ID: 1049368358

View in Genome Browser
Species Human (GRCh38)
Location 8:142251734-142251756
Sequence GGCCCTGCAGACAGAGATCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 5, 3: 20, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368358_1049368368 19 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC 0: 1
1: 1
2: 5
3: 20
4: 209
Right 1049368368 8:142251776-142251798 GCCCACGTTCTCTGTCTTCAGGG No data
1049368358_1049368371 24 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC 0: 1
1: 1
2: 5
3: 20
4: 209
Right 1049368371 8:142251781-142251803 CGTTCTCTGTCTTCAGGGCCCGG No data
1049368358_1049368367 18 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC 0: 1
1: 1
2: 5
3: 20
4: 209
Right 1049368367 8:142251775-142251797 CGCCCACGTTCTCTGTCTTCAGG No data
1049368358_1049368372 25 Left 1049368358 8:142251734-142251756 CCGCGATCTCTGTCTGCAGGGCC 0: 1
1: 1
2: 5
3: 20
4: 209
Right 1049368372 8:142251782-142251804 GTTCTCTGTCTTCAGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368358 Original CRISPR GGCCCTGCAGACAGAGATCG CGG (reversed) Intronic
900651491 1:3732207-3732229 GGGGCTGCAGACAGAGATGAGGG + Intronic
900697962 1:4024030-4024052 GGCCATGAAGACAGAGACAGAGG - Intergenic
903764639 1:25726261-25726283 GGCCCTGGAGACCGTGGTCGTGG - Intronic
904328502 1:29743102-29743124 GGCCCAGCAGGCAGACATCCAGG - Intergenic
904421820 1:30399002-30399024 GGGTCTGCAGAGAGAGATGGGGG + Intergenic
904534598 1:31190768-31190790 GGAGCAGCAGACAGAGACCGTGG - Intronic
905037084 1:34925386-34925408 AGCCCTGCAGACAGATGTGGTGG + Intronic
905278378 1:36833597-36833619 GGCATTGCAGACAGAGGTTGGGG + Intronic
906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG + Exonic
906208297 1:43998550-43998572 GGCCCTGCAGAAGGAAATGGAGG - Intronic
906700818 1:47856839-47856861 GGCCCCGCAGGCAGAGAGAGAGG + Intronic
908912515 1:69088524-69088546 GGCACTACAGGCAGAGATCCAGG - Intergenic
909924667 1:81425636-81425658 GGCACTACAGGCAGAGATCTGGG + Intronic
913989995 1:143602317-143602339 GGCAGTGCAGACACAGATCTTGG + Intergenic
915507723 1:156368097-156368119 GGCCCGGTAGACAGACATGGAGG - Intergenic
915594729 1:156889913-156889935 GGCCCAGCAGGCAGAGCTGGGGG + Intergenic
918276702 1:182959754-182959776 GCAGCTGGAGACAGAGATCGAGG - Intergenic
918824910 1:189312163-189312185 GCCCCTGCAGGCAGAGATCTTGG - Intergenic
919880143 1:201895635-201895657 GGGGCTGCAGGCAGAGACCGTGG + Intergenic
920932324 1:210400556-210400578 GGCCACGCAGAAAGAGATGGTGG - Exonic
922577456 1:226671751-226671773 GGCACTGCAGACAGAGGGAGCGG + Intronic
923563488 1:235059477-235059499 GGCCATCCAGACAGAGAGCGGGG - Intergenic
1062833014 10:618471-618493 CGCACTGCAGACAGAGCTCAAGG + Intronic
1062970216 10:1642350-1642372 GGCCCTGCAGAAAGGGATGCAGG + Intronic
1063214222 10:3909499-3909521 GGCCAAGCAGGCAGAGAACGGGG + Intergenic
1067377914 10:45744823-45744845 GGCTCTGTAGGCAGTGATCGTGG + Exonic
1067885614 10:50085499-50085521 GGCTCTGTAGGCAGTGATCGTGG + Exonic
