710-107469732 GTGTGGAGGGAGAAGCAGGGCGG - Intergenic
936679635 2:114755400-114755422 CTCTGGAGGGTGAAGCGGGGAGG - Intronic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
937318244 2:120945529-120945551 CTGGGCAGTGGGAAGCTGTGTGG + Intronic
937428596 2:121819636-121819658 CTGAGCGGGAGGAGGCTGGGAGG - Intergenic
937829406 2:126403271-126403293 CTGGGCATGGGGAAGCAGGTAGG + Intergenic
937911041 2:127075789-127075811 CGGTGGGGGGGGCAGCTGGGAGG - Intronic
938287240 2:130128551-130128573 CTGTGGAGGGGGTGGTTGGGGGG - Intronic
938469260 2:131544322-131544344 CTGTGGAGGGGGTGGTTGGGGGG + Intergenic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
939566386 2:143790775-143790797 CTGAGCTAGGTGAAGCTGGGGGG + Intergenic
939732379 2:145800403-145800425 CAGTGCAAAGGGAAGATGGGGGG + Intergenic
940265094 2:151828214-151828236 CTGAGCCGGGGGAAGCCAGGCGG - Exonic
940308003 2:152247127-152247149 CTGTGCAGGGGGTAGGGTGGGGG - Intergenic
941291455 2:163680704-163680726 CTGGGGAGGGGGAAGATTGGGGG - Intronic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
943030482 2:182679895-182679917 GTGGGTAGGGGGAAGATGGGAGG + Intergenic
943320851 2:186440158-186440180 CTGGGGTGGGGGAAGCGGGGAGG + Intergenic
943660230 2:190552211-190552233 CTGAGCAGGAGGAAGCAAGGGGG - Intergenic
943754290 2:191541920-191541942 CTGTACAGGAGGAAGCCTGGAGG - Intergenic
944117493 2:196205200-196205222 TTGTGGAGGGGGAAACTGTGTGG + Intronic
946441815 2:219703308-219703330 CAGTGCAGGAGGGAGCGGGGAGG + Intergenic
946621499 2:221568742-221568764 CTGTTCAGGGAGAACTTGGGTGG - Exonic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947743869 2:232497655-232497677 GGGCGCAGGGGGAGGCTGGGGGG + Intergenic
948027564 2:234790207-234790229 CTATGCTGGGGGAAGATGAGAGG - Intergenic
948029638 2:234806653-234806675 CTGTGCTGGGGGAAGATGAGAGG + Intergenic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948279552 2:236736357-236736379 CAGGGCAGGGGGTGGCTGGGGGG + Intergenic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169802116 20:9521136-9521158 CTGTGCAGAGGGAAGCTTATGGG + Intronic
1170395672 20:15922701-15922723 TTGTGCTGGAGGAAGCAGGGAGG - Intronic
1170574520 20:17652511-17652533 CTGTGCTGCGGGGATCTGGGAGG - Intronic
1170623095 20:18010609-18010631 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1170629357 20:18055085-18055107 GTGTGCTGGGGGAAGGGGGGCGG - Intronic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171388866 20:24788181-24788203 CTCAGAAGGGGGAGGCTGGGGGG - Intergenic
1171425604 20:25046765-25046787 GTGTGCAGGGGCCACCTGGGGGG + Intronic
1171464365 20:25317386-25317408 CTTGGCACAGGGAAGCTGGGAGG - Intronic
1171957261 20:31471092-31471114 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1172638295 20:36424586-36424608 CTGTGCAGGGGGGTCCTGGGTGG + Intronic
1173025758 20:39305901-39305923 CTGTGCTGGGGGTGGGTGGGAGG + Intergenic
1174269060 20:49353739-49353761 CTCTGCAGAGGGAAACTGGGTGG + Intergenic
1174271091 20:49369227-49369249 GTTTTCAGGGGCAAGCTGGGTGG + Exonic
1174340426 20:49891766-49891788 CCATGCAGGTGGAAGCAGGGAGG - Exonic
1174361164 20:50029736-50029758 CAGGGCAGGGGCAAGGTGGGGGG - Intergenic
1174836092 20:53856362-53856384 CTGTGCAGCTGGAGGCTGCGAGG - Intergenic
