ID: 1049368358

View in Genome Browser
Species Human (GRCh38)
Location 8:142251734-142251756
Sequence GGCCCTGCAGACAGAGATCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368358_1049368367 18 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC No data
Right 1049368367 8:142251775-142251797 CGCCCACGTTCTCTGTCTTCAGG No data
1049368358_1049368368 19 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC No data
Right 1049368368 8:142251776-142251798 GCCCACGTTCTCTGTCTTCAGGG No data
1049368358_1049368372 25 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC No data
Right 1049368372 8:142251782-142251804 GTTCTCTGTCTTCAGGGCCCGGG No data
1049368358_1049368371 24 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC No data
Right 1049368371 8:142251781-142251803 CGTTCTCTGTCTTCAGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368358 Original CRISPR GGCCCTGCAGACAGAGATCG CGG (reversed) Intronic