1073466707 10:103698437-103698459 GGCCCCGCAGACAGGCATCCTGG - Intronic
1075682445 10:124342398-124342420 GGCCATGCATCCAGAGATTGAGG - Intergenic
1075719264 10:124575460-124575482 GGTCCTGCAGAGAGAGAACCGGG - Intronic
1075747959 10:124741388-124741410 GGCCCTGAAGACTGAGTTCTGGG - Intronic
1076130091 10:128008182-128008204 GGGGCTGCAGACAGAGATGGTGG - Intronic
1076444113 10:130500258-130500280 AGCCCTGCAGGCAGAGAGCAAGG + Intergenic
1077285154 11:1762294-1762316 GGAGCTCCAGACTGAGATCGGGG + Intronic
1077842933 11:5994551-5994573 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1079068391 11:17319444-17319466 AGCCCTGCAGACCAAGATCTGGG + Intronic
1079122443 11:17695697-17695719 GGGCCTGAGGACAGAGATGGAGG + Intergenic
1081961248 11:47139210-47139232 GGCTCTGAAGACAGAGTTGGAGG + Intronic
1083291247 11:61691494-61691516 GGCTCTGCAGACACAGTTGGAGG - Intronic
1083339508 11:61950040-61950062 GGCCTTGCAGAGAGAGTTGGGGG - Intronic
1083794070 11:65004472-65004494 GGTGCTGCAGACAGAGACCTGGG + Intergenic
1083865068 11:65449226-65449248 GGCCCTGCAGAAAAACATGGAGG - Intergenic
1083888249 11:65583192-65583214 GGCCCAGGAGACAGAGGTCGGGG + Exonic
1084054974 11:66626153-66626175 GGCCCTGCAGAGAAAGACCTTGG - Intronic
1084064072 11:66693425-66693447 GACCCTGCAGAAAGAGATTCAGG - Exonic
1090065083 11:123496550-123496572 GGCCTTACAGAAAGAGATAGGGG - Intergenic
1090163761 11:124523529-124523551 GGCCCAGGAGACAGAGGTTGCGG + Intergenic
1091936926 12:4441966-4441988 GGGCCTGCACACAGAGAGTGGGG - Intronic
1092082845 12:5732351-5732373 TGTCCTGCAGCCAGAGATCATGG - Intronic
1092386049 12:8036559-8036581 GGCCCTGGAGAGAGAGGTCTGGG + Intronic
1094324828 12:29225959-29225981 GGCTCTGGAGATAGAGATCCTGG + Intronic
1096634715 12:52950840-52950862 GCAGCTGGAGACAGAGATCGAGG + Exonic
1097479341 12:60101582-60101604 TGTCCTGCAGACAGAAATCTTGG - Intergenic
1098398205 12:70044529-70044551 GGCCCCCCAGACAGTGATGGAGG - Intergenic
1100717664 12:97322869-97322891 AACACTGCAGACAGAGATCCAGG + Intergenic
1102028391 12:109726466-109726488 GGCTCTGCAGCCAGTGATCTGGG - Intronic
1103614433 12:122143183-122143205 GGCCCTGCAGGAAGAGAGGGAGG - Exonic
1104823190 12:131690394-131690416 TTCACTGGAGACAGAGATCGAGG + Intergenic
1104873520 12:132017125-132017147 GGCCCTGCAGGCAGTGAGCGGGG - Intronic
1104967710 12:132516531-132516553 GGCACTGAAGACAGAAAACGTGG - Intronic
1105029482 12:132872879-132872901 GGCCCTGCACTCAGAGCTTGTGG + Intronic
1112443797 13:99445215-99445237 GGCACTGCAAGCAGAGATCTGGG - Intergenic
1113922625 13:113922430-113922452 TGCCCTGCACCCAGAGATCTAGG + Intergenic
1114528019 14:23378383-23378405 GGCCATGTAGGCAGAGATGGAGG - Exonic
1117164084 14:53016604-53016626 GACCCTGCAGGCAGAGATCTAGG - Intergenic
1118705980 14:68480578-68480600 AGCACTACAGACAGAGATCTGGG - Intronic
1118717621 14:68571469-68571491 GGCTCTGAAGACAGAGAAAGGGG - Intronic
1119345824 14:73923415-73923437 GGCACTGAAGACAGGGAACGTGG - Exonic