1175273526 20:57751678-57751700 CTGTGCTCGGGGAACCTGGTAGG - Intergenic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1175625205 20:60483922-60483944 GTGGGCAGGGGCAAGCAGGGAGG + Intergenic
1176023905 20:62976174-62976196 CTCTGCTGGGGGAAGGTTGGGGG - Intergenic
1176072275 20:63233622-63233644 CTGTGCAGGGAGCTGCTGAGGGG - Intergenic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176249581 20:64114027-64114049 CTGGGCTGGGGAAGGCTGGGTGG + Intergenic
1176254430 20:64143597-64143619 CTCTGCAGAGGGAACATGGGGGG - Intergenic
1176348188 21:5770441-5770463 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176355002 21:5891025-5891047 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176448196 21:6840167-6840189 CTGTTCACGGGGAAGCCGGGCGG + Intergenic
1176496639 21:7554014-7554036 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1176542509 21:8168511-8168533 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176561460 21:8351556-8351578 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176826366 21:13705189-13705211 CTGTTCACGGGGAAGCCGGGCGG + Intergenic
1177741957 21:25165499-25165521 ACTTGCAGGTGGAAGCTGGGAGG + Intergenic
1179487960 21:41722842-41722864 GTGTGCGGGGGGAAGTGGGGGGG - Intergenic
1179554332 21:42162823-42162845 CTGTGCAGGGATAAGTTGGGGGG + Intergenic
1179673944 21:42969082-42969104 GTGTGCAGGGGGCAGTGGGGGGG + Intergenic
1179795312 21:43779004-43779026 AAGTGCAGGGTGAAGCAGGGTGG + Intergenic
1179816539 21:43909798-43909820 TGCTGCAGGGGGAAGCTGTGAGG + Intronic
1179821762 21:43941087-43941109 TGGTGCAGGGGGCAGCTGGGGGG + Intronic
1179986858 21:44927081-44927103 CTGGGCGAAGGGAAGCTGGGGGG - Intronic
1180032952 21:45224575-45224597 CTGGGCAGGGGGCTACTGGGGGG + Exonic
1180141943 21:45898328-45898350 GTGTGCAGAGGGAGGCTGTGAGG - Intronic
1180141953 21:45898380-45898402 GTGTGCAGAGGGAGGCTGTGAGG - Intronic
1180141958 21:45898406-45898428 GTGTGCAGAGGGAGGCTGTGAGG - Intronic
1180141963 21:45898432-45898454 GTGTGCAGAGGGAGGCTGTGAGG - Intronic
1180764178 22:18234098-18234120 CTGGGAAGGTGGAATCTGGGAGG + Intergenic
1180771464 22:18390443-18390465 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1180802846 22:18640058-18640080 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1180833090 22:18915963-18915985 CTGGGAAGGCGGAATCTGGGAGG + Intronic
1180995783 22:19964543-19964565 CTGTGCAGGTGCAAAATGGGTGG + Intronic
1181066735 22:20310291-20310313 CTGGGAAGGCGGAATCTGGGAGG - Intergenic
1181218872 22:21355203-21355225 CTGGGAAGGTGGAATCTGGGAGG + Intergenic
1181406728 22:22690228-22690250 GTGGACAGGGGGAAGCTGGTTGG + Intergenic
1181468334 22:23122721-23122743 ATGGGCAGTGGGAAGATGGGGGG + Intronic
1181583995 22:23842953-23842975 CAGTGAGGGGGAAAGCTGGGTGG - Intergenic
1181722943 22:24789963-24789985 CTGATCAGGGGGCAACTGGGAGG + Intergenic
1181808613 22:25390370-25390392 CTTTGGAGGGGGAGCCTGGGAGG + Intronic
1181964894 22:26649550-26649572 CTGTGCAAGGGGCAGCCTGGAGG + Intergenic
1183350677 22:37333057-37333079 GTGTGCAGGGAGAAGGTCGGGGG - Intergenic
1183368967 22:37421770-37421792 CTGTGCAGGCGGAGACTGGTAGG - Intronic
1183416933 22:37688016-37688038 GTACGCAGGGGGAAGGTGGGAGG + Intronic
1183598284 22:38825215-38825237 CTGGGCATGAGGAAGATGGGTGG + Intronic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183688294 22:39374564-39374586 CTGTGCAGGGGGTACCTGCTGGG - Intronic
