ID: 1049365401

View in Genome Browser
Species Human (GRCh38)
Location 8:142234547-142234569
Sequence CCCAACCACAAGTTCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049365391_1049365401 20 Left 1049365391 8:142234504-142234526 CCCCAACCATGGGTTCAGGGAAA 0: 2
1: 3
2: 4
3: 17
4: 180
Right 1049365401 8:142234547-142234569 CCCAACCACAAGTTCAGGGAAGG No data
1049365393_1049365401 18 Left 1049365393 8:142234506-142234528 CCAACCATGGGTTCAGGGAAAGC 0: 2
1: 1
2: 2
3: 5
4: 170
Right 1049365401 8:142234547-142234569 CCCAACCACAAGTTCAGGGAAGG No data
1049365394_1049365401 14 Left 1049365394 8:142234510-142234532 CCATGGGTTCAGGGAAAGCTCAA 0: 1
1: 1
2: 4
3: 18
4: 188
Right 1049365401 8:142234547-142234569 CCCAACCACAAGTTCAGGGAAGG No data
1049365392_1049365401 19 Left 1049365392 8:142234505-142234527 CCCAACCATGGGTTCAGGGAAAG 0: 2
1: 2
2: 2
3: 13
4: 133
Right 1049365401 8:142234547-142234569 CCCAACCACAAGTTCAGGGAAGG No data
1049365388_1049365401 26 Left 1049365388 8:142234498-142234520 CCATGACCCCAACCATGGGTTCA 0: 3
1: 1
2: 11
3: 20
4: 212
Right 1049365401 8:142234547-142234569 CCCAACCACAAGTTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049365401 Original CRISPR CCCAACCACAAGTTCAGGGA AGG Intronic
No off target data available for this crispr