1121562178 14:94884080-94884102 GGCTCCGCAGACAGAGGTTGGGG + Intergenic
1122119861 14:99546480-99546502 GGCCCTGCAGCAAGAGAAAGAGG + Intronic
1122608531 14:102964563-102964585 GGCCCTGGAGGCGGAGATCCGGG - Exonic
1124013793 15:25860220-25860242 GGTGCTGCAGTGAGAGATCGGGG - Intronic
1125029612 15:35063157-35063179 AACCCAGCAGACAGAGGTCGCGG - Intergenic
1128151912 15:65368538-65368560 GGCCCTGCACACAGAGTAAGGGG + Intronic
1129066360 15:72907828-72907850 GGCCCTGCTCACAGAGCTCTGGG + Intergenic
1131132354 15:89908417-89908439 GGCCAGGCAGACAGAGAGTGAGG + Intronic
1132326616 15:100975251-100975273 GGCCAAGCAGCCAGAGATAGTGG + Intronic
1133339536 16:5027620-5027642 GGCCCTGGAGCCAGAGCCCGGGG + Intronic
1134005931 16:10818765-10818787 GGAACTGCGGACAGAGATAGTGG + Exonic
1134625686 16:15721003-15721025 GGCCCTGGAGACCCAGATGGAGG - Exonic
1137599568 16:49747028-49747050 GAGCGGGCAGACAGAGATCGGGG + Intronic
1137743495 16:50803559-50803581 TGCCCTGCAGAAAGAGAATGTGG + Intergenic
1139630602 16:68229903-68229925 GCCCATGCCGACAGATATCGTGG - Exonic
1142112751 16:88340949-88340971 GACCCTGCAGAGAGAGCCCGGGG + Intergenic
1142235700 16:88921545-88921567 GGGGCTGCAGACAGAGAGGGAGG - Intronic
1143375379 17:6464048-6464070 GTCCATGCAGACAGAGATGGGGG + Intronic
1144825833 17:18105246-18105268 GACCCTGCAGGCACAGATGGTGG + Intronic
1145061979 17:19739291-19739313 GGCCCTGCACACAGGCATGGGGG - Intronic
1145862075 17:28219207-28219229 GGCCCTGGAGGCAGAGGTTGCGG + Intergenic
1146202555 17:30872495-30872517 GGCCAAGCAGACAGAGATGTGGG - Intronic
1147443443 17:40461213-40461235 GGGCCTGAAGACAGAGGTTGAGG + Intergenic
1147635263 17:41960059-41960081 CGCCCTGCAGACAGACAGCATGG + Intronic
1151745977 17:76012005-76012027 GGCCCTGCAGGCAGCGCTCCAGG - Exonic
1155043931 18:22087540-22087562 GGCCCTTCAGACGGAGACCAGGG - Intergenic
1156199237 18:34811263-34811285 GGCCCTTCAGAGAAAGATCCAGG + Intronic
1156228636 18:35132918-35132940 GGCCCAGCAGCCAGAGGTGGAGG + Intronic
1157501663 18:48194859-48194881 GGCCCTGCAGAGACACATCTGGG + Intronic
1157568197 18:48694327-48694349 GGCTCTGGAGACAGAGAGCAGGG + Intronic
1158907747 18:62030300-62030322 GGACTTGCACACAGAGATCCTGG + Intergenic
1159006677 18:63019605-63019627 AGCCCTGTAGACAAAGATCAGGG - Intergenic
1160666881 19:335021-335043 GGCCCTGCAGACGGAGCTTAAGG - Intronic
1160690024 19:457316-457338 GGGTTTGCAGACAGAGATCTAGG - Intronic
1160819933 19:1053214-1053236 GTCCCGGCAGACAGAGATCAGGG - Intronic
1160825353 19:1077751-1077773 GGCCTTGCTGAGAGAGATGGGGG + Intronic
1161362419 19:3858204-3858226 GGCCCTACAGAAAGAGCTCTGGG - Intronic
1161524173 19:4743173-4743195 GGCCCTGCAGACACAGACCAAGG + Intergenic
1161592547 19:5135338-5135360 GGCCCTACAGACTGAGAAGGAGG + Exonic
1161596803 19:5154706-5154728 GGCCCAGCAGCCAGGGCTCGGGG + Intergenic
1164304145 19:23988682-23988704 GGCCCTGCCTACAGAGAGCATGG - Intergenic
1165352121 19:35281323-35281345 GGCACTGAAGGCAGAGATCAGGG - Intronic
1166259052 19:41625391-41625413 GGCCCTGCAGACACTGATGGCGG - Intronic