1184273479 22:43397759-43397781 TTGTGCAGGGGGCAGGTGGCAGG + Intergenic
1184594039 22:45503382-45503404 CTGGGCTGGGGGACGCTGGCTGG + Intronic
1184606884 22:45579451-45579473 CTGTGCCGGGGGAAGCCGCTGGG - Intronic
1185171576 22:49297577-49297599 CTCTGCAGGGGGTGCCTGGGAGG - Intergenic
1203233303 22_KI270731v1_random:131434-131456 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1203247449 22_KI270733v1_random:84929-84951 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1203283174 22_KI270734v1_random:141267-141289 CTGGGAAGGCGGAATCTGGGAGG + Intergenic
949338637 3:3004875-3004897 CTCTTCAGGGGTCAGCTGGGTGG + Intronic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949941008 3:9154420-9154442 CTGAGCAGGGGGAGGCGAGGTGG - Intronic
950169869 3:10830946-10830968 CTCCGGAGGTGGAAGCTGGGTGG + Intronic
950454848 3:13086572-13086594 GAGTGCAGTGGGAAGCTGGCGGG - Intergenic
950525912 3:13523180-13523202 GGAAGCAGGGGGAAGCTGGGCGG - Intergenic
950533859 3:13568440-13568462 CAGCGCAGTGGGCAGCTGGGTGG + Intronic
950626787 3:14253198-14253220 CTGTGCTGGGCGAAGTAGGGTGG + Intergenic
950661057 3:14467240-14467262 CTGTCCAGGGGGAAGGGTGGTGG - Intronic
950664758 3:14488421-14488443 CTGTGCTGGGAGATGCTGGCTGG - Exonic
951348446 3:21575264-21575286 CTGTGCAGGGTGGAGGTGGGAGG + Intronic
952883825 3:38001125-38001147 CTGAGCAGCGAGCAGCTGGGAGG + Intronic
953751474 3:45611667-45611689 CAATGCAGGGGCAGGCTGGGAGG + Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954451084 3:50572092-50572114 CTGCAGAGGGGGCAGCTGGGTGG - Intronic
954481255 3:50803749-50803771 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954929899 3:54272365-54272387 CTGGGCTTGGGGAAGCTGTGGGG + Intronic
955710087 3:61769514-61769536 CTTTGCAAGGCTAAGCTGGGAGG - Intronic
956765955 3:72484681-72484703 CTGGGCATGGGGGAGCTGAGAGG + Intergenic
957620291 3:82585007-82585029 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
960944695 3:122958130-122958152 CTGGGCTGGGGGAAGCTGCCAGG - Intronic
961045494 3:123705115-123705137 GTGTGCAGGGGGTAGAGGGGTGG - Intronic
961662299 3:128475877-128475899 CAGAGCTGGGGGAGGCTGGGGGG - Intergenic
962112784 3:132470798-132470820 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
963498558 3:146097110-146097132 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
964201123 3:154120842-154120864 CTCTGAAGAGGGAAACTGGGTGG - Intergenic
964571044 3:158107131-158107153 CTGGGCAGGATGATGCTGGGCGG - Intronic
964982569 3:162703369-162703391 CAGTGCAGGGGCAGGCTGGAGGG + Intergenic
967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG + Intergenic
968121301 3:196127961-196127983 CTGTGCTGGTTGAGGCTGGGTGG - Intergenic
968508707 4:985316-985338 CTCTGCAGGGACAAGCCGGGAGG - Intronic
968526664 4:1061502-1061524 CTGTGCAGGGGGATCCAGCGCGG + Intronic
968588674 4:1446813-1446835 CTGTGCTGGGGGAGCCGGGGAGG - Intergenic
968621317 4:1604621-1604643 CTGTCCTGGGGGAAGTAGGGTGG - Intergenic
968655394 4:1776394-1776416 CTGAGCAGGTGGTGGCTGGGAGG - Intergenic
968726641 4:2250958-2250980 CAGTGCAGCAGGGAGCTGGGAGG + Intronic
968728470 4:2259043-2259065 CTGTGCAGCGGCATCCTGGGAGG - Intronic
968832488 4:2940279-2940301 CTGTGCAGGAGAAAGCGGGTAGG - Intronic