1167761876 19:51454837-51454859 GGCCCTGCAGACAGTGGGAGGGG - Intronic
1167846627 19:52170528-52170550 GGCACTGCAGACAGACAGTGGGG - Intronic
927638393 2:24832006-24832028 GGGCCAGCAGACAGGGACCGGGG + Intronic
928288710 2:30018139-30018161 AGCCCTGCAGGCAGAGAGCCAGG + Intergenic
930107662 2:47652796-47652818 GGCCCTGCAGACCCAGAAGGTGG + Intergenic
932743142 2:74307402-74307424 GTAGCTGGAGACAGAGATCGAGG - Intronic
936042505 2:109160678-109160700 GCCCCTGCAGTCAGAGATCTTGG - Intronic
936786420 2:116098930-116098952 GGCCATGAAGTCAGAGATGGAGG + Intergenic
937094822 2:119228603-119228625 GGCCCAGCAGCCAGAAATCAGGG + Intronic
937114170 2:119392478-119392500 GGCTCTGCATAAAGAGATCAGGG - Intergenic
937295587 2:120807988-120808010 GGCCCTGCTGTCAGAGGGCGTGG + Intronic
942971366 2:181961868-181961890 GCCACTGGAGACAGAGATGGAGG - Intronic
943548660 2:189311928-189311950 GCAGCTGGAGACAGAGATCGAGG - Intergenic
945025536 2:205616291-205616313 GGCAGAGCAGACAGAGATAGAGG + Intronic
946537414 2:220646862-220646884 GGCACTGCAGAAAGAGACCTTGG - Intergenic
948301691 2:236912360-236912382 GTCCCTGCAGAGAGAGAGCCAGG - Intergenic
948931439 2:241134904-241134926 GGCCCTGGAGGCAGAGTTCCGGG + Intronic
1173914630 20:46697839-46697861 GGCCTTGAAGACAGAGAAAGGGG - Intergenic
1174349587 20:49957333-49957355 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1175402070 20:58706696-58706718 GGCCCTGCAGACAGACCCCCAGG + Intronic
1175952748 20:62592164-62592186 GGCCCTGCAGAGAGTGAGCTGGG + Intergenic
1176257512 20:64159929-64159951 GGCCCTGCAGGCAGAGGGTGGGG - Intronic
1179275095 21:39885121-39885143 CTCCCTGCAGTCAGAGATCCTGG - Intronic
1180205994 21:46260979-46261001 GGCCACGCAGACAGGGATTGAGG + Intronic
1180781267 22:18521202-18521224 GCCCTTGCAGACAGACATCACGG + Intergenic
1180973755 22:19832654-19832676 GGCCCTGCACACAGAGCCCAGGG + Intronic
1181000090 22:19984005-19984027 GGCCCAGCAGAGAGAGCTCAGGG - Intronic
1181117584 22:20642680-20642702 AGCCCTGCAGGCAGAGAAGGAGG + Intergenic
1181238152 22:21460544-21460566 GCCCTTGCAGACAGACATCACGG + Intergenic
1182641601 22:31772397-31772419 GGCTCTGCAGATACAGATCCAGG - Intronic
1183248812 22:36713811-36713833 TGCCATGCAGACGGACATCGGGG + Intergenic
1183707072 22:39480728-39480750 GGCCCTGCAGAGACAGATGCTGG + Intronic
1184498345 22:44856900-44856922 CGCGCTGCAGACAGAAATCTGGG + Intronic
1184504084 22:44890737-44890759 GGCCCTGCAGACACAGGTAGAGG + Intronic
1184554955 22:45228048-45228070 GGACCTGCAGATAGAGCTGGGGG + Intronic
1184687628 22:46103777-46103799 GGCCCTGCCGACAAGGGTCGGGG - Intronic
949487084 3:4550199-4550221 GGCCCTGCTCAGAGAGATCTGGG - Intronic
950043448 3:9934401-9934423 GGACCTGCAGATAGAGGGCGTGG - Exonic
950156752 3:10726782-10726804 GGCTCTGCAGTCAAAGATCCAGG - Intergenic
950200484 3:11039329-11039351 TCCCCAGCAGACAGAGATTGGGG + Intergenic
952319142 3:32259528-32259550 GCAGCTGGAGACAGAGATCGAGG + Intronic
954379982 3:50214208-50214230 GCCTTTGCAGACAGAGATGGTGG + Exonic