968969827 4:3788004-3788026 CTGGGCTGGGGTAAGGTGGGTGG + Intergenic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
969587167 4:8101008-8101030 CAGACCAGGGGAAAGCTGGGAGG + Intronic
969637521 4:8377938-8377960 CTGTCTAGGGGGCAGCTGGTGGG - Intronic
970290761 4:14569642-14569664 ATGTGGAGGTGGAGGCTGGGAGG - Intergenic
973229767 4:47827985-47828007 CTGATCAGAGGAAAGCTGGGAGG - Intronic
973297340 4:48539517-48539539 CGGGGCAGGGGGAGGGTGGGGGG - Intronic
974088279 4:57284105-57284127 CTCTATTGGGGGAAGCTGGGTGG - Intergenic
974373225 4:61044025-61044047 CTGAGCAGGAGGAAGCAGGTAGG + Intergenic
975327221 4:73072138-73072160 CTGTGCTTTGGGAAGCTGAGTGG + Intergenic
975714099 4:77189185-77189207 CTGTGGAGGAGGAAACAGGGAGG - Intronic
976265274 4:83182720-83182742 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
976582842 4:86759630-86759652 CAGTGCAGTGGGAAACAGGGAGG + Intronic
977142961 4:93398686-93398708 CTGTGCAGGGCTAAGCTTGCAGG - Intronic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
980895241 4:138854449-138854471 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
983646180 4:169993682-169993704 CTGGCCAGGGGGAATCTGGCGGG + Intronic
984217318 4:176930630-176930652 CAGTGTTGGGGGAAGCTGGATGG + Intergenic
984533536 4:180945018-180945040 CTGTCCGGGAGGAAGGTGGGGGG + Intergenic
984869059 4:184310951-184310973 CTTTGCTGGAGGAAGCTGGGAGG - Intergenic
984977125 4:185240528-185240550 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
985280313 4:188280018-188280040 CTGGGCAGGAGGAAGCGGGAAGG + Intergenic
985484489 5:140813-140835 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985484577 5:141049-141071 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985484585 5:141071-141093 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985484593 5:141093-141115 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985484652 5:141222-141244 CAGTGCAGGGGGAGGTTGTGGGG - Intronic
985555740 5:557158-557180 CTGGGCTGGGGGTTGCTGGGCGG - Intergenic
985640016 5:1059184-1059206 CTGTCCACGGACAAGCTGGGCGG + Intronic
985714528 5:1447933-1447955 CTGTGCAGGTAGAAGCAGTGTGG + Intergenic
985795479 5:1958711-1958733 CTGTGCAGGTGGAACCTCCGAGG - Intergenic
985800636 5:2003538-2003560 CAGTGTAGGGTGAGGCTGGGAGG + Intergenic
985868385 5:2534362-2534384 TTGTGCAGGGCTCAGCTGGGTGG + Intergenic
985874115 5:2582343-2582365 CTGCACAGGTGGAAACTGGGAGG + Intergenic
986013666 5:3739335-3739357 CTGTGCAGCCTGAAGCTGGAGGG - Intergenic
986136312 5:4982359-4982381 GTGTGCAGGGGGCAGGCGGGGGG + Intergenic
987088140 5:14488048-14488070 TTCTGCAGGGGGCTGCTGGGGGG - Exonic
988240047 5:28597000-28597022 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
989247741 5:39273006-39273028 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
991969574 5:72126116-72126138 CTGTGTTGAGGGAAGCAGGGAGG + Intronic
992780041 5:80119449-80119471 CAGTGCAGGGATCAGCTGGGTGG + Intronic
992905851 5:81345042-81345064 CTGTGAAGGGTGATGCAGGGCGG + Intronic
992941565 5:81767315-81767337 CTGTGCAGGGGTAAGCTGCCAGG + Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
995906489 5:117130371-117130393 CTTGGCAGGTGGAAGGTGGGAGG - Intergenic
997874957 5:137538288-137538310 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