954690334 3:52392301-52392323 AGCCCTGCAGCCTGAGATGGAGG + Intronic
955469528 3:59272171-59272193 GGCCCTCCAGCAAGAGATCCTGG - Intergenic
958191172 3:90186774-90186796 GGCTCTGGTGACAGAGATCTAGG - Intergenic
961095059 3:124147292-124147314 GGCCCTGCAGATTCAGATCATGG + Intronic
962238981 3:133734190-133734212 GGCTCTCCAGACAGAGCTAGGGG - Intergenic
966809153 3:183827998-183828020 GGCCTTGAAGGCAGTGATCGCGG + Intergenic
967129388 3:186456601-186456623 GGCCCTACAGACAGAGAGAGTGG + Intergenic
968529788 4:1085552-1085574 GGCCCTGCAGCCAGGGACTGCGG - Intronic
969090985 4:4693877-4693899 GCCCCTGCAGCCAGAGAGAGGGG + Intergenic
971684450 4:29746627-29746649 GGCACTGCAGACAGGGAATGTGG - Intergenic
972538722 4:40020830-40020852 GCAGCTGGAGACAGAGATCGAGG + Intergenic
973823697 4:54684778-54684800 GGCCCTGCATCTAGAGATCCTGG + Intronic
979611367 4:122692249-122692271 GGCCATGAAGACAGAGACAGAGG + Intergenic
980625660 4:135371856-135371878 GTACCTGGAGACAGAGATCGAGG - Intergenic
982553597 4:156832789-156832811 GGCCCTGCAGACCGACATATTGG - Intronic
983069516 4:163252482-163252504 GGCTCTGAAGCCAGAGAACGTGG + Intergenic
987631493 5:20478373-20478395 TGCCCTGAAGGCAGAGATCTAGG + Intronic
988885565 5:35553962-35553984 GTCTCTGCATACAGAGATTGTGG + Intergenic
993510660 5:88767819-88767841 GGCCCTTAAGACAGAGTTGGTGG - Intronic
996452057 5:123636697-123636719 GCAGCTGGAGACAGAGATCGAGG + Intergenic
997011228 5:129880809-129880831 GCCCTTGCAGTCAGACATCGTGG + Intergenic
998372202 5:141669183-141669205 GGCCCTGGAGTCAGACATCCTGG - Intronic
1002309666 5:178306800-178306822 GGCCCTGCAGTCAGAGCCTGGGG + Intronic
1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG + Intronic
1003514809 6:6809167-6809189 GGACCTTCAGACAGAGGTGGAGG - Intergenic
1005308985 6:24541311-24541333 GGACCTGCAGAGAGACATCTGGG - Intergenic
1005438286 6:25837959-25837981 GGCCCTGCAGCCATAGCTCCTGG + Intronic
1005761213 6:28969810-28969832 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1006296832 6:33173552-33173574 GGCCCTAGAGACAGAGGTGGGGG + Exonic
1007772990 6:44206145-44206167 TACCCTGCAGGCAGAGATCTAGG - Intergenic
1011840580 6:91493141-91493163 AGCCCTGGAGACAGAGGTTGCGG + Intergenic
1013667332 6:112362117-112362139 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1014009241 6:116457997-116458019 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1015882063 6:137879585-137879607 TGCCCTGTAGACAGAGCTCATGG + Intronic
1018611155 6:165649036-165649058 TGCCCTGCAGAAAGAGAACTAGG + Intronic
1018953748 6:168394588-168394610 GGCCATGGAGAGAGAGATGGGGG + Intergenic
1019771801 7:2887987-2888009 GGCCCAGCAGAAAGAGACCTTGG - Intergenic
1020105977 7:5422516-5422538 GCTGCTGCAGACAGAGATCGAGG - Intronic
1023854304 7:44172497-44172519 GGCCCTGAAGACAGAGTGCCAGG - Intronic
1024286699 7:47763913-47763935 GGTCCCGCAGAAAGAGATGGAGG + Intronic
1026456149 7:70574318-70574340 GTCCCTGCAGAGAGAGCTCTGGG + Intronic