997889255 5:137660407-137660429 CTGTCCTGTGGGAAGCTGGCTGG - Intronic
997984723 5:138492926-138492948 CTCTGCAGGAGAAAGCTGGAGGG + Intergenic
998148233 5:139742550-139742572 CTGAGCAGGCTGAAGCTCGGGGG - Intergenic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
1001223491 5:169924135-169924157 CTGTGCAGGGAGAAGCAGACTGG - Intronic
1001261795 5:170236039-170236061 CTGTGCTGGAGGGATCTGGGAGG - Intronic
1001266518 5:170278337-170278359 GAGTGCAGGGGGGGGCTGGGGGG + Intronic
1001308484 5:170593712-170593734 CTGGGCAGGGCGGGGCTGGGGGG + Intronic
1002038797 5:176495363-176495385 CTTTGCAGGGGGCAGAAGGGAGG + Intronic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002426910 5:179181974-179181996 GTGTGCGGTGGGAAGCTGGAGGG - Intronic
1002791577 6:441367-441389 CTGAGCAGGGGTGAGGTGGGAGG - Intergenic
1003646248 6:7915103-7915125 CTGAGAAGGGGAATGCTGGGAGG - Intronic
1004253795 6:14044336-14044358 CTGTCCAGGGAGAAGCTGGGAGG - Intergenic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1004874393 6:19939598-19939620 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1006517326 6:34552230-34552252 CTGTCCTGTGGCAAGCTGGGAGG - Intronic
1006579428 6:35068339-35068361 CTGTGCCTGGGGAAGCTCTGGGG + Intronic
1007181391 6:39931799-39931821 CTGTGGCGGGGGAAGCAGGGAGG - Intronic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007756354 6:44102160-44102182 GTGGGCAGGAAGAAGCTGGGTGG - Intergenic
1007910083 6:45504880-45504902 CTGTTTAGGGGGAAAATGGGTGG + Intronic
1008522571 6:52376286-52376308 CTATGCAGGCAGAAGCTGTGTGG + Intronic
1011804756 6:91059899-91059921 CTGTGCAGGTACCAGCTGGGTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013744841 6:113333567-113333589 GTGTGCATGGGGAAACTGGAAGG + Intergenic
1014817893 6:125954884-125954906 GTGGGCAGGGGGCAGTTGGGGGG + Intergenic
1015264978 6:131281762-131281784 CTCAGCAGAGGGAAGCAGGGAGG - Exonic
1015619737 6:135118512-135118534 CAGTGCAGTTGGAAGCTGGTTGG - Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1016471576 6:144380369-144380391 CTGGGCAGAGGGAAAATGGGTGG + Intronic
1016799303 6:148152784-148152806 CTTTTCATGGGGAGGCTGGGGGG + Intergenic
1017250494 6:152275003-152275025 CTGGGATGGGAGAAGCTGGGAGG - Intronic
1017382737 6:153848826-153848848 CTCTGAAGGGAGAAACTGGGTGG + Intergenic
1017658107 6:156649140-156649162 CTGAGCAGACAGAAGCTGGGAGG + Intergenic
1017764237 6:157593651-157593673 CTGTCCTGGCGGAAGTTGGGAGG - Intronic
1018185268 6:161261158-161261180 CTGTTCAGCGGGAGGCAGGGAGG - Intronic
1018452579 6:163922874-163922896 CTGGGCAGGGGTCAGTTGGGGGG - Intergenic
1019413964 7:919060-919082 CTGTGGAGGTGGGCGCTGGGAGG - Intronic
1019499199 7:1355927-1355949 CTGGGCAGGGGGCAGCAGAGGGG - Intergenic
1019501187 7:1365489-1365511 GTGTGCAGCAGGAAGCTGGCAGG - Intergenic
1019738084 7:2660253-2660275 CTGGGCAGGGGGAGCCTGGAAGG - Intronic
1019768871 7:2870922-2870944 CTGTGGAGGGTGACTCTGGGAGG + Intergenic
1019933233 7:4237363-4237385 CAGGGCAGGGGGCAGCTTGGAGG + Intronic
1020831836 7:13103031-13103053 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021872493 7:25018989-25019011 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1021927006 7:25543531-25543553 CTTTGCAGGAGGAAGATGGAAGG - Intergenic
1022015583 7:26346067-26346089 ATGTGCGGGGGGATGCTGGCTGG - Intronic
1022974864 7:35547711-35547733 CTGTGGAGAGGGAAGCCGGCAGG + Intergenic
1023939305 7:44759729-44759751 CTGTGCAGGGAGCAGCAGGTGGG + Intronic
1024046103 7:45586828-45586850 CTGTGCAGGGAGCAGTTGTGTGG + Intronic
1024247341 7:47480202-47480224 CTGTGTATGGCGAAGCTAGGGGG + Intronic
1024636719 7:51297068-51297090 CTTTGCAGGGGGATGCTGCCTGG - Intronic
1024673913 7:51621185-51621207 CTTCCCAGGGGGAAGCCGGGAGG - Intergenic
1031021188 7:116629715-116629737 CTTTGCAGGGCCAAGCTGGGTGG + Intergenic
1031359915 7:120836953-120836975 CTATGCAGTGGGATGCTGGAGGG - Intronic
1033151420 7:138918051-138918073 GTGGGCAGGGGGAACCTGTGTGG + Exonic
1033376110 7:140763292-140763314 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1034274601 7:149818563-149818585 CAGGGGAGGGGGAAGCGGGGAGG - Intergenic
1034343787 7:150373485-150373507 CTACGCAGGGGGCAGGTGGGAGG - Intronic
1034717485 7:153256798-153256820 TGGGGCAGGGGGAAGCTGGGAGG + Intergenic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1034937702 7:155210419-155210441 CGGTGCAGGGGGAGACTAGGAGG + Intergenic
1034950136 7:155291351-155291373 CTGGGCAGGAGGAGGCTGTGTGG - Intergenic
1035034731 7:155887290-155887312 CTGTGCAGGAGAGAGCTGCGTGG + Intergenic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035185572 7:157123306-157123328 GTGTCCAGGGGGCAGCAGGGAGG - Intergenic
1035363450 7:158329193-158329215 CGGGGCAGGGGGAAGCGTGGCGG + Intronic
1035685729 8:1522352-1522374 GAGTGCATGGGGAAGCTGGCAGG + Intronic
1035760465 8:2064861-2064883 CTGGGCAGGGGATAGCTGGGAGG - Intronic
1036621408 8:10426508-10426530 CTTTGCAGGGCGCAGCTGTGAGG - Intronic
1036727396 8:11231934-11231956 CTCTGCAGGTGGAAGGTGTGGGG - Intergenic
1036750946 8:11443529-11443551 CTGTGCAGGGCGCTGCTGTGAGG - Intronic
1037150017 8:15626025-15626047 CTGTGGCGAGGGAGGCTGGGTGG + Intronic
1037649859 8:20826442-20826464 CTGTGCTGGGAGGAGCTAGGAGG + Intergenic
1038278699 8:26143287-26143309 CTGGGCAGGGGGTGGCTGTGGGG - Intergenic
1039418827 8:37418957-37418979 CTTTTTGGGGGGAAGCTGGGGGG + Intergenic
1039435543 8:37556979-37557001 CCCTGCAGGGAGAAGCTGTGGGG - Intergenic
1041286962 8:56272192-56272214 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1044597188 8:93970670-93970692 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG + Intergenic
1045564445 8:103299034-103299056 GGGTGCCGGGGGAAGCGGGGAGG + Intronic
1046636836 8:116680059-116680081 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1047851014 8:128858122-128858144 CTGTTAAGGGGGCAGCTGGCAGG - Intergenic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048934008 8:139340347-139340369 CTGTGTAGGAGTAAGCTGGCTGG - Intergenic
1048987083 8:139740464-139740486 CTGGGCAGGGGGAGGCAGGCTGG + Intronic
1049032323 8:140047113-140047135 CTGTGCCGGGAGAGGCTGGCGGG - Intronic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1051174084 9:14346491-14346513 CTGGGCCTGGGGACGCTGGGCGG - Intronic
1051762822 9:20486903-20486925 TTGTGCTAGGGGAATCTGGGAGG + Intronic
1053089350 9:35259781-35259803 GTGTGTAGGGGGATGCGGGGGGG + Intronic
1053199029 9:36140336-36140358 CTCTGCAGGGAGAAGCTGTGTGG + Intronic