1027124545 7:75546950-75546972 GGACCTCCAGAGAGAGATTGTGG - Exonic
1029375730 7:100176059-100176081 GGCCCTGGAGACAGAGTCTGGGG + Intronic
1034276308 7:149825357-149825379 GTCCCTGCAGACACTGAACGCGG - Intergenic
1035466787 7:159084596-159084618 GGCCCTGCAGACACTGACCAGGG - Intronic
1036049875 8:5184491-5184513 GGCACTACAGACAGAGATCTTGG - Intergenic
1036396545 8:8376207-8376229 TGCCCTGCAGACAGAGTCCCAGG + Intronic
1036456598 8:8914482-8914504 GGCCCGGGAGGCAGAGATTGCGG + Intergenic
1036741010 8:11361735-11361757 GTCTCTGAATACAGAGATCGGGG - Intergenic
1039881902 8:41630449-41630471 GGGCCTGCAGACAGGGGTAGGGG - Intergenic
1039970877 8:42320770-42320792 GGCTCTGCAGACCGACATTGTGG + Exonic
1040105387 8:43538653-43538675 GGCTCTGCAGAGAGTGATCATGG - Intergenic
1044749628 8:95403456-95403478 GGCCCTGCAGACCTAGGTCCAGG - Intergenic
1044884441 8:96761593-96761615 GGCTCTGCAGTCACAGATCTGGG + Intronic
1045636576 8:104198641-104198663 GGCATTCCAGACAGAGATCCAGG + Intronic
1047950750 8:129932777-129932799 GGCCCTGCAGACTGAGTTCTGGG + Intronic
1048524622 8:135190718-135190740 GGGCCTCCAGACAGAGCTCCTGG - Intergenic
1049368346 8:142251690-142251712 GGCCCTGCAGATAGAGAACGCGG - Intronic
1049368358 8:142251734-142251756 GGCCCTGCAGACAGAGATCGCGG - Intronic
1049368370 8:142251778-142251800 GGCCCTGAAGACAGAGAACGTGG - Intronic
1049368382 8:142251822-142251844 GGCCCTGCAGATAGAGAACGCGG - Intronic
1049368394 8:142251866-142251888 GGCCCTGAAGACAGAGAATGCGG - Intronic
1049368405 8:142251910-142251932 GGCCCTGCAGACAGAGAACGCGG - Intronic
1049368417 8:142251954-142251976 GGCCCTGAAGACAGAGAACATGG - Intronic
1049368439 8:142252042-142252064 GGCCCTGCAGATAGAGAACGTGG - Intronic
1049368461 8:142252130-142252152 TGCCCTGCAGACAGAGAACGCGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049679821 8:143913143-143913165 GGCCCTGGAGTCAGGGGTCGGGG + Intergenic
1051549806 9:18315668-18315690 GGGGCTGCAAACAGAGCTCGTGG - Intergenic
1057186011 9:93058105-93058127 GGCCCTGCAGACAGACCCCAGGG + Intergenic
1059138377 9:111829296-111829318 AGACCTGCAGACAGGGATTGTGG + Intergenic
1059285459 9:113168338-113168360 GGCCCTGCACACAGAGTCCAGGG + Intronic
1060188472 9:121577877-121577899 GGCCCTGCAGCCTGAGGTCAGGG + Intronic
1060348610 9:122838134-122838156 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1061056168 9:128224146-128224168 GGCCCCTCAGGCAGAGTTCGTGG + Intronic
1062204151 9:135326452-135326474 GGCCCTGGACACAGAGACCCTGG + Intergenic
1203773590 EBV:61226-61248 GGCCCCGCGGACAGACGTCGAGG - Intergenic
1185466542 X:358402-358424 GGCCCTGCAGGCGGAGAGCATGG - Intronic
1188364766 X:29302114-29302136 GGACCTGAAGACAGTGATCCAGG + Intronic
1189928644 X:45983952-45983974 GTAGCTGGAGACAGAGATCGAGG + Intergenic
1195659387 X:107363113-107363135 CTCCCTGCATACAGAGATCTGGG + Intergenic
1197617897 X:128715093-128715115 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1200085876 X:153604737-153604759 GCAGCTGGAGACAGAGATCGAGG - Intergenic