1053789550 9:41677104-41677126 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054155593 9:61637648-61637670 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054177888 9:61888795-61888817 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054475362 9:65568658-65568680 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054659641 9:67692029-67692051 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055586087 9:77761099-77761121 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055727133 9:79242609-79242631 CTGTGCATGGGAAAGCCAGGAGG + Intergenic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1057204660 9:93164087-93164109 GTGTCCAGGGAGAAGCTGGATGG - Intergenic
1059331386 9:113537789-113537811 CTATGCAGGGGGCAGTTGGGGGG + Intronic
1059433523 9:114263645-114263667 CTGTGCAGGGGGGATGGGGGTGG + Intronic
1060205993 9:121683174-121683196 CAGGGCCTGGGGAAGCTGGGTGG - Intronic
1060231720 9:121830409-121830431 CTGTGCAGTGGGGAGCAGGGAGG - Intronic
1060265333 9:122108723-122108745 CTGTGCAGGGTGGGGCAGGGAGG + Intergenic
1060405080 9:123368966-123368988 CTGGGCAGGGGGAGGTTGGTGGG + Intronic
1061264192 9:129496201-129496223 CTCTGCAGGGGTAAGGTTGGGGG - Intergenic
1061298034 9:129687539-129687561 GTGTGCAGAGGGAAGCCGGCTGG - Intronic
1061410049 9:130415696-130415718 CTGTGCAGGGGAGACCTGAGGGG - Intronic
1061807132 9:133142809-133142831 CTGGGCAGGGCGGGGCTGGGAGG - Intronic
1062091022 9:134678922-134678944 CTGTGCAGGGTGAGGCTCCGAGG + Intronic
1062111148 9:134782743-134782765 TTGGGCTGGGGAAAGCTGGGTGG + Intronic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062337301 9:136077670-136077692 CTGAGCAGGGGGCAGCTGTGTGG + Intronic
1062573349 9:137195467-137195489 CTGTGCAGGCAGATCCTGGGTGG - Intronic
1203520995 Un_GL000213v1:44351-44373 CTGTTCACGGGGAAGCCGGGCGG - Intergenic
1203463781 Un_GL000220v1:67989-68011 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1185863575 X:3602757-3602779 CTTTGCAGGGCCAAGGTGGGAGG + Intergenic
1187081698 X:15996707-15996729 TTGAGAAGGGAGAAGCTGGGAGG - Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1187149636 X:16669767-16669789 CTGTGCAGTGGATGGCTGGGTGG - Intronic
1189586869 X:42470766-42470788 CTGTTGAAGGGGAATCTGGGTGG - Intergenic
1189968424 X:46395792-46395814 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1190062088 X:47218229-47218251 CGGTGGAGGGGGCAGTTGGGCGG + Intronic
1190446031 X:50525334-50525356 ATGTGAAGGGGTAAGCTGGTGGG + Intergenic
1192140530 X:68644115-68644137 CTGTGCACAGGCAAGCAGGGAGG - Intergenic
1193164568 X:78265527-78265549 CTGTCCGGGAGGAAGGTGGGGGG - Intergenic
1195280750 X:103330445-103330467 TTTTGCAGGGGGAAGCAAGGGGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196029958 X:111086110-111086132 CTGGGCAGGGGGGCGGTGGGGGG + Intronic
1196937987 X:120748685-120748707 CTCTGAAGGGGGAGGCTGGGAGG + Intergenic
1197672541 X:129293931-129293953 CTGTGGTGGGGGGAGCGGGGAGG + Intergenic
1197980590 X:132215083-132215105 CAGTGCAAGGGGAGTCTGGGTGG + Intronic
1198394603 X:136208912-136208934 CTTTGCAGGGGGATTCTGGGGGG + Intronic
1199732438 X:150649344-150649366 CTCTTCAGGGGGAAGGCGGGAGG - Intronic
1201282277 Y:12352287-12352309 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1201413996 Y:13729629-13729651 ATGGGCAGGGGGAAGGTGCGGGG - Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic