ID: 1049368588

View in Genome Browser
Species Human (GRCh38)
Location 8:142252830-142252852
Sequence AATGGCTGAGGGGTGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1297
Summary {0: 1, 1: 1, 2: 9, 3: 119, 4: 1167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368588_1049368597 -8 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368597 8:142252845-142252867 CAGCCATTTCCTCTGCACAATGG No data
1049368588_1049368602 22 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368588_1049368603 23 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368588_1049368604 24 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368588_1049368606 28 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368588_1049368601 7 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368588_1049368598 -7 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368598 8:142252846-142252868 AGCCATTTCCTCTGCACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368588 Original CRISPR AATGGCTGAGGGGTGGGGAG GGG (reversed) Intronic
900351523 1:2237216-2237238 AGTGGGTGAGGGGTGGTGGGAGG + Intronic
900463000 1:2810245-2810267 ACTGGCTGCGGGGGGGGGGGGGG + Intergenic
900572143 1:3363922-3363944 AAGGGCTGAGGTGTGCGTAGCGG - Intronic
901107242 1:6766094-6766116 AAGGGGTTAGGGGTGGGGTGTGG - Intergenic
901145573 1:7062501-7062523 AATGGCTGGGCGCCGGGGAGAGG + Intronic
901217525 1:7563083-7563105 AATAGCTTGGGGCTGGGGAGGGG - Intronic
901401914 1:9020551-9020573 AAAGGCGGGGGGGTGGGGGGGGG - Intronic
901512447 1:9724258-9724280 AACAGCTGAGGGGAGGGGAGAGG - Exonic
901771588 1:11533137-11533159 AGTGGCTGTGGGAGGGGGAGAGG - Intronic
901820380 1:11825475-11825497 AATGGCTGAGCTGAGGGAAGGGG - Intronic
901844012 1:11970983-11971005 AGGGACTGAGGGGTGGGGATGGG + Intronic
902204943 1:14861606-14861628 AATGAATTAAGGGTGGGGAGGGG - Intronic
902333505 1:15742430-15742452 AAAGGCCCAGGGGAGGGGAGGGG - Exonic
902346317 1:15820742-15820764 AATGGATGTGGGTTGGAGAGTGG - Intergenic
902365302 1:15969387-15969409 GGGGGCTGAGGGGTGGGGGGTGG - Intronic
902719041 1:18292023-18292045 AAGGGCGGAGGGATGGGGAGTGG + Intronic
903014509 1:20353325-20353347 GATGGATTGGGGGTGGGGAGAGG + Intronic
903033128 1:20477466-20477488 GATGGCAGTGGGGTGGGGTGGGG - Intergenic
903328814 1:22586529-22586551 AGTGGCTGTGGGGAGGGCAGCGG - Exonic
903462965 1:23531739-23531761 AATGGCAGAGGGGTGAGGGACGG + Intergenic
903475649 1:23617607-23617629 AATGGCAATGGGGTGGGGTGGGG - Intronic
903750948 1:25620153-25620175 AGTGGCTGGAGGGTGGGAAGAGG + Intronic
903756886 1:25668454-25668476 AATGGATGTCAGGTGGGGAGAGG + Intronic
903829438 1:26165714-26165736 AACCACTGAGGGCTGGGGAGGGG - Intergenic
904314224 1:29649943-29649965 AATGGATGCTGGGTGGGGAAAGG + Intergenic
904416603 1:30365596-30365618 AAGGGAAGAGGGGAGGGGAGGGG + Intergenic
904499386 1:30905402-30905424 AAGGCAGGAGGGGTGGGGAGTGG - Intronic
904542120 1:31239986-31240008 AACGGCAGAGGGGTGGGGCGGGG + Intergenic
904703764 1:32375260-32375282 AATAGGTTAGGGGTGGGGTGGGG + Intronic
905037120 1:34925510-34925532 ACTGAGTGAGGGGAGGGGAGAGG + Intronic
905140771 1:35842316-35842338 CATGGATGAGGGTAGGGGAGCGG - Intronic
905168267 1:36096260-36096282 AGGGACTGAGGGGTTGGGAGGGG + Exonic
905314236 1:37071283-37071305 ACTGTCTGTGGGGTGGGGGGAGG - Intergenic
905461467 1:38125592-38125614 ACAGAATGAGGGGTGGGGAGAGG - Intergenic
905864347 1:41368622-41368644 ATGGGTTGGGGGGTGGGGAGAGG - Intronic
905874333 1:41422551-41422573 GGTGGCTGAGGGACGGGGAGAGG + Intergenic
906026770 1:42681109-42681131 AATGGCTGCGGAGTGGAGAATGG - Intergenic
906251567 1:44314654-44314676 AAGGGCTGGGGGGCTGGGAGTGG + Intronic
906483563 1:46217534-46217556 TATGGCAGGGGAGTGGGGAGTGG + Intronic
907280174 1:53342146-53342168 ATGGGGTGAGGGGTGGGGAGAGG - Intergenic
907287184 1:53389434-53389456 TGTGGCCCAGGGGTGGGGAGGGG + Intergenic
907483829 1:54763111-54763133 AATTGCTGGGGGTTGGGGGGAGG - Intronic
908344269 1:63215577-63215599 AGTGGGTGGGGGGTGGGTAGGGG + Intergenic
908681185 1:66663213-66663235 AGTGGGTGGGGGATGGGGAGGGG - Intronic
910210903 1:84791901-84791923 AGTGGCTGAGGTGTGGGGCCGGG + Intergenic
910355090 1:86344170-86344192 AAGGGTTGTGGGGAGGGGAGGGG - Intergenic
910359837 1:86404542-86404564 GAGGGTGGAGGGGTGGGGAGGGG + Intergenic
910421282 1:87066492-87066514 GATGGCACAGGGGTGGGGAGTGG - Intronic
910474494 1:87592090-87592112 AATGACAGAGGGAAGGGGAGAGG - Intergenic
910477653 1:87624025-87624047 AGAGGCCGGGGGGTGGGGAGGGG - Intergenic
910745961 1:90575277-90575299 AGTGGCCAGGGGGTGGGGAGGGG + Intergenic
910747591 1:90590696-90590718 ATTGTCTGAGGGGTGAGCAGAGG - Intergenic
911821568 1:102430338-102430360 ATTTGTTGTGGGGTGGGGAGAGG + Intergenic
912624680 1:111197329-111197351 CAAGGCTGAGGGCTGGGGAGGGG + Intronic
912978215 1:114348571-114348593 AAGGGCTGGGGGCTGGGCAGAGG + Intergenic
913050821 1:115115239-115115261 AATGGCACAGGGCTGGTGAGCGG + Intergenic
913058556 1:115183944-115183966 ACTGGGTAGGGGGTGGGGAGTGG - Intergenic
913173730 1:116255477-116255499 TGTGGCTGGGGGGTGGGGGGCGG - Intergenic
913275795 1:117136701-117136723 AAAGGGTGGGGGGTGGGGTGGGG + Intergenic
913590852 1:120323242-120323264 GACGGTTGTGGGGTGGGGAGAGG - Intergenic
915109241 1:153552614-153552636 GAGGCCTGAGGGGTGGGGTGGGG + Intergenic
915197284 1:154199150-154199172 AAGGGGGCAGGGGTGGGGAGGGG - Intergenic
915328691 1:155094859-155094881 AAAGGCGGAGAGGTGGGGAATGG - Intergenic
915353419 1:155240752-155240774 AGTAGTTGAGGGGTGGAGAGGGG - Intronic
915360464 1:155283548-155283570 AATGGGTGGGGGGAGGGGGGAGG - Intronic
915508760 1:156374253-156374275 AATGGTTGGGGGGTGGGGGATGG - Intronic
915675576 1:157526902-157526924 AGTGGCTGACTGGTGTGGAGAGG + Intronic
915729512 1:158043349-158043371 AATGGAGGAGGGGTGGGGTCAGG - Intronic
915736128 1:158086597-158086619 AATTGCTGAAGGATGGGAAGAGG + Exonic
915911457 1:159918198-159918220 TGTGGCTAAGGGGTGGGGTGAGG - Exonic
915917586 1:159950289-159950311 GGTGTCTGAAGGGTGGGGAGAGG - Intergenic
916124013 1:161553211-161553233 ATTGGCTGAGGGGTGATGAAGGG + Intergenic
916133896 1:161634573-161634595 ATTGGCTGAGGGGTGATGAAGGG + Intronic
916334475 1:163654839-163654861 CATGACTGAGGAGTGGTGAGTGG - Intergenic
916561812 1:165940257-165940279 AATTGCAGAGGGGAGTGGAGAGG - Intergenic
916682037 1:167113757-167113779 AATGGCTGAGGAGAGGTGAATGG - Exonic
916769626 1:167895386-167895408 ATAGGCAGTGGGGTGGGGAGTGG - Intronic
916980593 1:170132219-170132241 AGTGGAGGAGGGGTGGAGAGGGG - Intergenic
917077464 1:171220262-171220284 AAAGCCTCGGGGGTGGGGAGGGG + Intergenic
917665022 1:177218039-177218061 CATGGGTGAGGTGTGGGGATGGG + Intronic
917839189 1:178963727-178963749 CATGGGTGAGGGGTGGCTAGGGG + Intergenic
917923234 1:179768001-179768023 AAGGACTGAGGGAAGGGGAGAGG - Intronic
918048835 1:180956941-180956963 TAAGGCTGAGGAGTGGGGAGAGG - Intergenic
918112801 1:181472211-181472233 AGTGGGTGGGGGGTGGGGACTGG + Intronic
918114416 1:181484298-181484320 AAGGGAGTAGGGGTGGGGAGGGG - Intronic
918223720 1:182459089-182459111 AATGGGTGTGGGATGGGAAGTGG + Intronic
918248192 1:182679246-182679268 AATGGCAAAGGGGTTAGGAGGGG - Intronic
918385717 1:184005405-184005427 AGTGGCAGAAGGATGGGGAGTGG + Intronic
918547527 1:185701510-185701532 AATGACTGAGGGCTGGGGAAGGG - Intergenic
918815694 1:189178501-189178523 AATGGCTGATGAGTCGGGATTGG + Intergenic
919158144 1:193793357-193793379 AGAGGCTGAGGGTTGGGGTGGGG + Intergenic
919996583 1:202757083-202757105 AAGGGCTGGGAGGTGGGGGGGGG + Intronic
920172712 1:204081775-204081797 TAGGGCTGGAGGGTGGGGAGAGG - Intronic
920185892 1:204159359-204159381 AAGGGCTGAGGTGGGGGGACAGG - Intronic
920434288 1:205938189-205938211 GGAGGCTGAGGGGTAGGGAGAGG - Intronic
920439863 1:205972715-205972737 CATGGCTGAGGGGTAAGGTGGGG - Intergenic
920442270 1:205989142-205989164 GATGGAGGAGGGGTGAGGAGAGG - Intronic
920531685 1:206706920-206706942 AATGAATGAGGGGTAGGGAAGGG - Intronic
920658185 1:207891951-207891973 AATGGCTGGAGGGTGAGCAGAGG + Intronic
920879727 1:209868408-209868430 CAGGACTGAGGGGTGGGGTGTGG - Intergenic
920949839 1:210562387-210562409 AAGGGCCAAGGGGTGGGGGGTGG + Intronic
921387513 1:214585955-214585977 AATGGTAGAGGGGTGGGGTCAGG + Intergenic
921840746 1:219825728-219825750 AAGGCCAGAGAGGTGGGGAGAGG + Intronic
922212292 1:223495516-223495538 AATGGGTGAGGAGGGAGGAGTGG - Intergenic
922314181 1:224427350-224427372 AATGGGGGAGGGGTGGGCATAGG - Intronic
922344105 1:224681693-224681715 AATGGATGCTGGGTGGGGACAGG + Intronic
922536407 1:226384248-226384270 ACTGGCGGTGGGGTGGGGAGAGG + Intronic
922574278 1:226651886-226651908 AATGGAGGAGGTGTGGGCAGAGG - Intronic
922729029 1:227940529-227940551 AGTCACTGTGGGGTGGGGAGGGG - Intronic
923410542 1:233704476-233704498 GATGGCAGGGTGGTGGGGAGCGG + Intergenic
923818450 1:237406217-237406239 GATGGGAGAGGGGAGGGGAGGGG - Intronic
924280797 1:242435024-242435046 AAGGGCTGGGGAGTGAGGAGGGG - Intronic
924415005 1:243849916-243849938 GATGGCGGCGGGGTGGGGTGAGG - Intronic
924620280 1:245654300-245654322 TAATGATGAGGGGTGGGGAGGGG + Intronic
924627462 1:245707638-245707660 ATGGGCTGGGGGATGGGGAGAGG + Intronic
924711689 1:246534774-246534796 AATGGCTGAAGGCTGGCAAGGGG - Intergenic
924732840 1:246727806-246727828 CATGGCAGAGAGGTGGAGAGTGG + Intronic
1063353116 10:5374224-5374246 GAGGGCAGCGGGGTGGGGAGGGG + Exonic
1064114761 10:12568319-12568341 GAGGGGGGAGGGGTGGGGAGAGG - Intronic
1064479115 10:15721698-15721720 AAAAGTTTAGGGGTGGGGAGTGG + Intergenic
1064479508 10:15725416-15725438 AAAGGGTGGGGGGTGGGGAGAGG + Intergenic
1064536191 10:16360152-16360174 AATGGGGGAGGGGTTGAGAGAGG + Intergenic
1064726489 10:18285147-18285169 TATGGCTCATGGGTTGGGAGAGG - Intronic
1064805170 10:19122283-19122305 TAGGGCTGATGGTTGGGGAGTGG + Intronic
1064950645 10:20845856-20845878 GATGCCTGAGGGTTAGGGAGGGG + Intronic
1065010276 10:21414960-21414982 AATGGCGGTGGGGCGGGGGGGGG - Intergenic
1065218675 10:23474428-23474450 AATGCAAGAGGGGAGGGGAGGGG - Intergenic
1065273514 10:24062287-24062309 GATGGTTGTGGGGTGGGGGGAGG - Intronic
1065508701 10:26456077-26456099 GATTGCTAAGGGATGGGGAGAGG + Intronic
1065574090 10:27101036-27101058 AAAGGCAGAGGGGTGGGGGAAGG - Intergenic
1065695307 10:28374301-28374323 AAGGGCTGTGGGGTGAGGTGGGG - Intergenic
1066023396 10:31325649-31325671 AATGGGGGAGGGGAAGGGAGAGG - Intronic
1066286557 10:33972116-33972138 AATTGCTTAGGGCTGGGGAGGGG - Intergenic
1066349338 10:34622988-34623010 CATGGCTGAGGGGCCAGGAGAGG - Intronic
1066963689 10:42242620-42242642 AGTGGCTGAGGGGTCGGGTCCGG - Intergenic
1067023869 10:42826893-42826915 AATGGCAGCTGGGAGGGGAGGGG + Intronic
1067549987 10:47227443-47227465 CATGGCTAAGAGGTGGGGTGAGG - Intergenic
1067823439 10:49550801-49550823 AATGGCGGGGGGGGGGGGGGGGG + Intergenic
1067844577 10:49709710-49709732 TAGGGCTGTGGGGTGGGCAGTGG - Exonic
1068585809 10:58796922-58796944 TCTGTATGAGGGGTGGGGAGGGG + Intronic
1069625796 10:69867031-69867053 AAAGGAATAGGGGTGGGGAGCGG - Intronic
1069860005 10:71464640-71464662 AATGTCAGGGTGGTGGGGAGGGG + Intronic
1070059463 10:72968018-72968040 GCTGCCTGAGGTGTGGGGAGGGG + Intergenic
1070270460 10:74949377-74949399 AATTTCTTAGGGGTGGGGCGCGG - Intronic
1070497152 10:77034994-77035016 GAGGGCAGAGGGGAGGGGAGGGG - Intronic
1070782560 10:79146173-79146195 GAAGGCTGAGGGGTGGAGAGTGG - Intronic
1070782869 10:79147678-79147700 AATGGCAGTGGGGTGGGAAATGG - Intronic
1070825180 10:79386642-79386664 ACCCGATGAGGGGTGGGGAGAGG + Intronic
1071505995 10:86231936-86231958 ATTGGGTGAGGGATGGGGTGAGG + Intronic
1071690922 10:87818669-87818691 GAGGGATGAGGGGTGAGGAGTGG - Intronic
1071783986 10:88879359-88879381 AATGGCTGCAGAGTGGGGTGGGG - Intergenic
1072751556 10:97984141-97984163 TATGTCTGAGGGGTGGGGCAGGG + Intronic
1072761224 10:98058656-98058678 TATGGCTGGGGGTTGGGTAGGGG - Intergenic
1073093760 10:100967813-100967835 AATGGCTGGGGGGGGGGGGGGGG - Intergenic
1073104945 10:101027234-101027256 GAGGGCGGAGGGGTGGGCAGAGG - Intronic
1073447998 10:103592426-103592448 AGAGGCTGAGGGTTGGGGAGAGG + Exonic
1073494386 10:103878447-103878469 CATGAATGTGGGGTGGGGAGTGG + Intergenic
1073998673 10:109345265-109345287 AGAGGCTTAGGAGTGGGGAGAGG + Intergenic
1074078785 10:110151793-110151815 TATGAGTGAGGGGTGGGCAGGGG - Intergenic
1074115899 10:110457430-110457452 AAATGGTGAGGGGTGAGGAGAGG + Intergenic
1074169574 10:110919479-110919501 CACGGCAGAGGGGTGGGGCGGGG + Intergenic
1074182485 10:111076905-111076927 ACTGGCGGAGGGGTGGTGCGAGG + Intergenic
1074326365 10:112455287-112455309 AGTGGAGGAGGGGAGGGGAGGGG - Intronic
1074378861 10:112961822-112961844 CGTGGCTGGGGGGTGGGGTGGGG + Intronic
1074406058 10:113181136-113181158 AATGGCAGGGGGGTGAGGAGGGG - Intergenic
1074409205 10:113211028-113211050 GATGGGAGAGGGGAGGGGAGGGG - Intergenic
1074862917 10:117525832-117525854 ACTGCAGGAGGGGTGGGGAGAGG + Intergenic
1074919560 10:117993402-117993424 AAAGGCTTGGGGGTGGGGTGTGG + Intergenic
1075313772 10:121435826-121435848 AATTGCTTAGGGGTGGGGACTGG - Intergenic
1075726308 10:124612643-124612665 AATGGCTGAAGGCTTTGGAGAGG + Intronic
1075816393 10:125267736-125267758 AGAGGCTGAGAAGTGGGGAGAGG - Intergenic
1075939356 10:126375984-126376006 AGAGGCTGGGGGGTGGGGAGGGG - Intronic
1076053341 10:127352218-127352240 CATCGGGGAGGGGTGGGGAGGGG + Intronic
1076053359 10:127352258-127352280 CATCGGGGAGGGGTGGGGAGGGG + Intronic
1076072740 10:127504634-127504656 AATTGCTTAGGGATGGGAAGGGG + Intergenic
1076236749 10:128869334-128869356 GGGGGCTTAGGGGTGGGGAGGGG + Intergenic
1076254405 10:129010375-129010397 AATTGTTGTGGGGTGGGGGGAGG - Intergenic
1076487915 10:130836115-130836137 AGAGGCTGGGGGGTTGGGAGTGG - Intergenic
1076683477 10:132186789-132186811 AGTGGCTGAGGGCGGGGGCGGGG + Intergenic
1076811713 10:132889686-132889708 AATGCATGAGGGGTGGGGTCCGG - Intronic
1076977364 11:184497-184519 AATGGATTAGGGTTGGGGGGTGG - Intronic
1077101405 11:824135-824157 GAGGGCTGGGGGGTCGGGAGAGG + Intronic
1077538306 11:3134831-3134853 AGGGGCTGAGGGTGGGGGAGGGG + Intronic
1077892546 11:6429937-6429959 AATGGCTGACAGGTTGGGAGGGG + Intergenic
1077948619 11:6929776-6929798 AAATGCTGTGGGGTGGGGGGAGG - Intronic
1078145019 11:8716523-8716545 ATTTGCTGAGGAGTGAGGAGAGG - Intronic
1078253659 11:9639099-9639121 AATTGCTGATGGGTAGGAAGTGG + Intergenic
1078362174 11:10677519-10677541 TATGGTTGAGGGGAGGGGACGGG - Intronic
1078382016 11:10850994-10851016 AATCGCTGGGGGATGGGGGGCGG + Intronic
1078703089 11:13708746-13708768 CATGGCTGGGGGGTGGTGAGGGG - Intronic
1079083326 11:17428708-17428730 AGGGGCAGAGGGGAGGGGAGAGG + Intronic
1079086386 11:17448486-17448508 ATGGGCTGAGGGGAAGGGAGGGG - Intronic
1079088734 11:17465671-17465693 AATGGGAGAGGTGTGGGGCGAGG - Intronic
1079124598 11:17709612-17709634 AATGCTTGAGGGGTTGGGGGAGG + Intergenic
1079129337 11:17738311-17738333 TGTGGCTGAGCTGTGGGGAGGGG + Intronic
1079335166 11:19564608-19564630 AGGGGCTGAGGGGCGGGGCGGGG + Intronic
1079408108 11:20162829-20162851 AATGGCTGGGGCTTGGGGTGGGG - Intergenic
1079534605 11:21497151-21497173 GATGGCTGGGGTGGGGGGAGGGG + Intronic
1080171714 11:29311605-29311627 AATGGCTGAGAGGTGACGAATGG - Intergenic
1081159456 11:39735092-39735114 AGTGGAGAAGGGGTGGGGAGTGG - Intergenic
1081487633 11:43544108-43544130 AATGCTTGTGGGGTGGGGTGAGG + Intergenic
1081867940 11:46369894-46369916 ACTGGGTGAGGGGTGGGCAGGGG - Intronic
1081868438 11:46372308-46372330 AAGGGGTGAGGGGTGGAGAAAGG - Intronic
1081873943 11:46396361-46396383 GATGGGGGAGGGGTGGGGATTGG - Intergenic
1082072836 11:47952772-47952794 GATGGCAGGGGGGTGGGGGGTGG + Intergenic
1082164643 11:48930998-48931020 ACTGGTTGTGGGGTGGGGGGAGG + Intergenic
1082262834 11:50090501-50090523 AATTGGTGGGGGGTGGGGGGTGG - Intergenic
1082679691 11:56152664-56152686 TATGGATGCTGGGTGGGGAGTGG - Intergenic
1082807840 11:57461432-57461454 ACTGGGGGTGGGGTGGGGAGGGG + Intronic
1083257304 11:61504554-61504576 AATGTGTGGGGGGTGGGGAGGGG - Intergenic
1083595802 11:63917767-63917789 AAGGGCTGAGGGATGGGGAGTGG + Intergenic
1083652533 11:64211583-64211605 TACGGCCGTGGGGTGGGGAGGGG - Intronic
1083682248 11:64357070-64357092 ACTGGCTGAGGGATGGGGTGAGG - Exonic
1083910147 11:65702988-65703010 AGGGGCTGAGGGGAGGGGAATGG + Intergenic
1084269924 11:68023258-68023280 ACTGGCTGAGGGCCGGGGAAGGG - Intronic
1084305761 11:68282452-68282474 AAGAGATGGGGGGTGGGGAGGGG - Intergenic
1084538254 11:69770936-69770958 CATGGCTGGGGGTTGGGGTGGGG - Intergenic
1084579501 11:70014314-70014336 AGCGGCTCAGGGGCGGGGAGTGG - Intergenic
1084614460 11:70226463-70226485 AATGGCTGGGGGGTGGGGGATGG + Intergenic
1084901767 11:72315135-72315157 AAGGGGTGAGGGGGAGGGAGGGG + Intronic
1084907431 11:72358821-72358843 AGTGGAAGAGGGGTGGGGTGGGG - Intronic
1084937629 11:72595525-72595547 GATGGCTGAGAGGGGAGGAGAGG - Intronic
1084956485 11:72694260-72694282 ACTCGCTGATGGGTGGGGAGAGG - Intronic
1084973416 11:72783510-72783532 AACTGCTGAGGCCTGGGGAGGGG - Intronic
1085185025 11:74568568-74568590 AGTTGCTCAGGGCTGGGGAGGGG - Intronic
1085287704 11:75374919-75374941 AGTGGCCTAGTGGTGGGGAGAGG + Intergenic
1085290589 11:75396380-75396402 GATGGATGGGGGGTGGGGGGGGG + Intergenic
1085403064 11:76246017-76246039 ACTGGCTGAGGGGGTGAGAGGGG + Intergenic
1085431659 11:76455906-76455928 AATGTCTGAGTGATGGGGAAAGG - Intronic
1085996069 11:81915522-81915544 AATGTGTGTGGGGTGGGGTGGGG + Intergenic
1086055082 11:82636795-82636817 CATGGCTGTGGTGTGTGGAGGGG - Intergenic
1086436167 11:86782879-86782901 ATTGGCCTTGGGGTGGGGAGTGG + Intergenic
1086461437 11:87009480-87009502 GATGGGAGAGGGGTGCGGAGGGG + Intergenic
1087237222 11:95733472-95733494 AATGGAGGAGGGGTGGGGTTTGG - Intergenic
1088799072 11:113289209-113289231 AGTGGGGTAGGGGTGGGGAGGGG - Intergenic
1088872299 11:113901106-113901128 AAAAACTGAAGGGTGGGGAGAGG + Intergenic
1088913873 11:114212350-114212372 AATGCCTGGGGGAGGGGGAGAGG - Intronic
1088992878 11:114969926-114969948 AAAGGATGAGAGGTGGGGAGGGG + Intergenic
1089395240 11:118132335-118132357 AATGGCTATTGGGTGGGGAAAGG + Intergenic
1089396730 11:118141045-118141067 AGGGGCTGAGAGATGGGGAGGGG + Intronic
1089491411 11:118886473-118886495 AGGGGCTGGGGGGTGGGGACGGG + Intronic
1089533124 11:119144815-119144837 AGTCTCTGAGGGGTCGGGAGAGG + Intergenic
1089577932 11:119459944-119459966 AGTGGCTTTGAGGTGGGGAGAGG + Intergenic
1089728940 11:120508515-120508537 AATGGATGATGGGTGAGGTGGGG + Intergenic
1089984986 11:122804204-122804226 ACTGGGTGAGAGGTGGGGATGGG + Intronic
1090056872 11:123431124-123431146 AGTGGCTGAGGGTGAGGGAGCGG + Exonic
1090190120 11:124761777-124761799 GCTGGGTGGGGGGTGGGGAGTGG + Intronic
1090384205 11:126347187-126347209 AATGGCTGAGTGGAGGCCAGTGG - Intergenic
1090419221 11:126562529-126562551 GCTGGCTGTGGGGTGGGGTGCGG + Intronic
1090887583 11:130892891-130892913 AAGGGCAGAGAGGTGGGGTGGGG + Intronic
1091413838 12:262958-262980 AGTGGCCGAGGGGAGGGGAGGGG - Intergenic
1091528687 12:1333097-1333119 AATGGAGGAGGGGGGGTGAGAGG - Intronic
1091561680 12:1619130-1619152 AATGTCTTAGGGGTGGGGAGGGG - Intronic
1091782543 12:3222964-3222986 TAAGGCAGAGGGGTGGGGTGTGG + Intronic
1092235719 12:6807557-6807579 AGGGGCTCAGGGATGGGGAGGGG + Intronic
1092278542 12:7081425-7081447 AATGACGGAGGTGTGGGGATGGG - Intronic
1092284359 12:7120327-7120349 GTTGGCTGAGGTCTGGGGAGAGG + Intergenic
1092449995 12:8593251-8593273 GATGGGGGAGGGGAGGGGAGGGG + Intergenic
1092843241 12:12562556-12562578 AAAGGCGGGGGGGTGGGGTGGGG + Intergenic
1092968487 12:13668993-13669015 AATGGAGGGGAGGTGGGGAGGGG + Intronic
1093058202 12:14575919-14575941 AAAGGCTGAGGTGAGGTGAGAGG + Intergenic
1093076036 12:14759938-14759960 CATGGCTGTGGGGGGGGGTGGGG - Intergenic
1093758502 12:22879349-22879371 AAGGGGTGAGGGGTTGGGGGAGG - Intergenic
1094184469 12:27626336-27626358 AGAAGCTGAGGCGTGGGGAGAGG + Intronic
1094592851 12:31837674-31837696 GGAGGCTGAGGGGTGGGGGGTGG - Intergenic
1095094499 12:38138489-38138511 AATGGCTGAGGCGTGGGTGTCGG + Intergenic
1095587329 12:43863701-43863723 AATGGCTGAGAGGTGGTGAGAGG + Intronic
1095686940 12:45047408-45047430 AAGGGCTCAGGGCTAGGGAGGGG - Intronic
1095963478 12:47850860-47850882 AATGCGGGAGGGGAGGGGAGGGG - Intronic
1095964481 12:47857684-47857706 AATGACTGTGGGGTGGGAAGGGG + Exonic
1095989885 12:48027393-48027415 AAAGGCTGAGGCCTGGGGCGAGG - Intergenic
1096027544 12:48380115-48380137 GATGGCTAAAGGGTGGGGCGGGG + Intergenic
1096121886 12:49093896-49093918 AATGGCTGAGGCGTGGACCGGGG - Intronic
1096178447 12:49538328-49538350 AAAGGGTGTGTGGTGGGGAGGGG - Intergenic
1096230639 12:49895040-49895062 GAGAGCTGAGGGGTGTGGAGCGG + Intronic
1096352365 12:50911124-50911146 AATGGCTAAGAGGAGGAGAGAGG - Intergenic
1096465587 12:51846620-51846642 TATGGCTGAGGGCTGGGCTGAGG - Intergenic
1096499343 12:52055672-52055694 AGGGGCTGGGGGGTGGGGACGGG - Intronic
1096560105 12:52430002-52430024 GATTGCTGAGGAGTGGGGAGAGG - Intronic
1096755820 12:53798697-53798719 AAGGCCTGATGGGTGGGGAGGGG + Intergenic
1096780555 12:53989481-53989503 AAGGGAGGAGGGGCGGGGAGAGG - Exonic
1097269272 12:57764428-57764450 AGTGGCTGAGGGGTAGGCACTGG + Exonic
1097574712 12:61377283-61377305 GATGGTTGTGGGGTGGGGGGAGG - Intergenic
1097744739 12:63288625-63288647 AATGGCTGTGGGATAGGGAAAGG - Intergenic
1097979075 12:65718448-65718470 AATGGCAGAGAGGTGGAGAGTGG - Intergenic
1097999667 12:65926421-65926443 AATGCCTCGGAGGTGGGGAGAGG + Intronic
1098073761 12:66703840-66703862 CATGTGTGTGGGGTGGGGAGAGG + Intronic
1098253767 12:68595518-68595540 AATGGCTGTGTTTTGGGGAGGGG - Intergenic
1098512387 12:71332010-71332032 AGAGGCTGAGCTGTGGGGAGGGG + Intronic
1099224200 12:79949530-79949552 AAAGGCAGAGGGAAGGGGAGAGG - Intergenic
1099248535 12:80223024-80223046 AAAGGCTGGGGGGTGATGAGGGG - Intronic
1099413401 12:82358969-82358991 ATTAGTTGAGGGGTGGGGTGGGG + Intronic
1099572459 12:84341174-84341196 GATGGTTGTGGGGTGGGGGGAGG - Intergenic
1099669572 12:85673503-85673525 CATGGCGGTGGGGTGGGGGGGGG - Intergenic
1099672518 12:85712612-85712634 AGTGGCTGAGGGCTGGGGGTTGG - Intergenic
1099675840 12:85759501-85759523 AAAGGAAGAGGGGAGGGGAGGGG + Intergenic
1099721743 12:86370903-86370925 GATGGCAGAGGGGTGAGGGGTGG + Intronic
1100137646 12:91573285-91573307 AATGACTGATGGATGGGGTGAGG - Intergenic
1100146272 12:91681657-91681679 ATTGGCTGAAGAGTGGGGAATGG - Intergenic
1101023072 12:100573267-100573289 AGTGGATGTGGGGTTGGGAGCGG + Intergenic
1101239246 12:102821778-102821800 AAGGGCAGAAGGGTGGGGGGAGG + Intergenic
1101324874 12:103706651-103706673 AGTGGGTGAGGGGTGGGGGCAGG - Intronic
1101414207 12:104494677-104494699 AATAACTGTGGGGTGGGGTGCGG + Intronic
1101527942 12:105548753-105548775 AATGGATGAGGCGTGGGGCAGGG - Intergenic
1101599593 12:106197616-106197638 AATGGCAGAAGGGAGTGGAGAGG - Intergenic
1102004914 12:109582960-109582982 AATTGCTGGGGGCTGGGGCGGGG - Intronic
1102050151 12:109856219-109856241 AGATGCTGAGGGCTGGGGAGTGG - Intronic
1102099183 12:110264637-110264659 AATGGCAGCGTTGTGGGGAGGGG - Intergenic
1102394116 12:112573798-112573820 AATGATTGAGGGGGAGGGAGGGG + Intronic
1102513210 12:113429350-113429372 GATGTCTTAGGGGTGGGGTGAGG - Intronic
1102843430 12:116151175-116151197 AATCTCTTGGGGGTGGGGAGGGG + Intronic
1103244945 12:119448660-119448682 AATGGCGGTGGGGAGGGGAGGGG + Intronic
1103902453 12:124310478-124310500 ATGGGCTGAGCTGTGGGGAGGGG + Intronic
1103906181 12:124328262-124328284 CATGGCTCCTGGGTGGGGAGAGG - Intronic
1103939723 12:124495179-124495201 AAAGGCTGTGGGGCGGGTAGCGG + Exonic
1104081417 12:125433662-125433684 AATGGGTGGGGGGAGGGGGGAGG - Intronic
1104951880 12:132444820-132444842 AACCGCTGTGGGGTGGGGAGGGG + Intergenic
1104990691 12:132622293-132622315 AACGCCTGTGGGGTGGGGTGGGG - Intronic
1105018070 12:132798166-132798188 GAGGGATGAGGGGTGGGGGGGGG + Intronic
1105649451 13:22358843-22358865 AATGGCAGCAGGGTGGGGAGTGG - Intergenic
1105890316 13:24677903-24677925 CTTGACTGAGGGATGGGGAGCGG - Intergenic
1105947346 13:25201502-25201524 TGGGGCTGTGGGGTGGGGAGGGG - Intergenic
1106000994 13:25723193-25723215 AATTGCTTAGTAGTGGGGAGTGG + Intronic
1106520912 13:30497005-30497027 AAAGACTGAAGGCTGGGGAGGGG - Intronic
1106742414 13:32660115-32660137 AAGGAGTGAGGGGTGGGAAGAGG - Intronic
1107314247 13:39114143-39114165 ATTGGGGGAGGGGAGGGGAGGGG - Intergenic
1107536093 13:41334368-41334390 ACTGGCTGAAGGGTAGAGAGAGG + Intronic
1107566226 13:41607629-41607651 GCTGTCTGTGGGGTGGGGAGGGG + Intronic
1107833955 13:44398688-44398710 AGGGGCTGGGGGCTGGGGAGTGG - Intergenic
1107898601 13:44989830-44989852 GAGGGCGGAGGAGTGGGGAGTGG + Intronic
1107976699 13:45695259-45695281 AAGGGCTGAGGGGAGTGGAAAGG + Intergenic
1108675086 13:52729971-52729993 AACTGCTGTGGGGTGGGGGGAGG - Intronic
1108703171 13:52960843-52960865 AGGGGCTTAGGGGAGGGGAGTGG - Intergenic
1109381077 13:61559748-61559770 GTTGGCCGGGGGGTGGGGAGGGG + Intergenic
1109719032 13:66253912-66253934 GACTGCTGTGGGGTGGGGAGAGG - Intergenic
1109774975 13:67028410-67028432 AACTGCTGTGGGGTGGGGGGAGG + Intronic
1110594340 13:77302366-77302388 AAGGGCTGGGGGGTGGGGAGGGG + Intronic
1110922670 13:81108515-81108537 TATGGGTGGGGGGTGGGGGGGGG - Intergenic
1111213784 13:85116429-85116451 AATGGTTGTGGGGTGGGGGGAGG + Intergenic
1111261299 13:85744211-85744233 AACTGCTGTGGGGTGGGGGGAGG - Intergenic
1112652916 13:101417997-101418019 AATGCCTGTTGGGTGAGGAGTGG - Intergenic
1113360120 13:109622938-109622960 AATAGGGGAGGGGAGGGGAGTGG - Intergenic
1114370319 14:22079513-22079535 AGGGGATGGGGGGTGGGGAGAGG + Intergenic
1114562357 14:23602614-23602636 GATGGTTGAGGGGTTGGCAGTGG + Intergenic
1115069161 14:29300492-29300514 AATAGTTGGGGGGTGGGGGGAGG - Intergenic
1115816676 14:37171109-37171131 AAGGGGGGAGGGGAGGGGAGGGG + Intronic
1115885706 14:37969538-37969560 GAAGGCGGGGGGGTGGGGAGAGG + Intronic
1116411941 14:44634314-44634336 ACCTGCTGTGGGGTGGGGAGAGG + Intergenic
1116949336 14:50864480-50864502 GATGGGTCAGGGGTGGGGTGGGG + Intronic
1116969616 14:51050751-51050773 AAAGGAAGAGGGGTGGAGAGGGG - Intronic
1117154683 14:52926697-52926719 AAAGGCTCGGGGGTGGGGCGTGG + Intronic
1117621812 14:57594949-57594971 TGGGGCTGAGGGGTGGGAAGTGG - Intronic
1117882877 14:60328893-60328915 AGATGATGAGGGGTGGGGAGAGG - Intergenic
1117963685 14:61186595-61186617 AATTGCAGTGGGGTGGGGTGGGG - Intergenic
1118073980 14:62278522-62278544 AATGTTTGAGGGGTAGGGATTGG - Intergenic
1118147618 14:63157474-63157496 CATGGCTGAGTGGTTGGGAGAGG - Intergenic
1118562078 14:67096700-67096722 ACCGGGTGGGGGGTGGGGAGTGG - Intronic
1118778988 14:68993703-68993725 AGTGGGTGGTGGGTGGGGAGGGG - Intergenic
1118778995 14:68993714-68993736 AATGGCTGGGGAGTGGGTGGTGG - Intergenic
1119265935 14:73263372-73263394 AAAGCCCAAGGGGTGGGGAGAGG - Intronic
1119357745 14:74020909-74020931 ACAGGCTGAGGGGTTGGGAATGG + Intronic
1119429065 14:74554005-74554027 AAGGGCTGAGAGGGTGGGAGAGG + Intronic
1119586724 14:75842704-75842726 AATGGGTGGGGGTTGGGGAAAGG + Intronic
1119738033 14:76996304-76996326 AATGGGGGAGGCTTGGGGAGTGG + Intergenic
1120057378 14:79940534-79940556 AAGTGCTGAGGGGGGGGGGGCGG - Intergenic
1120169487 14:81234493-81234515 AAGGGCTGGGGGGTGGGGGATGG + Intergenic
1120371293 14:83639643-83639665 CCTGGCTCGGGGGTGGGGAGCGG + Intergenic
1120542701 14:85769891-85769913 AATGGCAGAGCGGGGGTGAGTGG + Intergenic
1121272318 14:92646224-92646246 AAGGGCCGAGGGGCGGGAAGTGG - Intronic
1121623180 14:95364411-95364433 AATGCCTGGGGTGTGGGGGGAGG + Intergenic
1121641302 14:95486360-95486382 ATTGGGAGAGGGGTGGGGGGTGG - Intergenic
1121834288 14:97077903-97077925 CAGGGCTGAGGTGTGGGGAGAGG + Intergenic
1121863463 14:97340625-97340647 AGTGGCTTGGGGGTGGGGAATGG + Intergenic
1121965132 14:98296776-98296798 AGGAGCTGAGGGTTGGGGAGTGG - Intergenic
1122018862 14:98819981-98820003 AATAGCTGGGGGTGGGGGAGGGG - Intergenic
1122411819 14:101529504-101529526 TAAGACTGAGGGGTGGGGGGCGG - Intergenic
1122464063 14:101918487-101918509 GAAGGCTGAGGGGTGGGGGGAGG - Intronic
1122464094 14:101918555-101918577 GAAGGCTGAGGGGTGGGGGGAGG - Intronic
1122549641 14:102543142-102543164 GAGGGCAGAGGGTTGGGGAGAGG + Intergenic
1122573822 14:102727881-102727903 AATGGCCGTGGGGTGGGAACAGG - Exonic
1122575413 14:102738799-102738821 GAGGAATGAGGGGTGGGGAGCGG - Intergenic
1122745632 14:103895734-103895756 AAAGGGGGAGGGGAGGGGAGGGG - Intergenic
1122790653 14:104182923-104182945 AATGACAGAGGGATGGGGAGGGG - Intergenic
1122868423 14:104621428-104621450 AAGGAGTGAGGGGAGGGGAGAGG + Intergenic
1123425017 15:20163930-20163952 AATGGCAGCTGGGAGGGGAGGGG + Intergenic
1123534241 15:21170463-21170485 AATGGCAGCTGGGAGGGGAGGGG + Intergenic
1123921721 15:25074761-25074783 AGTGGCTGTGGGAAGGGGAGAGG + Intergenic
1123952333 15:25292814-25292836 GATGGTTGTGGGGTGGGGGGAGG + Intergenic
1124645865 15:31437170-31437192 AGTGGCTGCTGGCTGGGGAGAGG + Intergenic
1125090395 15:35784140-35784162 AATGGGAGAGGGATGGGCAGAGG + Intergenic
1125389958 15:39181548-39181570 TCTGGCAGAGGGGAGGGGAGGGG + Intergenic
1125790999 15:42365614-42365636 AATGACAGAGAGGTGGGGACAGG - Intronic
1126335957 15:47586775-47586797 GATGGCTGCCGGGTGGGGTGGGG - Intronic
1126711272 15:51459289-51459311 AATGGCTTAGGGTTGGTGATGGG + Intronic
1127507712 15:59611179-59611201 AAAGGGGGAGGGGAGGGGAGGGG - Intronic
1128056251 15:64702383-64702405 ACTGGGAGAGGGGTGTGGAGAGG + Intronic
1128065530 15:64762205-64762227 GATGGCAGGGGGGTGGGGGGTGG + Intronic
1128370359 15:67035450-67035472 CCTGGGTGTGGGGTGGGGAGGGG + Intergenic
1128561098 15:68668263-68668285 CATGGCCCAGGGCTGGGGAGGGG + Intronic
1128864450 15:71103700-71103722 AGAGGCTGAGGGGGTGGGAGTGG - Intronic
1129007374 15:72385117-72385139 AATGGGTGGGGGGTGGGGAGGGG - Intergenic
1129239431 15:74242778-74242800 AAACGCGGTGGGGTGGGGAGGGG - Intronic
1129257374 15:74341574-74341596 CAAAGCTGAGAGGTGGGGAGTGG - Intronic
1129379887 15:75158249-75158271 GATGGCTGGGGGGTGGGGGATGG + Intergenic
1129516176 15:76159108-76159130 AAGGGCTGAGAGGGGGTGAGAGG - Intronic
1129536811 15:76319866-76319888 AATGCCAGAGGGGTGAGGAACGG - Intergenic
1129604098 15:77016378-77016400 AGAGGCTGAGGGGTGGGAAGGGG + Intronic
1129651106 15:77490485-77490507 AATTGCTGAGGAGTGGGATGTGG + Intergenic
1129842937 15:78755041-78755063 ATGGGCTGAGGGGTGGGGTGGGG - Intergenic
1129874153 15:78961718-78961740 ACTGGGTGGGGGGTGGGGGGCGG - Exonic
1130062400 15:80579197-80579219 AAGGGCTGGGGGCTGTGGAGAGG + Intronic
1130275158 15:82472580-82472602 ACTGGCTGCGGGGGGGGGGGGGG + Intergenic
1130467506 15:84199948-84199970 ACTGGCTGCGGGGGGGGGGGGGG + Intergenic
1131179572 15:90230735-90230757 AATGGCAGTGGGAAGGGGAGAGG + Intronic
1132279888 15:100603163-100603185 AGTGTCTCAGAGGTGGGGAGGGG - Intronic
1132560137 16:589857-589879 AATGGCTGAGGGAAGGAGGGCGG + Intronic
1132933141 16:2468803-2468825 TAGGGGTGAGGGGTGGGGTGGGG + Intergenic
1132992872 16:2806150-2806172 AGGGGCTGTGGGGTGGGGATGGG - Intergenic
1133340173 16:5030811-5030833 AGTGGCTGCAGGGTGGTGAGGGG - Intronic
1133727675 16:8552827-8552849 AAGGGCTGCTGGGAGGGGAGGGG - Intergenic
1133970017 16:10560754-10560776 ATGGGCGGAGTGGTGGGGAGAGG + Intronic
1135220194 16:20607917-20607939 ATGGGCTGAGGGATGGGTAGAGG - Intergenic
1135284602 16:21182593-21182615 CATGGATGAGGCGTGGGTAGGGG - Intergenic
1135501385 16:22998955-22998977 AAGGGAGGAGGGGAGGGGAGAGG + Intergenic
1135628169 16:24014264-24014286 AGGGGGAGAGGGGTGGGGAGGGG + Intronic
1135665563 16:24332795-24332817 AATGGGGCAGGGGTGTGGAGTGG - Intronic
1135830727 16:25770554-25770576 AATGGCTGAGGGGTGCAGTTGGG + Intronic
1136071843 16:27792054-27792076 ATTTGCTGAGGGGTGGGTGGTGG - Intronic
1136362684 16:29790936-29790958 CATGGCGCAGGGGCGGGGAGAGG + Intronic
1136570412 16:31093421-31093443 CCTGGCAGAGGGGTGGGGTGGGG + Exonic
1136719806 16:32310743-32310765 AGTGGCTGAGGGGTTGGGTCCGG - Intergenic
1136777490 16:32879589-32879611 CATGGCTGAGGGCTGGGCTGGGG - Intergenic
1136838181 16:33517023-33517045 AGTGGCTGAGGGGTTGGGTCCGG - Intergenic
1136859840 16:33691815-33691837 AATGGCAGCTGGGAGGGGAGGGG - Intergenic
1136893134 16:33981925-33981947 CATGGCTGAGGGCTGGGCTGGGG + Intergenic
1137529736 16:49271215-49271237 AGTGGTAGAGGGGTGGGGTGGGG - Intergenic
1137670663 16:50276340-50276362 CAGGGTTGAGGGGTGGGGACAGG + Intronic
1137689055 16:50407600-50407622 ATGGGCGGAGGGGTGGGGAGGGG + Intergenic
1137748206 16:50839023-50839045 AAGGGCTGAGTTATGGGGAGTGG - Intergenic
1138138693 16:54547472-54547494 AGTGGCTGGGGGCTGGGGAGAGG - Intergenic
1138193319 16:55033987-55034009 ACGGGCAGAGGGGTGGGGAGAGG + Intergenic
1138207946 16:55138593-55138615 CCAGGCTGAGGGGTGAGGAGGGG + Intergenic
1138299034 16:55911043-55911065 ACTGGCAGATGAGTGGGGAGGGG - Intronic
1138401248 16:56746153-56746175 ATGGGCGGAGGGGTGGGGTGGGG + Intronic
1138496528 16:57412309-57412331 CCTTGCTGAGGGGTGGGGAGAGG + Intronic
1138581160 16:57941267-57941289 GGAGTCTGAGGGGTGGGGAGGGG - Intronic
1138615490 16:58162095-58162117 GAGGGCTGAGGAGTGGGGTGGGG + Intronic
1139333981 16:66217945-66217967 AATGGGGGTGGGCTGGGGAGAGG + Intergenic
1139429007 16:66901104-66901126 AAGGGATCAGGGGTTGGGAGAGG + Intergenic
1139547367 16:67655973-67655995 AAAGGCTAGGGTGTGGGGAGCGG + Intronic
1139708062 16:68755700-68755722 ACATGCTGAGGGGTGGGGAGTGG - Intronic
1140202423 16:72905351-72905373 TGTGGCTGATTGGTGGGGAGGGG - Intronic
1140253965 16:73319079-73319101 AGGTGCTGAGGGGAGGGGAGGGG + Intergenic
1140359516 16:74332524-74332546 AGTGGGGGAGGGGAGGGGAGGGG + Intergenic
1140482362 16:75268342-75268364 AGGGGCTGAGGGCTGGGAAGTGG + Intergenic
1140698985 16:77563798-77563820 ATTTGCAGAGGGGAGGGGAGAGG + Intergenic
1140776050 16:78249823-78249845 GATGGCTGTGGGGTGGGGGCTGG + Intronic
1140790497 16:78386627-78386649 ACAGGCTGGGGGGTGGGGCGGGG - Intronic
1140820832 16:78661634-78661656 TGTTGCTGAGAGGTGGGGAGGGG + Intronic
1140974284 16:80044288-80044310 AAGGGAAAAGGGGTGGGGAGAGG + Intergenic
1141544291 16:84753933-84753955 ATTGGCAGAGGGGTGTTGAGGGG + Intronic
1141572501 16:84942369-84942391 GAGGGCAGAGGGGTGGGGTGGGG - Intergenic
1141592165 16:85076633-85076655 GATGGCTGTGGGAGGGGGAGGGG - Intronic
1141752795 16:85970362-85970384 AATGGGTGAGGGGTGTGGAAGGG - Intergenic
1141896123 16:86959659-86959681 GCTGGGTGAGGGGTGGGGATGGG - Intergenic
1142003978 16:87680329-87680351 AAGGGCTGCGGCGTGTGGAGGGG + Intronic
1142285103 16:89168472-89168494 AGTGAGTGAGGGGTGGGGAGTGG - Intergenic
1142428915 16:90015834-90015856 AGAGGCTGGGGGGTGGGCAGTGG + Intronic
1203006625 16_KI270728v1_random:207026-207048 AGTGGCTGAGGGGTTGGGTCCGG + Intergenic
1203079903 16_KI270728v1_random:1141698-1141720 CATGGCTGAGGGCTGGGCTGGGG - Intergenic
1203121345 16_KI270728v1_random:1539994-1540016 AATGGCAGCTGGGAGGGGAGGGG - Intergenic
1142955975 17:3522554-3522576 AAGTGCTGGGGGGTGGGGGGGGG - Intronic
1143053318 17:4144101-4144123 GATGGATGTGGGGTGGGGATGGG - Intronic
1143125930 17:4640866-4640888 GAGGGCTGGGAGGTGGGGAGAGG + Intronic
1143170621 17:4927838-4927860 AGTGGCTGGGAGGTGGAGAGAGG + Intergenic
1143186790 17:5014840-5014862 AATGGCTGAGGGGGTGAGAGAGG + Intronic
1143402550 17:6655956-6655978 GAGGGCTGGGAGGTGGGGAGAGG - Intergenic
1143447250 17:7016806-7016828 AGGGGCAGAGGGGAGGGGAGAGG + Intronic
1143514490 17:7413009-7413031 ACTGGGAGAGGGGTGGGGTGAGG + Intronic
1143539822 17:7562274-7562296 CAGGGCTGGGGGGAGGGGAGGGG - Intronic
1143614202 17:8039737-8039759 AATGGCGGAGCCTTGGGGAGCGG + Intronic
1143627719 17:8120856-8120878 AATGGGGCAGGGTTGGGGAGCGG - Exonic
1143782944 17:9239050-9239072 GATGGCTTAGGCGTGGGAAGCGG + Intronic
1144354772 17:14434914-14434936 AATGAATGAGGTGTGGGCAGTGG + Intergenic
1144422283 17:15109735-15109757 TTAGGCTGAGGGGTGGGGATTGG - Intergenic
1144842356 17:18195321-18195343 AGAGGCTAAGGGGTGGGGTGAGG - Intronic
1145304418 17:21665456-21665478 AAAGGCAGTGGGGTGAGGAGAGG - Intergenic
1145793199 17:27640786-27640808 CAGGGGTGAGAGGTGGGGAGGGG - Intronic
1146125678 17:30229387-30229409 GACGGCTTAGGGGTGGGGAGGGG + Intronic
1146656788 17:34639196-34639218 AATGGCTGTGGGATGGGGTAGGG - Exonic
1146679814 17:34798940-34798962 AATGGCAGTGGGGTGGGTGGAGG + Intergenic
1147140215 17:38456452-38456474 AAAGGCTGAGGGGCTGGGTGTGG - Intronic
1147265425 17:39231679-39231701 ACTGGCACAGGGCTGGGGAGGGG - Intergenic
1147268149 17:39247366-39247388 GATGGCTATGGGGTGGGGGGAGG - Intergenic
1147313454 17:39607742-39607764 AAGGGGAGAGGGGAGGGGAGGGG + Exonic
1147466676 17:40616171-40616193 AATGGAAGCGTGGTGGGGAGGGG + Intergenic
1147576231 17:41600722-41600744 AATAGCTGGGGGGAGGGCAGAGG - Intergenic
1147723642 17:42553614-42553636 GATGGGTGAGTGGTAGGGAGTGG + Exonic
1147726393 17:42568429-42568451 AATCACTAAGGGGTGGGGTGGGG - Intronic
1147770630 17:42865735-42865757 AAGGGCAGAGGGGTCGGGGGTGG + Intergenic
1148061908 17:44842530-44842552 AAAGGGTGGGGGGTGGGGGGTGG + Intergenic
1148324169 17:46773636-46773658 TGGGGCTGAGGGGGGGGGAGGGG - Intronic
1148735631 17:49863103-49863125 ACTGGCAGAGGGATGGGCAGAGG - Intergenic
1148798983 17:50211163-50211185 AATAGCTGGGGGGTCGGGGGAGG + Intergenic
1148858810 17:50593476-50593498 AAGGGCTGAGTGCTGGGGAGGGG - Intronic
1148868322 17:50640837-50640859 AAAGGCTGAGGGAGGGTGAGTGG + Intronic
1148869702 17:50649613-50649635 GAGAGATGAGGGGTGGGGAGGGG + Intronic
1149023787 17:52000899-52000921 AGTGGCTGGGGGGTGGGGGTGGG + Intronic
1149057500 17:52383275-52383297 AGTTGCTGAGGGCTGGGGATAGG + Intergenic
1149771748 17:59327918-59327940 AAGGGCTGAGGGGTGGGGAAGGG + Intergenic
1150475085 17:65468813-65468835 AGTGGCTGAGTGTAGGGGAGGGG - Intergenic
1150522838 17:65887796-65887818 AAAGCCTGAGGGGTGGCAAGAGG - Intronic
1150548570 17:66188398-66188420 AAGGGCTCGGGGGTGGGGGGGGG - Intronic
1150606694 17:66697656-66697678 CATGGCTGAGAGATTGGGAGAGG + Intronic
1150647295 17:66986950-66986972 AATGGATTTGGTGTGGGGAGGGG + Intronic
1150695609 17:67402498-67402520 AATGGCGGAGGGGCGGGGGATGG - Intronic
1151167807 17:72219902-72219924 AACGGCTTTGGGGAGGGGAGAGG - Intergenic
1151424026 17:74018084-74018106 TTTGGCAGAGGGGTGGGAAGAGG + Intergenic
1151606763 17:75142558-75142580 AAGGGGGGAGGGGAGGGGAGAGG + Intronic
1151936383 17:77264420-77264442 AATGGCTGGGAGCGGGGGAGGGG + Intergenic
1151988006 17:77556418-77556440 GCTGGCTGAGAGGTGGGCAGGGG - Intergenic
1151993256 17:77592027-77592049 AGTTCCTGATGGGTGGGGAGTGG + Intergenic
1152023236 17:77792765-77792787 AGTGGCCCTGGGGTGGGGAGTGG + Intergenic
1152067718 17:78120851-78120873 AAAGGCTGAGGGGCGGGTACAGG + Intronic
1152160743 17:78667170-78667192 AATGACTGAAGTGTGGGGACGGG - Intergenic
1152371780 17:79892857-79892879 AAGTGCTGGGGGTTGGGGAGAGG - Intergenic
1152467365 17:80473924-80473946 CCTGGCTGTCGGGTGGGGAGAGG - Intronic
1152755846 17:82086679-82086701 AATAGCTGAGGGTTGAGGAAGGG + Intronic
1152809906 17:82376425-82376447 CATGGCCATGGGGTGGGGAGGGG - Intergenic
1153659153 18:7311128-7311150 CACTGCTAAGGGGTGGGGAGAGG - Intergenic
1153761953 18:8340058-8340080 AATTGCTCAGGGGTGGGCACTGG - Intronic
1153985180 18:10344726-10344748 AATGCCTGGGAGGTGGGGTGGGG + Intergenic
1154000947 18:10482035-10482057 AAAGGCTCGGGGGAGGGGAGGGG - Intronic
1154940882 18:21111726-21111748 AATGCCTGGGGGGTGGGGCGAGG + Exonic
1155045308 18:22097969-22097991 AAGGGCTGAGGGGAGGTCAGGGG + Intronic
1155555164 18:27010879-27010901 AAGGGCAGATGGGTGGGGAAAGG + Intronic
1155757964 18:29525709-29525731 AGTGGGGTAGGGGTGGGGAGAGG - Intergenic
1155987531 18:32245966-32245988 AATGGCTTAGGTGCGGGAAGTGG - Intronic
1156462101 18:37326827-37326849 AGTGGCAGAGGGATGGGGAGGGG - Intronic
1156553822 18:38045322-38045344 AATAGGTGAGGAGTGGGGAGAGG + Intergenic
1156569834 18:38240814-38240836 AAAGGCTCTGGGGTGGGGAATGG + Intergenic
1156761794 18:40601030-40601052 AAGGGCAGAAGGGAGGGGAGGGG - Intergenic
1157176701 18:45458589-45458611 AATGGCTGATGGGCCAGGAGAGG - Intronic
1157302083 18:46486359-46486381 GGTGGCTGAGGGGCTGGGAGTGG - Intronic
1157400010 18:47379428-47379450 CATGGCTTAGGGGTGTGGTGGGG - Intergenic
1157418456 18:47525874-47525896 AAAGGCTGAGGGGAGGGGTGGGG - Intergenic
1157589526 18:48828018-48828040 AAAGGGTGGGGGCTGGGGAGAGG - Intronic
1158416935 18:57256945-57256967 AGTGGTTGAGAGGAGGGGAGAGG + Intergenic
1158421408 18:57298049-57298071 AATGGATGAGAGGTGGGATGGGG - Intergenic
1158452305 18:57578188-57578210 TATGGCTGAGGTGGGGAGAGGGG + Intronic
1158507294 18:58057966-58057988 AATGGCTGAGTGAAGGGAAGTGG - Intronic
1158529693 18:58247815-58247837 AATGAACGAGGGGAGGGGAGTGG - Intronic
1158530271 18:58254833-58254855 AATAGCTAAGTGGAGGGGAGGGG - Intronic
1158578468 18:58660750-58660772 ACTAGATGAGGGGTGGGGTGGGG - Intergenic
1158594158 18:58801914-58801936 GAAGGGTGAGAGGTGGGGAGGGG - Intergenic
1159041368 18:63325959-63325981 AAGAGATGAGGGGTAGGGAGGGG - Intergenic
1159046701 18:63375616-63375638 AATTGCTTGGGGGTGGGCAGGGG + Intergenic
1159189722 18:65026040-65026062 CATCGCTGGGGGGTGGGGGGTGG - Intergenic
1159554510 18:69931224-69931246 AACTGTTGTGGGGTGGGGAGAGG + Intronic
1159975821 18:74711111-74711133 AATGGGAGTGGGCTGGGGAGGGG + Intronic
1160269536 18:77371952-77371974 AGTGCCTGAGGCGTGGCGAGTGG + Intergenic
1160579058 18:79873422-79873444 GGTGGCTGGGGGGGGGGGAGGGG - Intronic
1160744283 19:703574-703596 CATGGCTCAGGGTTGGGGTGGGG + Intergenic
1160805840 19:991835-991857 ACTGGCTGTGGGGCGGGGACTGG + Intronic
1161256281 19:3311604-3311626 ACTGGCTGGTGTGTGGGGAGGGG - Intergenic
1161321483 19:3643668-3643690 AAGGGAGGGGGGGTGGGGAGGGG - Intronic
1161327071 19:3669113-3669135 AGAGGCTGAGGGTTGGGGAAGGG + Intronic
1161398661 19:4058281-4058303 GGTGGCTGAGAGTTGGGGAGGGG - Intronic
1161398726 19:4058508-4058530 GAGGGCGGAGGGGTGGGGACAGG - Intronic
1161445130 19:4314068-4314090 AATCCCGGAGGGGCGGGGAGAGG + Intronic
1161523359 19:4738375-4738397 AACGGCGGAGGGGAGTGGAGAGG + Intergenic
1161924813 19:7292879-7292901 CAGGGCTGAGGGGAGAGGAGGGG + Intronic
1161926421 19:7303581-7303603 AAGGGGAGAGGGGAGGGGAGGGG + Intergenic
1162091627 19:8284047-8284069 AAAGGCAGAGGGGAGGGGGGCGG + Intronic
1162093864 19:8298895-8298917 AAAGGCAGAGGGGAGGGGGGCGG + Intronic
1162340327 19:10087715-10087737 AAAGGCTGGGAGGTGGGGAAGGG + Intronic
1162424702 19:10587394-10587416 GATGGCTGCGGGGCCGGGAGAGG + Intergenic
1162490092 19:10986633-10986655 AATGGCTGGGGCGTGGGTGGCGG + Intronic
1163184240 19:15626343-15626365 GTTGGCTGAGGTGTGGGTAGAGG - Intronic
1163228888 19:15985375-15985397 CAGGGCTGAGGGGAAGGGAGAGG + Intergenic
1163398871 19:17079744-17079766 AAGGGCTGGTGGGTGGGGTGTGG - Intronic
1163524552 19:17812709-17812731 AATGGTGGAGGTGTGGGCAGAGG + Exonic
1163529576 19:17841848-17841870 AATGGCAAAGGGATAGGGAGTGG - Intronic
1163782322 19:19257067-19257089 AATATCTGAGGGGTGGGACGTGG + Exonic
1164352792 19:27372831-27372853 GATGGTTGTGGGGTGGGGGGAGG + Intergenic
1164527106 19:29020601-29020623 AATGGGAGAGGGATGGGGAGAGG - Intergenic
1164706753 19:30325543-30325565 AAAGGCTGAGGGCAGCGGAGAGG + Intronic
1164998714 19:32743351-32743373 AGTGGGGGAGGGGAGGGGAGGGG - Intronic
1164999004 19:32745161-32745183 CATGCCTGAAGGGTGGGCAGTGG - Intronic
1165105331 19:33465941-33465963 AAGGGTAGAAGGGTGGGGAGAGG + Intronic
1165411874 19:35666925-35666947 AGTGGTTGTGTGGTGGGGAGGGG + Intronic
1165782193 19:38441251-38441273 GACGGCTGGGGCGTGGGGAGGGG + Intronic
1165980057 19:39714088-39714110 CATGGGTGTGGGGAGGGGAGAGG - Intergenic
1166101988 19:40576535-40576557 GGTGGGTGCGGGGTGGGGAGAGG + Intergenic
1166136592 19:40780845-40780867 AGTGGCTTGGGGGTGGGGAAAGG + Intronic
1166339628 19:42129742-42129764 GACAGCTGTGGGGTGGGGAGGGG - Intronic
1166552378 19:43674712-43674734 AATGGGTCTGGGGTGGGTAGGGG + Intergenic
1166729391 19:45050182-45050204 GAGGGCTGAGTGGTTGGGAGTGG + Intronic
1166745645 19:45140708-45140730 AAAGGCTGAGGGGTGGCGCAAGG + Intronic
1166851694 19:45764405-45764427 AGTGGCTCTGGGGTGGGGAAGGG - Exonic
1166884966 19:45954566-45954588 GAGGGCTGAGGGGTGGGGGAGGG + Intronic
1167605996 19:50481463-50481485 AGAGGCTGAGGCGTGGGGTGGGG + Intronic
1167622406 19:50567332-50567354 AAGGGCTGAAGACTGGGGAGGGG + Intronic
1167642346 19:50688703-50688725 GCTGGCTGGGGGGTGGGCAGGGG + Intronic
1167650676 19:50726924-50726946 AATGGCTGAAGGAAGGGAAGGGG - Intergenic
1167713733 19:51127469-51127491 AAGGGTTGTGGGGTGGGGAGAGG + Intronic
1167722272 19:51186711-51186733 AATGGGCGCGGGGTGGGGAGAGG + Intergenic
1167751132 19:51380751-51380773 AATGGGTTGGGGGTGGGGATAGG + Intronic
1167761934 19:51455231-51455253 AAGGGGTGCGGGGTGGGGAGAGG - Intronic
1167768150 19:51497880-51497902 AGTGAGTGCGGGGTGGGGAGAGG - Intronic
1168083798 19:54029991-54030013 AATGGGGGAGGGGGGGAGAGGGG + Intergenic
1168139475 19:54375571-54375593 CACGGCTGTGGGGTGTGGAGGGG + Intergenic
1168158512 19:54492526-54492548 CACGGCTGTGGGGTGTGGAGGGG - Intergenic
1168264816 19:55216955-55216977 CAGGACTGAGGGGTGGAGAGTGG - Intergenic
1168296624 19:55380272-55380294 AAGGGGGGAGGGGAGGGGAGGGG - Intronic
925212331 2:2060679-2060701 AAGGGCAGAGAGGAGGGGAGGGG - Intronic
925313741 2:2906627-2906649 GGTGGCTGTGGGCTGGGGAGAGG - Intergenic
925313776 2:2906718-2906740 GGTGGCTGCGGGCTGGGGAGAGG - Intergenic
925313849 2:2906901-2906923 AGTGGCTGTGGGCTGGGAAGAGG - Intergenic
925313865 2:2906947-2906969 AGTGGCTGTGGGCTGGGGAGAGG - Intergenic
925313915 2:2907083-2907105 GGTGGCTGTGGGCTGGGGAGAGG - Intergenic
925348734 2:3187510-3187532 GGTGGGTGGGGGGTGGGGAGTGG - Intergenic
925348781 2:3187627-3187649 GGTGGATGAGGAGTGGGGAGGGG - Intergenic
925348847 2:3187798-3187820 GGTGGGTGAGGAGTGGGGAGGGG - Intergenic
925348882 2:3187886-3187908 GGTGGGTGAGGAGTGGGGAGGGG - Intergenic
925404725 2:3598674-3598696 AGCGGGTGAGGGGTGTGGAGAGG + Intronic
925404737 2:3598712-3598734 CGTGGGTGAGGGGTGTGGAGAGG + Intronic
925420182 2:3704451-3704473 CATGGGGGAGGGGTGTGGAGAGG + Intronic
925420233 2:3704565-3704587 CATGGGGGAGGGGTGTGGAGAGG + Intronic
925420271 2:3704649-3704671 CATGGGGGAGGGGTGTGGAGAGG + Intronic
925455697 2:4014735-4014757 AGTGGCGGTGGGGTGGGGTGGGG + Intergenic
925609313 2:5691331-5691353 AGCGGCGGAGGGGCGGGGAGAGG + Intergenic
925913737 2:8589642-8589664 AAAGGGAGAGGGGAGGGGAGAGG + Intergenic
926879500 2:17527703-17527725 AATGGCAGAGGGGAGTAGAGAGG + Intergenic
926980449 2:18561762-18561784 AATGGGTGGAGGGTGGGAAGTGG - Intronic
927503064 2:23595207-23595229 AGTGGCTGTGGGGTGTGGAAAGG + Intronic
927516112 2:23672534-23672556 CAGGGCTGAGGGGCCGGGAGTGG - Intronic
927574236 2:24188398-24188420 AATCAAGGAGGGGTGGGGAGGGG - Intronic
927901999 2:26827225-26827247 AATGGCTGATGGGATGGAAGTGG - Intergenic
927999164 2:27507794-27507816 GAGTGGTGAGGGGTGGGGAGGGG + Intronic
928042488 2:27891687-27891709 AAAGGGCGGGGGGTGGGGAGTGG - Intronic
928170383 2:28999480-28999502 GGTGGGTGAGGGGTGGGCAGGGG - Intronic
928363569 2:30684942-30684964 AGGGGCTGGGGAGTGGGGAGGGG + Intergenic
928402007 2:30985815-30985837 CAAGGCTGAGGGGAGGGGAGGGG - Intronic
928419825 2:31129709-31129731 TATGGCTGGGAGGTGGGGGGTGG + Intronic
929573878 2:43040209-43040231 AATGACAGAGAGGTGGTGAGAGG - Intergenic
929604624 2:43226406-43226428 AACGGGCGAGGGGCGGGGAGGGG + Exonic
929749307 2:44693339-44693361 ACTGGAGGAGGGGTGGTGAGGGG - Intronic
929794637 2:45049579-45049601 AAAGGAAGAGGGGTGGGGAAGGG + Intergenic
929830900 2:45345510-45345532 AATGGCCTTGGGGTGGGGATGGG + Intergenic
929972949 2:46599494-46599516 AATGAATGCGGGGTAGGGAGGGG - Intronic
930076386 2:47409061-47409083 AATTTCTGAGGGGAGGGGAGGGG + Intronic
930260459 2:49140304-49140326 AATGGGTGGGGGGTGGTGCGGGG - Intronic
930736747 2:54787282-54787304 GATGGGTGAGGGTTGGGGGGGGG + Intronic
931180253 2:59892299-59892321 AATGGGGGCGGGGTGAGGAGTGG + Intergenic
931667180 2:64617813-64617835 CTTGGCGGGGGGGTGGGGAGGGG + Intergenic
931976650 2:67650824-67650846 AGGGCCTGAGGGGTGGGGATTGG - Intergenic
932084044 2:68742002-68742024 AAAGGTGGAGGGGTGGTGAGGGG - Intronic
932122557 2:69115049-69115071 TATAGCTGGGGAGTGGGGAGGGG + Intronic
932165236 2:69499238-69499260 AAGGGCTGAGGGTTAGAGAGTGG - Intronic
932412443 2:71555331-71555353 GAAGGCTGCTGGGTGGGGAGGGG + Intronic
932713235 2:74083008-74083030 TATGGCTGGGGGCTAGGGAGAGG - Intronic
932756956 2:74415670-74415692 AATGGCAGAGGAGTCCGGAGAGG + Intronic
932767513 2:74480930-74480952 AGTGGCTGGGGAGTAGGGAGGGG - Intronic
932793202 2:74673565-74673587 CCTGGCTGAACGGTGGGGAGAGG + Exonic
933392538 2:81690129-81690151 GATGCCTAAGGGGAGGGGAGGGG + Intergenic
933695292 2:85213017-85213039 AGTGGGTGAGGTGTGGGGTGGGG + Intronic
934458200 2:94192923-94192945 AATGGCAGCTGGGAGGGGAGGGG - Intergenic
934901464 2:98163117-98163139 GTGGGGTGAGGGGTGGGGAGGGG + Intronic
934973944 2:98787178-98787200 AAGGGCTCAGGGGTGGGGCTGGG + Intergenic
935101325 2:99998481-99998503 AATGGGGGAGAGGTGGGCAGAGG + Intronic
935848096 2:107188100-107188122 TATGGCTGGGGGATGGGTAGGGG - Intergenic
936464807 2:112738110-112738132 CAGGGGAGAGGGGTGGGGAGTGG - Exonic
936476571 2:112844887-112844909 AAAGGCTGAGAGCTGGGAAGAGG - Intergenic
936531307 2:113278531-113278553 AAAGGATGAGGCCTGGGGAGGGG - Exonic
936652327 2:114442261-114442283 ACTGGGTTAGGGGTGGGGAGAGG + Intergenic
936935046 2:117831404-117831426 GATGGCTGGGGGGTAGGAAGAGG + Exonic
937241100 2:120463235-120463257 TGTGGCTGTGGGGTGGGGTGGGG + Intergenic
937527964 2:122794319-122794341 AGTGGCTGAGGGTGTGGGAGTGG + Intergenic
937853291 2:126655292-126655314 AATGGCAGAAGGTAGGGGAGAGG + Intergenic
937912151 2:127080993-127081015 CTTGGCGGAGGGCTGGGGAGGGG - Intronic
937966770 2:127518045-127518067 GAGGACTGTGGGGTGGGGAGGGG + Intronic
937988180 2:127647966-127647988 AAGGGCTGAGGGCTGTGAAGGGG - Intronic
938172530 2:129092193-129092215 CATTTCAGAGGGGTGGGGAGTGG + Intergenic
938389735 2:130895277-130895299 CATGGCTGAGGGGTGGCCCGTGG + Intronic
938444355 2:131366326-131366348 GTGGGGTGAGGGGTGGGGAGTGG - Intergenic
939197635 2:138992001-138992023 AATGGCTGTGGGCGGGGGAGGGG - Intergenic
939606683 2:144262848-144262870 AAGGGAAGAGGGGAGGGGAGAGG + Intronic
939628202 2:144504417-144504439 AAAGACAGAGGGGTGGGGGGAGG - Intronic
940460213 2:153955555-153955577 AAGGGCTGAGTGCTGGGGAAAGG + Intronic
940788984 2:158011855-158011877 AATGGTAGTGGGGTGGGGATAGG + Intronic
940907154 2:159179689-159179711 AAAGGGTGAAGGGTGTGGAGCGG - Intronic
941983345 2:171484747-171484769 TATACCTGAGGGGTGGGGAGGGG - Exonic
942178346 2:173355674-173355696 TAAGGCTGGGGGGTGGGGGGTGG - Intronic
942547123 2:177076706-177076728 AAAGGATGAGGGGCTGGGAGTGG - Intergenic
942608548 2:177717297-177717319 GATGGATGAGGGCGGGGGAGGGG - Intronic
942613190 2:177762960-177762982 AGTGGCGGAGGGCGGGGGAGTGG - Intronic
942657242 2:178226429-178226451 AATGGGTCTGGGGTGGGAAGAGG + Intronic
944025119 2:195155632-195155654 TATGGTTGTGGGGTGGGGTGGGG - Intergenic
944161457 2:196664766-196664788 ATTGGCTGGGGGGTGGGGGAAGG - Intronic
944358816 2:198826754-198826776 AAAAGCAGAGGGGTGGGGGGTGG + Intergenic
944593029 2:201236185-201236207 AAAGGAGCAGGGGTGGGGAGGGG - Intronic
944604748 2:201342553-201342575 AGTGGAAGAGGGGTGGGAAGGGG - Intronic
944904320 2:204247279-204247301 TATGGGAGTGGGGTGGGGAGGGG + Intergenic
945688015 2:212996246-212996268 AAGGGAGGTGGGGTGGGGAGGGG + Intergenic
945899982 2:215526519-215526541 AATGGATGGGGGGCGGGGGGTGG + Intergenic
946292134 2:218753452-218753474 CATGCCTGAGGGGTAGGGAAGGG + Intronic
946310527 2:218880478-218880500 AATGGCGGGGGGGTGGGGGGAGG + Exonic
946494431 2:220181525-220181547 TAGGGCTGAGGGGTGGTGAAGGG + Intergenic
946758874 2:222973456-222973478 AAAGGCTGAGGAGGAGGGAGAGG + Intergenic
946800504 2:223410853-223410875 AATGGTGGAGGGATGGAGAGAGG + Intergenic
946816172 2:223580559-223580581 GATGCATGAGGTGTGGGGAGGGG + Intergenic
947020166 2:225665924-225665946 AATAGCTGAGAGGGAGGGAGTGG - Intergenic
947203004 2:227632701-227632723 CAGGGACGAGGGGTGGGGAGAGG + Intronic
947375131 2:229488146-229488168 ACTGGGTGTGGGATGGGGAGTGG + Intronic
947497145 2:230646137-230646159 AGTGACTGAGGAGTGGAGAGAGG - Intergenic
947744857 2:232502252-232502274 AATGGGGGAGGGGTGGGAGGAGG + Intergenic
947840265 2:233203261-233203283 AGAGGCTGCGGGGTGGGGATGGG + Intronic
947943520 2:234079748-234079770 AAGGGTTGTGGGGTGGGGGGAGG - Intergenic
948057018 2:235016126-235016148 AAGGGGTGGGGGGTGGGGGGAGG + Intronic
948627033 2:239275720-239275742 GCAGCCTGAGGGGTGGGGAGTGG - Intronic
948627367 2:239277320-239277342 CAAGGGTGAGAGGTGGGGAGAGG + Intronic
948697893 2:239742555-239742577 AAAGGCTGTGGGGAGGGGAGTGG - Intergenic
948993745 2:241567936-241567958 AGTGGGCGAGGGGTGGGGAATGG - Intronic
1169339835 20:4787917-4787939 TATTGTTGAGGGGTGAGGAGTGG - Intronic
1169536856 20:6553823-6553845 AGAGGGTGGGGGGTGGGGAGAGG - Intergenic
1169617908 20:7471057-7471079 AATGGGGGAGGGGTGGAGAGTGG - Intergenic
1170349038 20:15419261-15419283 AATGACTGATGGGTGAGGAATGG - Intronic
1170442215 20:16390597-16390619 AATGGATGAGGAGTTGGAAGAGG - Intronic
1170593433 20:17788072-17788094 AAAATGTGAGGGGTGGGGAGGGG - Intergenic
1170700063 20:18695589-18695611 AAGGGGGGAGGGGAGGGGAGGGG - Intronic
1170841135 20:19925061-19925083 AAAGGCTGAGGAGTGGTGAGAGG - Intronic
1171241144 20:23568133-23568155 AATGGGAGTGGGGTGGGGACAGG - Intronic
1171280078 20:23888972-23888994 ACTTGCTGAGGGCTGGGGTGAGG + Intergenic
1171285106 20:23930430-23930452 ACTTGCTGAGGGCTGGGGTGAGG + Intergenic
1171430847 20:25082352-25082374 AATGGGGGTGGGGTGGGGTGGGG - Exonic
1171521936 20:25782888-25782910 AAAGGCAGTGGGGTGAGGAGAGG - Intronic
1171554889 20:26072995-26073017 AAAGGCAGTGGGGTGAGGAGAGG + Intergenic
1172090755 20:32430545-32430567 AATGGGGGTGGGGTGGGGTGAGG - Intronic
1172407777 20:34702417-34702439 CAAGGCTGAGGGGTGGAGAGGGG - Intronic
1172600084 20:36177425-36177447 ACTGGCTGTGGGGAAGGGAGTGG + Intronic
1172608278 20:36230501-36230523 ATTGGTTGATTGGTGGGGAGGGG + Exonic
1172681547 20:36719671-36719693 ATGGGCGGAGGGGCGGGGAGGGG - Intronic
1172821100 20:37735213-37735235 AAGGGAGGAGGGGAGGGGAGGGG - Intronic
1173526040 20:43733541-43733563 AAAGGTTGTGGGGTGGGCAGGGG - Intergenic
1173538353 20:43832704-43832726 AAGGGAGGAGGTGTGGGGAGGGG - Intergenic
1173565515 20:44035647-44035669 CGTGGCTGATGCGTGGGGAGAGG + Intronic
1173610544 20:44364145-44364167 AGAGGTTGAAGGGTGGGGAGAGG - Intronic
1173727620 20:45308332-45308354 CAGGGCTGGCGGGTGGGGAGGGG + Intronic
1173937686 20:46881484-46881506 AGTGGTTGCTGGGTGGGGAGGGG - Intergenic
1174177173 20:48652481-48652503 ACTGGCTGGGAGGAGGGGAGGGG + Intronic
1174433848 20:50491256-50491278 TATGGGGGAGGGGTGGGGAGAGG - Intergenic
1174611610 20:51802105-51802127 AAAGGCGGGGTGGTGGGGAGAGG + Intronic
1175077533 20:56388930-56388952 ATGGGCTCAGGGGAGGGGAGAGG - Intronic
1175774153 20:61642325-61642347 GATGGCAGAGGGGTGTGGAATGG + Intronic
1175835948 20:61994580-61994602 AATGGCTGCCTGGTGTGGAGAGG - Intronic
1175939788 20:62532691-62532713 ATGGGCTGAGGGCTGTGGAGGGG + Intergenic
1175940509 20:62535526-62535548 GGTGGCTGAGGGGTGGGGACCGG + Intergenic
1175948824 20:62571731-62571753 CAGGGCAGAGGGGTGGTGAGGGG - Intergenic
1175973056 20:62696838-62696860 AGTGGGTGTGGGGTGGGGGGTGG + Intergenic
1176044894 20:63087472-63087494 AGGGGCTGCAGGGTGGGGAGTGG - Intergenic
1176056277 20:63150884-63150906 AGTGTCTGAGGGCTGGAGAGGGG - Intergenic
1176090499 20:63316377-63316399 AGGGGCTGGGGGGTGGGCAGGGG - Intronic
1176128731 20:63487379-63487401 AAGAGTGGAGGGGTGGGGAGAGG - Intergenic
1176153359 20:63604958-63604980 AATGGCAGAGGGGCCGGGTGCGG + Intronic
1176612909 21:9002068-9002090 GATGGTTGTGGGGTGGGGAGAGG + Intergenic
1176655745 21:9587883-9587905 AAAGGCAGTGGGGTGAGGAGAGG - Intergenic
1176670305 21:9727845-9727867 AATGGCTGAGGTGAGTGAAGAGG + Intergenic
1178480853 21:32978364-32978386 ATTTGCTCAGGGGAGGGGAGGGG - Intergenic
1178710441 21:34911932-34911954 GATGGTTCAGGGGTAGGGAGCGG - Intronic
1178859345 21:36275972-36275994 AATGCCAGAGGGGTGGTCAGAGG + Intronic
1179084973 21:38207935-38207957 GAGGGCAGAGGGGAGGGGAGAGG - Intronic
1179175285 21:39003661-39003683 AAAAGCTGAGGGATGGGGACAGG - Intergenic
1179498423 21:41790618-41790640 AATGGGGGAGGGATGGGGAGGGG + Intergenic
1179534641 21:42043650-42043672 TCTGCCTGAAGGGTGGGGAGGGG + Intergenic
1179617938 21:42593787-42593809 GGTGGCGGATGGGTGGGGAGTGG - Intergenic
1179883836 21:44305054-44305076 CCTGGCTGCTGGGTGGGGAGAGG + Intronic
1179889099 21:44326880-44326902 CATGGGTGGGGGCTGGGGAGGGG - Exonic
1179903582 21:44407605-44407627 TGTGGCTGAGGGGAGGGGAACGG - Intronic
1180309567 22:11158499-11158521 AGTGGCCGAGGGGTCGGGTGCGG + Intergenic
1180548044 22:16520309-16520331 AGTGGCCGAGGGGTCGGGTGCGG + Intergenic
1180564161 22:16649024-16649046 CATGGGGGAGGGGAGGGGAGGGG + Intergenic
1180604212 22:17044095-17044117 AAGGGGTTAGGGATGGGGAGAGG + Intergenic
1180867896 22:19129967-19129989 CATGTCTGAGGGGTGGGGCAGGG - Intergenic
1180898372 22:19353686-19353708 CATGGCTGGGGCGTGGGGATGGG - Intronic
1180907948 22:19428893-19428915 GAAGCCTGAGGGGTGGGTAGTGG - Intronic
1180937427 22:19634781-19634803 CATGGCAGCGGGATGGGGAGGGG + Intergenic
1181030284 22:20146204-20146226 AGGGCCTGAGGGCTGGGGAGGGG - Intronic
1181271856 22:21663723-21663745 AAGGGCCGGGGTGTGGGGAGGGG - Intronic
1181273133 22:21672518-21672540 AATGGGTGTGGGGAGAGGAGGGG - Intronic
1181306609 22:21920635-21920657 CCTGGCTCAGGGGTGGGGAGCGG + Exonic
1181358009 22:22313504-22313526 AATGGCAGCTGGGAGGGGAGGGG + Intergenic
1181527068 22:23496105-23496127 AAGGGCTGAATGGTGGGGTGGGG - Intergenic
1181540695 22:23571620-23571642 CAAGACTGAGGGATGGGGAGGGG - Intergenic
1181973475 22:26711379-26711401 ATTGGTTGAGGGCTGGGGGGTGG + Intergenic
1182016197 22:27041952-27041974 AATCACTGAGGGGCGGGCAGCGG - Intergenic
1182130381 22:27845926-27845948 CAAGGATGAGGGGTGGGAAGGGG + Intergenic
1182143367 22:27981870-27981892 CATGGTTCTGGGGTGGGGAGAGG - Exonic
1182211411 22:28680053-28680075 AATGGCCGAGGGGTCGGGTCCGG - Intergenic
1182709180 22:32310041-32310063 GGTGGCAGCGGGGTGGGGAGGGG + Intergenic
1182804718 22:33059715-33059737 AGCAGCAGAGGGGTGGGGAGAGG - Intergenic
1182810375 22:33111171-33111193 AATGGGTGAGGGCTGGGTTGAGG + Intergenic
1183246724 22:36699636-36699658 AGTGGTTAAGGGGTGGGGGGTGG + Intronic
1183422356 22:37719241-37719263 CATGGTTGTGGGGTGAGGAGGGG + Intronic
1183438224 22:37807725-37807747 GATGGCAGAGGGGAGGGAAGGGG - Intergenic
1183471229 22:38007733-38007755 AATGCCTGAGGGAGGGAGAGGGG + Intronic
1183719910 22:39556876-39556898 AAGGGCTGTGGATTGGGGAGAGG - Intergenic
1184601737 22:45547855-45547877 CATGGCTGAGAGGTAAGGAGGGG + Intronic
1184867267 22:47208657-47208679 CAGGGGTGGGGGGTGGGGAGCGG + Intergenic
1184875307 22:47270516-47270538 ATTGGCTGGGGGGTAGGGGGGGG + Intergenic
1184911836 22:47540367-47540389 ACTGGCTGGGGGGGGGGGCGGGG - Intergenic
1185146787 22:49141510-49141532 AAGGCCTCAGGGGTGGGCAGGGG - Intergenic
949399598 3:3652105-3652127 ATTGTGTGTGGGGTGGGGAGGGG - Intergenic
949741421 3:7238831-7238853 AAAGGAAGAGGGGAGGGGAGGGG - Intronic
949954514 3:9256654-9256676 AGTGGATGAGGGATGGGGAGTGG - Intronic
950045932 3:9948728-9948750 CATGGCTGGGGTGTGGGGAGAGG - Intronic
950062813 3:10086311-10086333 TGTGGCTGAGGGGTAGGCAGTGG + Intronic
951003000 3:17585957-17585979 AATGGTGGGGGAGTGGGGAGTGG + Intronic
951405024 3:22285681-22285703 GACTGCTGTGGGGTGGGGAGAGG - Intronic
951473075 3:23077332-23077354 AGTGGCTGACGGGTCGGTAGAGG - Intergenic
951619401 3:24584421-24584443 TATGGCTGTGTGGGGGGGAGGGG + Intergenic
952207768 3:31197753-31197775 TATGTCTGAGGGTTGGGGGGTGG - Intergenic
953295353 3:41710420-41710442 TATGGCTGGGGGCAGGGGAGGGG - Intronic
953458587 3:43063307-43063329 GATGTCTGAGAGGTGGGGTGGGG - Intergenic
953571315 3:44073859-44073881 AAGAGCTGTGGGGAGGGGAGTGG + Intergenic
954538871 3:51380879-51380901 ACTGGCTTAGGGGTGGTGGGAGG + Intronic
954613678 3:51959009-51959031 GATGGCTGGAGGGTGGGTAGGGG - Intronic
955051136 3:55412160-55412182 AATAGCTGAGTGGTGTGGAGAGG + Intergenic
955060474 3:55488320-55488342 AAGGGCTGGGGGGTGGGAGGGGG - Intronic
955785932 3:62538896-62538918 ATGGACTGAGGGGTGGGGAGTGG - Intronic
955982286 3:64539290-64539312 AGTGGCTGTGGGGTGGAGAAGGG + Exonic
956150569 3:66237975-66237997 GATGGCTGGGGGATGGGGAAGGG - Intronic
956587296 3:70878266-70878288 AATGTCTCCTGGGTGGGGAGGGG + Intergenic
957257530 3:77857318-77857340 AAGGATGGAGGGGTGGGGAGAGG + Intergenic
957381266 3:79433169-79433191 AGAGGGTGAGGGGTGGGAAGAGG - Intronic
957576125 3:82010512-82010534 GAAGGCTGTGGGGTGGGGGGGGG + Intergenic
958523207 3:95217951-95217973 CCTGGCTGGGGGGTGGTGAGTGG + Intergenic
958620530 3:96552500-96552522 AGGGGCTGAGGGTTGAGGAGGGG - Intergenic
959521142 3:107324290-107324312 GAGAGGTGAGGGGTGGGGAGGGG - Intergenic
960628263 3:119702688-119702710 AAGGGCTGGGGGGAGGGGCGGGG + Intergenic
960742502 3:120850626-120850648 AATAGCAAAGGGGTGGGGCGTGG + Intergenic
960823160 3:121755914-121755936 AACTGCTGAGAGGTGGGAAGTGG + Intergenic
961139993 3:124547743-124547765 GGTAGCTGGGGGGTGGGGAGGGG - Intronic
961166388 3:124766632-124766654 AATGGTTTCGGGGTGGGGACGGG + Intronic
961222685 3:125212667-125212689 AAGGGCTGTGGGGGGTGGAGAGG - Intronic
961584142 3:127908433-127908455 AATGGGAGAAGGGAGGGGAGGGG - Intergenic
961603293 3:128076632-128076654 TAGGCCTGAGGGGTGGGGGGAGG - Intronic
961944674 3:130673458-130673480 AAAGGCGGGGAGGTGGGGAGAGG + Intronic
962158134 3:132970654-132970676 GATACCTGAGGGGAGGGGAGAGG - Intergenic
962202990 3:133415518-133415540 CATGGCTGAGTAGAGGGGAGAGG - Intronic
962217970 3:133539081-133539103 AAAGGCTGGGGTGCGGGGAGGGG - Intergenic
963008779 3:140750340-140750362 CATGGCTCAGGGATGGTGAGTGG + Intergenic
963399636 3:144781467-144781489 AATGGCTTAGGGTTGAGGAGAGG - Intergenic
963633047 3:147758028-147758050 AACTGCTGAGGGGTGGGGATGGG + Intergenic
963740958 3:149080519-149080541 AGTGGCAGAGGGGTGGCGACTGG - Intronic
963754547 3:149220280-149220302 AATGGCAGAGTGGTGGTGAGTGG + Intronic
963907420 3:150784037-150784059 CCTGGCTGGGGGATGGGGAGTGG + Intergenic
963946073 3:151146800-151146822 AAAGGAGGAGGGGTGGGGATGGG - Intronic
964155089 3:153575584-153575606 CATGGCTGAGGGAGAGGGAGAGG + Intergenic
964203390 3:154143671-154143693 AACAGCTGAGGGGTTGGGAATGG - Intronic
964586596 3:158313096-158313118 AAGGGGTGAGGGGAGGGGGGAGG - Intronic
965252836 3:166364636-166364658 GATGGTTGTGGGGTGGGGGGAGG + Intergenic
965611140 3:170545292-170545314 GATGGCAGAGGGGTTGGGGGAGG - Intronic
966750313 3:183315772-183315794 CAAGGCAGAGGGGTGGGGACAGG - Intronic
966838877 3:184072062-184072084 ATGGGCTGAGGGAGGGGGAGTGG + Intergenic
967349314 3:188494537-188494559 AAAGGGTGAGGGGTGGGGCAAGG - Intronic
967352426 3:188528325-188528347 AAAAGCTGGGGGGCGGGGAGGGG - Intronic
967834646 3:193950710-193950732 GATGTCTGAGAGGTGAGGAGTGG - Intergenic
967892872 3:194375464-194375486 AAGGGGGGAGGGGAGGGGAGGGG + Intergenic
967938549 3:194748513-194748535 AAGAGCTGAAGGGTAGGGAGAGG - Intergenic
967947898 3:194818588-194818610 AGTGGGTGAGGAGAGGGGAGAGG - Intergenic
967994501 3:195156392-195156414 AGAGGGTGAAGGGTGGGGAGGGG + Intronic
968136683 3:196224753-196224775 AATGGGAGAGGGGAGGGGAGGGG + Intronic
968313281 3:197701695-197701717 AATGGCTCAGGTATGGGGACAGG - Exonic
968359966 3:198139832-198139854 AATGGATGAGGAGGAGGGAGAGG + Intergenic
968473483 4:792274-792296 AGTGGCGGAGGGGTGAGGGGTGG - Intronic
968628559 4:1638666-1638688 AGTGTCGGAGGGGTGGGGGGCGG + Intronic
969058765 4:4418418-4418440 AAAGGCTGTGGGGTGGGGGTGGG + Exonic
969112615 4:4853131-4853153 AACGACTGAGCGGTAGGGAGGGG + Intergenic
969252997 4:5982286-5982308 AATGGCTGTGCGGTGGGGGGTGG + Intronic
969388753 4:6875009-6875031 ACTGGCTGAGGGGCATGGAGTGG - Intronic
969495658 4:7524778-7524800 AGTGGCGGCGGGGTGGGGAGGGG - Intronic
969632481 4:8346654-8346676 AAGGGCTGGGTGGTTGGGAGGGG + Intergenic
969873402 4:10118286-10118308 AAAGGCAAAGGCGTGGGGAGAGG + Intergenic
969930648 4:10627773-10627795 AATGCCTGTGGGGGTGGGAGTGG - Intronic
970212235 4:13721622-13721644 CCTGTCTGAGGGGTGGGGTGTGG + Intergenic
970908761 4:21249370-21249392 AATGGCAGTGGGCTGGGGAAGGG + Intronic
971898645 4:32628858-32628880 TGTGGTTGTGGGGTGGGGAGAGG + Intergenic
973139979 4:46754533-46754555 AAGGGGTGGGGGGTGGGGGGAGG + Intronic
973971585 4:56218505-56218527 AATGAGGGAGGGGAGGGGAGGGG - Intronic
974876893 4:67712807-67712829 GGTGACTGAGGGGAGGGGAGGGG + Intergenic
975397192 4:73890271-73890293 AAGGGGTGAAGGGTGGGGAATGG - Intergenic
976432624 4:84980832-84980854 CATGGGTGGGGGGAGGGGAGAGG - Intergenic
976493905 4:85703933-85703955 AGGGGCTGAGGGTGGGGGAGCGG - Intronic
978020470 4:103804341-103804363 TAGGGCTGAGGGGTTTGGAGGGG - Intergenic
978279438 4:106992415-106992437 AATGGCCAAGAGGTGGGAAGAGG - Intronic
980113707 4:128659019-128659041 ACTGGATGGGGGGTGGGGAGCGG + Intergenic
980345844 4:131617899-131617921 AATTGCTGAGAGGTGTGAAGAGG - Intergenic
980638091 4:135535897-135535919 AAGGGGAGGGGGGTGGGGAGGGG + Intergenic
980864194 4:138535542-138535564 AATGTGTGGGGAGTGGGGAGGGG + Intergenic
980990902 4:139737460-139737482 AATGGGAAGGGGGTGGGGAGAGG + Intronic
981036085 4:140170006-140170028 AAGGGCTGGGGGCTGGGTAGGGG + Intergenic
981225491 4:142289527-142289549 AAGGGCTGGGGGCTGGGAAGAGG - Intronic
981265248 4:142775513-142775535 AGTAGGGGAGGGGTGGGGAGGGG - Intronic
981413499 4:144460150-144460172 AAAGGCAGAGACGTGGGGAGGGG + Intergenic
982263066 4:153512557-153512579 AAAGGCTCAGGGATGAGGAGAGG - Intronic
982288899 4:153760286-153760308 AATGGCGGTGGGGGGGCGAGGGG + Intergenic
982644921 4:158011297-158011319 AATGATGCAGGGGTGGGGAGGGG - Intergenic
982908639 4:161112009-161112031 AATTGCTAAGGGGTGTGGGGAGG - Intergenic
982971460 4:161993012-161993034 CAAGGCGGAGGGGTGTGGAGGGG + Intronic
983647816 4:170009718-170009740 AATGGCTGGGAGGTAGGGAAGGG - Intronic
983902944 4:173155942-173155964 GTTTGCTGAGGGGTGGGGAAGGG - Intergenic
983937120 4:173509711-173509733 AAGGGCCCTGGGGTGGGGAGGGG - Intergenic
984046768 4:174810314-174810336 AATGGATTAGCGGTGGGGAGAGG + Intronic
984392601 4:179155934-179155956 AATGGGTCAGTGATGGGGAGTGG + Intergenic
984762758 4:183376819-183376841 GGTGGCAGAGAGGTGGGGAGTGG - Intergenic
985661519 5:1159414-1159436 AGTGGCTGAGGACAGGGGAGAGG + Intergenic
985859886 5:2462400-2462422 AATGGTTTGGGGCTGGGGAGTGG + Intergenic
986057879 5:4157253-4157275 CATTGCTGTGGGGTGGAGAGTGG + Intergenic
986234139 5:5892138-5892160 AATGCTTGTGGGGAGGGGAGGGG + Intergenic
986413062 5:7501642-7501664 ACTGGCGGGGGGGGGGGGAGGGG - Intronic
986470100 5:8065008-8065030 CATTCCTGGGGGGTGGGGAGGGG - Intergenic
986543554 5:8871827-8871849 AAAGGGGGAGGGGAGGGGAGGGG + Intergenic
986543681 5:8872943-8872965 AATGGCTCAGGGAGGGGCAGGGG - Intergenic
986777517 5:11031388-11031410 CAGGGCTGAGGGGTGGGGGATGG + Intronic
987002095 5:13670157-13670179 GATGGTTGTGGGGTGGGGGGAGG - Intergenic
988727413 5:33938404-33938426 AGAGGCTGTGGGGTGCGGAGCGG - Intergenic
988813237 5:34805884-34805906 AATAGCTGAGGGTTCGGGAAGGG - Intronic
989302676 5:39912355-39912377 CATGGTTGGGGGGTGGGGGGTGG + Intergenic
990981087 5:61602869-61602891 TGAGGCTGAGGGCTGGGGAGGGG + Intergenic
991289488 5:65018969-65018991 AAGGGCAGAGGAGTGGGCAGGGG - Intergenic
991293034 5:65051066-65051088 CAGGGCTGATGGATGGGGAGGGG + Intergenic
991310063 5:65228841-65228863 CATGGCTGAGTGGTTGGAAGAGG + Intronic
991372707 5:65936156-65936178 GATGGAGGGGGGGTGGGGAGAGG + Intronic
991967898 5:72109155-72109177 AAAGGCTGCAGGGTGGGGACTGG + Intronic
992081180 5:73235044-73235066 ATTGGGCGAGGGGTGGGGTGGGG - Intergenic
992204191 5:74414396-74414418 CATGTCTGGGCGGTGGGGAGAGG - Intergenic
992489056 5:77223376-77223398 AATGGGTGGGGGGAGGGGGGAGG - Intronic
992658625 5:78935936-78935958 AAGGGGGGAGGGGAGGGGAGGGG - Intronic
992745500 5:79816247-79816269 AAGGGGTGGGGGGTGGGCAGTGG + Intergenic
992770199 5:80040442-80040464 ATTGGCGGGGGGGTGGGGGGCGG + Intronic
992986772 5:82238360-82238382 GATGGCTGATGGCTGGGCAGTGG - Intronic
993001668 5:82387326-82387348 AATGCCTTGGGGGTGGGGTGGGG + Intergenic
993638998 5:90380082-90380104 GATGGCTGAAGGATGGGGATAGG - Intergenic
993905726 5:93621274-93621296 CCTGGCTGAGGGGCGGGGCGCGG - Intronic
994064924 5:95528604-95528626 ACAGGGTGAGGGGTGGGGATAGG - Intronic
994242081 5:97435106-97435128 AATGGCTGAAGGAAGAGGAGGGG + Intergenic
994770987 5:103981358-103981380 GATTGCTGGGGGCTGGGGAGAGG + Intergenic
994934682 5:106239065-106239087 AACGACAGAGGGGAGGGGAGAGG + Intergenic
995632726 5:114151311-114151333 AATGGCAGTGGGTTGGGGACAGG + Intergenic
995656819 5:114435111-114435133 AAGGGGTGAGGGGTGAGGGGTGG - Intronic
995873364 5:116765248-116765270 TAGGGGTGCGGGGTGGGGAGGGG - Intergenic
997015414 5:129928188-129928210 ACAGGGTGGGGGGTGGGGAGAGG - Intronic
997362270 5:133302683-133302705 GATGGCTGAGGGGCAGAGAGGGG - Intronic
997581809 5:135022347-135022369 AAGGGCTGAGGGATGGGAAAAGG - Intergenic
997755570 5:136395724-136395746 CATAGGTGAGTGGTGGGGAGAGG + Intronic
998107156 5:139475899-139475921 AAGGGGAGAAGGGTGGGGAGTGG + Intronic
998265851 5:140667256-140667278 CATGGCTGAGGGTGGGGAAGGGG - Intronic
999212498 5:149902337-149902359 AAGGGCAGAGGGGAGAGGAGGGG - Intronic
999491195 5:152053145-152053167 AATGGCAGAGAGGTCGGGTGAGG - Intergenic
999626167 5:153522569-153522591 AATGGTGGGGGAGTGGGGAGAGG + Intronic
999792653 5:154956494-154956516 CTGGGGTGAGGGGTGGGGAGGGG - Intronic
999960864 5:156754105-156754127 CATGGCTGAGATGTGGGGAAAGG + Intronic
999999743 5:157126435-157126457 AAGGGGGGAGGGGAGGGGAGGGG + Intronic
1000285111 5:159819968-159819990 TAGGGATGGGGGGTGGGGAGTGG + Intergenic
1000620832 5:163484770-163484792 TAGGGCTGAAGGGTGGGGTGGGG - Intronic
1001154015 5:169257385-169257407 AATGGTTGTGGGGCGGGGTGGGG - Intronic
1001249819 5:170138329-170138351 AATGGCTGGGGGTGGGGGGGAGG + Intergenic
1001434576 5:171689169-171689191 AATGCTTTAGGGGTGGGGAGTGG - Intergenic
1001572879 5:172742101-172742123 TCTGGCTGCTGGGTGGGGAGTGG + Intergenic
1001651742 5:173320644-173320666 AAGGGGTGAGGGGAGCGGAGAGG + Intronic
1001805669 5:174583811-174583833 AAGGGCTGTGGGATCGGGAGAGG - Intergenic
1001825025 5:174737542-174737564 AATGGATGTGGGGTGGGGGCGGG + Intergenic
1002091297 5:176808158-176808180 AGTAGCTGAGGCGTAGGGAGAGG - Intergenic
1002412930 5:179098027-179098049 AATGGCTGAAAGGTGAGGAGGGG + Intergenic
1002436437 5:179234640-179234662 AATGGCTGATGGGTTGGGGTAGG - Intronic
1002596471 5:180327237-180327259 AAAGGCTGTGGGGAGTGGAGAGG - Intronic
1002689827 5:181043000-181043022 AGTGGGTGAGTGGTGGGGTGGGG - Intronic
1003042586 6:2701778-2701800 ATTGGGTGGGTGGTGGGGAGAGG - Intronic
1003087605 6:3073511-3073533 GAAGACTGAGGGGTGGGGTGAGG - Intronic
1003507484 6:6751705-6751727 AATTGCTGGGGGAGGGGGAGGGG - Intergenic
1003756717 6:9128964-9128986 AATGGGTGGGGGGTGGGGGTGGG + Intergenic
1005426429 6:25707458-25707480 AGTGGTTGGGGGGTGAGGAGGGG + Intergenic
1005510608 6:26508815-26508837 AATGGGAGAGGGGTCCGGAGAGG - Exonic
1005842619 6:29753360-29753382 GATGGCTGGGGGGTGGGGGTGGG + Intergenic
1005844536 6:29767183-29767205 AATGGATGAGGAGGGAGGAGAGG - Intergenic
1006052414 6:31355078-31355100 AAGGGGTGAGGGGTGGGGTCTGG - Intronic
1006067132 6:31470200-31470222 AATGGCTGAAGAGGGAGGAGAGG + Intergenic
1006295317 6:33167562-33167584 AATGGCAGAGGAGTGGGGTGTGG + Intronic
1006411867 6:33878480-33878502 GATGGGTGTGGGGTGGGGTGAGG + Intergenic
1006457175 6:34138543-34138565 CAGAGCTGAGGGGAGGGGAGAGG - Intronic
1006896105 6:37472113-37472135 AAGGACTAAGGGGTGGGGTGTGG + Intronic
1007153165 6:39715380-39715402 AATGGCTTAGGGGAAGAGAGTGG + Intronic
1007385254 6:41516207-41516229 AAAGCCTGGGGGGTGGGTAGAGG - Intergenic
1007528850 6:42522265-42522287 AATTGGTGGGGGGTGGGGGGAGG + Intergenic
1007589779 6:43014118-43014140 GAGGGCTGAGGAGTGGGCAGGGG - Intronic
1007727730 6:43926785-43926807 AAAGGCTGAGGGTTGGGGGGAGG + Intergenic
1007783966 6:44270122-44270144 CAGGGCAGAGGAGTGGGGAGAGG - Intergenic
1007960600 6:45955731-45955753 AAGGACTGAGGGGTGGGGGAGGG - Intronic
1008267300 6:49444278-49444300 AATGGCTGTGGGGTGGGGAGGGG - Intronic
1008326447 6:50187818-50187840 AATGGCGGTGGGAAGGGGAGGGG - Intergenic
1008410114 6:51167657-51167679 AATGGCTGACTGGTGGGGTGGGG + Intergenic
1008538647 6:52527502-52527524 AAAGGGTGCGGGGTGGGGTGGGG + Intronic
1008786638 6:55175697-55175719 AATTTCTGAGGGTTGGGGAGGGG + Intronic
1008939804 6:57034502-57034524 ATTTGCAGAGGGATGGGGAGAGG - Intergenic
1009029997 6:58045364-58045386 GTGGGGTGAGGGGTGGGGAGGGG + Intergenic
1009205525 6:60796594-60796616 GTGGGGTGAGGGGTGGGGAGGGG + Intergenic
1010323216 6:74537812-74537834 AAAGTCTGATGAGTGGGGAGGGG - Intergenic
1010323230 6:74537893-74537915 AAAGGCTGATGAGTCGGGAGGGG - Intergenic
1011632346 6:89339562-89339584 GAGGGAAGAGGGGTGGGGAGGGG + Intronic
1011632384 6:89339639-89339661 AGTGGGGGAGGGGAGGGGAGGGG + Intronic
1012263819 6:97117453-97117475 AATGGGGGAGAGGTGTGGAGAGG - Intronic
1012716204 6:102674159-102674181 AATGAATGAGTGGTTGGGAGAGG - Intergenic
1012774673 6:103484412-103484434 AATATCCGGGGGGTGGGGAGAGG - Intergenic
1012925330 6:105261766-105261788 ACGGGCTGATGGCTGGGGAGAGG + Intergenic
1013044299 6:106469083-106469105 GAGGGGTGAGTGGTGGGGAGAGG - Intergenic
1013348859 6:109288381-109288403 AATGGCTGAGAGGTGGGCCCTGG + Intergenic
1013360589 6:109390597-109390619 GATGGCAGAGGGCAGGGGAGTGG + Intronic
1013393698 6:109713302-109713324 CATGGCTGAGGGGGCGGGGGAGG + Intronic
1014192271 6:118510592-118510614 CATGGCTGGGAGTTGGGGAGTGG + Intronic
1014622687 6:123688581-123688603 AGTGGGTGAAGGGTGGGAAGAGG + Intergenic
1015588555 6:134801116-134801138 AGTGGCTGAGGGTTGGGTGGCGG - Intergenic
1015684386 6:135843206-135843228 AGTGGCTGAGTGGAGGGCAGGGG + Intergenic
1015772636 6:136784625-136784647 AGTGGCTGAAAGGTGGGAAGGGG + Intronic
1016045850 6:139479646-139479668 GATGGAGGAGGGGTGGGGAGGGG + Intergenic
1016312004 6:142744233-142744255 AATAGATGAGGGGTTGGGAGGGG - Intergenic
1016448397 6:144156070-144156092 AAATCCTGAGGAGTGGGGAGGGG - Intronic
1016469426 6:144360094-144360116 AAGGGGGGAGGGGAGGGGAGGGG - Intronic
1017077676 6:150633725-150633747 AATGGCCGAGGGGAGGAGAGAGG + Intronic
1017163823 6:151390369-151390391 AGGGGCTGAGGGGGAGGGAGGGG + Intronic
1017185844 6:151599498-151599520 AATGTCTGGGAGTTGGGGAGGGG + Intronic
1017374674 6:153754918-153754940 AATGCCTGAAGGTTGGGGATGGG - Intergenic
1017637355 6:156456185-156456207 AAGGGGAGAGGGGAGGGGAGGGG - Intergenic
1017685950 6:156913985-156914007 AAGGGCTGGGAGTTGGGGAGTGG - Intronic
1018266240 6:162027725-162027747 ACTTGCTGGGGGGTGGGAAGGGG + Intronic
1018298460 6:162375350-162375372 ACTGGAGTAGGGGTGGGGAGCGG + Intronic
1018428312 6:163702830-163702852 AAGGGCAGAGGGGTGGGGTGGGG + Intergenic
1018640273 6:165898563-165898585 CAAGGCTGAGGGGTGAGGATTGG - Intronic
1018656408 6:166041383-166041405 CAGGGCTGTGGGGTGTGGAGGGG - Intergenic
1018817674 6:167347281-167347303 AGAGGCTGAGGAGTGGGTAGGGG + Intronic
1019299856 7:297401-297423 CAGGGCTGAGGGGTGGCGGGAGG + Intergenic
1019417688 7:934856-934878 CATGGGTGAGAGGTGGGCAGTGG + Intronic
1019477154 7:1249568-1249590 AATGGCTGGTGGGGGGGGTGGGG - Intergenic
1019489804 7:1306982-1307004 TATGGCAGAGGGGCGGGGGGTGG + Intergenic
1019520264 7:1457770-1457792 AAAGCCTCTGGGGTGGGGAGAGG - Intronic
1019564067 7:1670924-1670946 ACTGGCGGGGGGGTGGGGTGGGG + Intergenic
1019695970 7:2446340-2446362 ATTGGCAGAGGGGAGGAGAGAGG + Intergenic
1019927828 7:4204950-4204972 AATGGCTGTGTGGTGAGGTGCGG + Intronic
1020035635 7:4961353-4961375 CAGGGCTGAGGGCTGGGGGGTGG + Intergenic
1020035640 7:4961360-4961382 GAGGGCTGGGGGGTGGGGTGGGG + Intergenic
1020079945 7:5281968-5281990 CAAGGCTGAGGGGTGGGCAGCGG + Intronic
1020114760 7:5470321-5470343 GATGTGTGAGGGGTAGGGAGGGG - Intronic
1020154708 7:5713224-5713246 CAGAGCTGAGTGGTGGGGAGGGG + Intronic
1020607787 7:10360140-10360162 AGTGGCTGAGGGGTGGCCATGGG + Intergenic
1020712883 7:11630951-11630973 AATGGAGGAGGAGTAGGGAGAGG - Intronic
1021452662 7:20797507-20797529 AATGGCCGAGGGGTAAGGCGGGG + Intergenic
1021602774 7:22380601-22380623 AATGGTTGACGGGTGGGATGAGG + Intergenic
1021808601 7:24380645-24380667 AATGTCTTGGGGGTGGGGGGCGG - Intergenic
1021821135 7:24498547-24498569 TATAGCTGAGGGGTTGGGGGAGG + Intergenic
1022008493 7:26289025-26289047 AATTTCTGTGGGGTGGGGAAGGG - Intergenic
1022214437 7:28244173-28244195 AGGGGTTGAGAGGTGGGGAGGGG + Intergenic
1022239561 7:28496765-28496787 AGAGGCTGAGAGGTGGCGAGTGG - Intronic
1022544457 7:31173240-31173262 AATGGCTGCGGGGATGGGAGAGG + Intergenic
1022974225 7:35543139-35543161 AATAGCTCTGGGGTGGGGTGTGG - Intergenic
1023292358 7:38681509-38681531 AAGGGCTGAGGAGAGGAGAGAGG + Intergenic
1023424639 7:40022600-40022622 AATGGCTGAGGATTGGGGCTGGG + Intronic
1023609468 7:41958585-41958607 AAGGGAGGAGGGGAGGGGAGGGG - Intergenic
1023609828 7:41961509-41961531 AATGTGTGAGGAGTTGGGAGGGG + Exonic
1023685388 7:42728909-42728931 AATGGGAGTGAGGTGGGGAGGGG + Intergenic
1023896548 7:44438571-44438593 ACTGGGTGTGGGGTGGGGTGGGG - Intronic
1023932389 7:44713713-44713735 CCTGGATGAAGGGTGGGGAGGGG - Intergenic
1023938595 7:44756313-44756335 AGGGCCTGAGGGGTGGGCAGAGG - Intronic
1023951727 7:44851315-44851337 GAAGGCTGAGGGGTAGAGAGTGG - Intergenic
1023990702 7:45126544-45126566 AATGGCTGAGAGGTCTGGGGCGG + Intergenic
1024587850 7:50856810-50856832 AATGGCTGAGGTGTGGGCAGGGG - Intergenic
1024587925 7:50857108-50857130 AATGGCTGAGGTGGGGGGTGGGG + Intergenic
1024974700 7:55102275-55102297 TCTGGCTGAGAGATGGGGAGAGG - Intronic
1025198968 7:56950248-56950270 CAAGGCTGAGGGGTGGGCAGCGG - Intergenic
1025282437 7:57638070-57638092 AAAGGCAGTGGGGTGAGGAGAGG - Intergenic
1025302293 7:57827449-57827471 AAAGGCAGTGGGGTGAGGAGAGG + Intergenic
1025672978 7:63626685-63626707 CAAGGCTGAGGGGTGGGCAGCGG + Intergenic
1025945365 7:66100323-66100345 AAAGGAGGAGGGGAGGGGAGGGG + Intronic
1026367643 7:69665208-69665230 AAAGGCTTAGGGGAGGAGAGAGG - Intronic
1026452874 7:70544784-70544806 AATGGCTGCGGGGTGTGCTGGGG + Intronic
1026553863 7:71389684-71389706 ATGGGGTGCGGGGTGGGGAGTGG - Intronic
1026846461 7:73701554-73701576 AAGGGCTGTGGGCTGGGCAGGGG - Intronic
1026913422 7:74106034-74106056 AATGGGGGTGGAGTGGGGAGGGG - Intronic
1027175391 7:75899859-75899881 AATGGCTGCAGGGTGGGATGAGG - Intronic
1027195514 7:76027320-76027342 AATGGAAGAGGGGAGGGGATGGG + Intronic
1027355098 7:77346943-77346965 AAAGGCAGGGGGGTGGGGCGGGG - Intronic
1027397120 7:77767730-77767752 AAGGGGGGAGGGGAGGGGAGGGG - Intronic
1027888315 7:83937812-83937834 AATGGATGGGGAGTTGGGAGGGG - Intergenic
1028205476 7:88011732-88011754 AAAGGTTGGGGGGTGGGGGGCGG - Intronic
1028281282 7:88932217-88932239 AATGGCAGAGGGATGCTGAGAGG - Intronic
1028755179 7:94425930-94425952 GATGGTGGAGGAGTGGGGAGGGG + Intronic
1028984343 7:96998116-96998138 AAAGGATGTGGAGTGGGGAGGGG + Intergenic
1029185101 7:98732573-98732595 AAAGGATGATGGGTGGGGGGTGG + Intergenic
1029425056 7:100489666-100489688 AGTGAGTGAGGGGTGGGGAGTGG + Exonic
1029506249 7:100965686-100965708 GATGGCTGGGGGTTGGGGAGGGG - Exonic
1030079043 7:105761705-105761727 AATGGCGGTGGGGTGGGGGCAGG + Intronic
1030923449 7:115421195-115421217 AAGGGCTGAAAGGTGAGGAGAGG - Intergenic
1031045637 7:116884416-116884438 AGAAGCTGAGGGGTGGGGAAGGG - Intronic
1031960479 7:127985091-127985113 AATGGCAGAGAGGGAGGGAGTGG - Intronic
1031966384 7:128031038-128031060 GAGGGCAGAGGGGAGGGGAGGGG + Exonic
1031985600 7:128162842-128162864 CATGGCAGAGGAGTGTGGAGAGG + Intergenic
1032122088 7:129163952-129163974 AAAGGGAGAGGGGAGGGGAGGGG + Intronic
1032122537 7:129167660-129167682 CATGGCTGAGGGGTAGGGAAAGG + Intronic
1032284652 7:130531185-130531207 GGTGGGTGGGGGGTGGGGAGTGG + Intronic
1032735878 7:134692266-134692288 GGTGGGTGAGGGGTGGGGTGGGG - Intergenic
1033133347 7:138764234-138764256 GATGGAGGAGGGGTGAGGAGGGG + Intronic
1033267299 7:139897324-139897346 CTTGGCGGTGGGGTGGGGAGGGG + Intronic
1033357324 7:140610803-140610825 TATGCCTGAGGGGAGAGGAGCGG + Intronic
1033653988 7:143361624-143361646 AATGGGGGAGGGGGTGGGAGAGG + Intronic
1033660968 7:143401726-143401748 TGGAGCTGAGGGGTGGGGAGAGG - Intronic
1033910906 7:146262088-146262110 AATGGCTGAGTGGCAGGGACAGG - Intronic
1033969779 7:147025336-147025358 AAGGGGGGAGGGGAGGGGAGGGG + Intronic
1034273461 7:149814230-149814252 TAAGGATGAGGGGAGGGGAGAGG + Intergenic
1034310649 7:150084818-150084840 AATGGGTGTGGGAGGGGGAGTGG + Intergenic
1034796188 7:154015813-154015835 AATGGGTGTGGGAGGGGGAGTGG - Intronic
1034895602 7:154874638-154874660 AAGGGCTGAGGAGTGGGGTGGGG - Intronic
1034921299 7:155084554-155084576 CATGGCTGTTGGGTGGGGATGGG - Exonic
1034934568 7:155190576-155190598 AATCGCTGCGGGGGGGGGGGGGG - Intergenic
1035454634 7:158999941-158999963 CAAGGCTGCCGGGTGGGGAGCGG - Intergenic
1035520814 8:273921-273943 ACTGGGTGAGGGGTGAGAAGTGG + Intergenic
1035550433 8:519573-519595 AGGGGCTGAGGGTGGGGGAGAGG - Intronic
1036224396 8:6945460-6945482 AAGGGCTGAGGGGAGGGGCAGGG - Intergenic
1036392546 8:8336885-8336907 AAGGGGTGTGGGGAGGGGAGTGG - Intronic
1036678389 8:10853014-10853036 ATTGGTGGAGGGGTGTGGAGGGG + Intergenic
1037135577 8:15455809-15455831 AATGGCTGAGTTTTGGGGAAGGG - Intronic
1037319985 8:17632774-17632796 AGTGGAGGAGGGCTGGGGAGAGG - Intronic
1037777138 8:21842947-21842969 TCAGGATGAGGGGTGGGGAGAGG - Intergenic
1037933734 8:22900225-22900247 AATGGGGAAGGGTTGGGGAGGGG + Intronic
1038123667 8:24646607-24646629 AATAGCTGATGGGTGGGGCGCGG + Intergenic
1038293570 8:26271028-26271050 AAAGGGTGGGGGGTGGGGGGGGG + Intergenic
1038491647 8:27976118-27976140 CGGGGCTGAGGGGTGGAGAGAGG + Intronic
1038645748 8:29360549-29360571 AGGGGCTAAGGGGAGGGGAGTGG - Intergenic
1038713141 8:29967196-29967218 AAGAGCTGGGGCGTGGGGAGAGG + Intergenic
1038990188 8:32859443-32859465 GTGGGCTGAAGGGTGGGGAGGGG + Intergenic
1039040165 8:33400149-33400171 GATGGTGGGGGGGTGGGGAGGGG + Intronic
1039052203 8:33505250-33505272 AAAGGCAGCAGGGTGGGGAGGGG + Intronic
1039448954 8:37655823-37655845 TATGTGTGAGGGGTGGGAAGTGG + Intergenic
1039460832 8:37742653-37742675 AGTGGATAGGGGGTGGGGAGAGG + Intronic
1039604688 8:38870850-38870872 AATGCCTGCAGGGTGGGGAGTGG - Intergenic
1039762393 8:40591527-40591549 AATGGTACTGGGGTGGGGAGGGG - Intronic
1039844411 8:41315734-41315756 GATGGCTGCGGGGAGGGCAGCGG + Intergenic
1040280502 8:46039576-46039598 AATGGCTGAGGCGTGGGTGTCGG - Intergenic
1041007295 8:53507973-53507995 GATGGGTGGGGGGTGGGAAGTGG - Intergenic
1041090657 8:54298053-54298075 AGTGGGTGGGAGGTGGGGAGGGG + Intergenic
1041908914 8:63066969-63066991 GGTGGCTGAGGTGGGGGGAGGGG + Intronic
1042339719 8:67666409-67666431 ACTGAGAGAGGGGTGGGGAGGGG + Intronic
1042996024 8:74699636-74699658 AAAGGCTGGGAGGTGGGGCGAGG + Intronic
1043479294 8:80637054-80637076 AATGCCTGGGGGTGGGGGAGGGG - Exonic
1043981324 8:86643425-86643447 GAAGGGTGAGTGGTGGGGAGAGG - Intronic
1044671644 8:94687170-94687192 AGTTGTTTAGGGGTGGGGAGAGG - Intronic
1044830852 8:96246958-96246980 AATAGAAGAGGGGAGGGGAGGGG - Intronic
1044947213 8:97400597-97400619 AAGGGCAGTGGGGTGGGGATGGG - Intergenic
1045291801 8:100839896-100839918 AGGGGCTGTGGGGTGGGGAATGG + Intergenic
1045706606 8:104930746-104930768 CATGGGGGAGGGGAGGGGAGGGG - Intronic
1045850833 8:106696822-106696844 TGTGGCTAAGGGGTGGGGTGAGG - Intronic
1045927025 8:107586335-107586357 AATATCTGGGGGGGGGGGAGAGG - Intergenic
1046724061 8:117655507-117655529 AAAGGCTGAGTGGAGGGCAGGGG - Intergenic
1047492845 8:125388665-125388687 AAGGGGTGGGGGGAGGGGAGCGG - Intergenic
1047588113 8:126296798-126296820 AATGGGGGAGTGGTGGGGTGAGG - Intergenic
1048053025 8:130837148-130837170 TATGGGTGTGGGGTGGGGACTGG - Intronic
1048082672 8:131146125-131146147 AACAGATGAGGGGTGGGGAGAGG + Intergenic
1048092501 8:131256318-131256340 GATTGTTGTGGGGTGGGGAGAGG + Intergenic
1048262484 8:132956769-132956791 TGTGGCTGAGGGATGGGAAGGGG + Intronic
1048509836 8:135052171-135052193 AATGATTGAGGAGGGGGGAGGGG + Intergenic
1048590341 8:135815502-135815524 CCAGGCTGTGGGGTGGGGAGAGG - Intergenic
1048987740 8:139744334-139744356 AAAGGAGCAGGGGTGGGGAGGGG - Intronic
1049173744 8:141178558-141178580 AATCTCTGACTGGTGGGGAGCGG + Intronic
1049368588 8:142252830-142252852 AATGGCTGAGGGGTGGGGAGGGG - Intronic
1049422651 8:142523772-142523794 ACTGGGAGGGGGGTGGGGAGGGG + Intronic
1049511359 8:143028367-143028389 AGGGGCTGAGTGGTGGGGGGCGG - Intergenic
1049525170 8:143121766-143121788 TGTGGCAGATGGGTGGGGAGGGG + Intergenic
1049578815 8:143401568-143401590 GAGGGCAGAGGGGAGGGGAGGGG + Intergenic
1049578829 8:143401595-143401617 GAGGGCAGAGGGGAGGGGAGGGG + Intergenic
1049640681 8:143713798-143713820 CATGGGTGAGGTCTGGGGAGAGG - Intronic
1049661354 8:143821013-143821035 AATGTCTGAGGGCTGGGCGGGGG + Intronic
1049706947 8:144047417-144047439 GCTGGGTGAGGGGCGGGGAGGGG + Intergenic
1049737761 8:144218817-144218839 AAGGGAGGAGGGGAGGGGAGGGG - Intronic
1050418571 9:5438928-5438950 TAGGGCTGAGGGGTGGGGGAAGG + Intergenic
1050475369 9:6034989-6035011 AATGGCTGTGCAGTGGGGAGAGG - Intergenic
1050846674 9:10229694-10229716 GATGGTTGTGGGGTGGGGGGAGG + Intronic
1051454014 9:17231807-17231829 AATGGGTGGGGGGTAGGGAAGGG - Intronic
1052465857 9:28829043-28829065 TATGGCTGCAGGATGGGGAGTGG - Intergenic
1052612825 9:30798168-30798190 AATGACTAAGGGGTGGTGAGTGG - Intergenic
1052685418 9:31749315-31749337 AAGGGCTGAGGGTGGAGGAGAGG + Intergenic
1052817147 9:33110582-33110604 CATGGCTGTGGGATGGGGTGGGG - Intronic
1053248106 9:36551903-36551925 AATGTCTGGGGGGCGGGGAGGGG + Intergenic
1053342315 9:37347977-37347999 AATGTTTAAGGGGTGGGCAGAGG - Intronic
1053688708 9:40568728-40568750 AATGGCAGCTGGGAGGGGAGGGG - Intergenic
1054275326 9:63062329-63062351 AATGGCAGCTGGGAGGGGAGGGG + Intergenic
1054299948 9:63369639-63369661 AATGGCAGCTGGGAGGGGAGGGG - Intergenic
1054399505 9:64702602-64702624 AATGGCAGCTGGGAGGGGAGGGG - Intergenic
1054433086 9:65186867-65186889 AATGGCAGCTGGGAGGGGAGGGG - Intergenic
1054497297 9:65834808-65834830 AATGGCAGCTGGGAGGGGAGGGG + Intergenic
1054758359 9:68981465-68981487 AATGGCGGAGGGTGGGGGTGGGG + Intronic
1054809732 9:69425357-69425379 AATGGCTCTGGGATGGGCAGGGG + Intergenic
1055098844 9:72442087-72442109 AATGACTGAAGTGTGGAGAGAGG - Intergenic
1055692788 9:78851754-78851776 AACACCTGAGGGGTGGGGACGGG + Intergenic
1056177592 9:84050442-84050464 AATGACTGAGGGTTCTGGAGTGG + Intergenic
1056198260 9:84249596-84249618 AAGGCCAGGGGGGTGGGGAGTGG + Intergenic
1056533456 9:87507594-87507616 GATGCCAGAGTGGTGGGGAGGGG + Intronic
1056590568 9:87963333-87963355 AATATGTGGGGGGTGGGGAGGGG + Intergenic
1057173675 9:92978688-92978710 AATGGGGGAAGGGAGGGGAGGGG - Intronic
1057173692 9:92978725-92978747 GATGGGGGAGGGGAGGGGAGGGG - Intronic
1057216196 9:93230194-93230216 GAGGGCTGGGGAGTGGGGAGTGG + Intronic
1057231592 9:93324691-93324713 GATGGAGGAGGGGTGGGCAGGGG + Intronic
1057360281 9:94367003-94367025 TAAGGCTGACAGGTGGGGAGAGG + Intergenic
1057663058 9:97021074-97021096 TAAGGCTGACAGGTGGGGAGAGG - Intergenic
1057801798 9:98195515-98195537 AGTGCCTGGGGGTTGGGGAGGGG + Intergenic
1057846758 9:98531844-98531866 GATGGGTGAAGGGTGGGGAGTGG - Intronic
1057884746 9:98821803-98821825 AAAAGCAGAGGAGTGGGGAGGGG - Intronic
1058108506 9:101003409-101003431 AGTTGTTGAGGGGTGGGGTGGGG + Intergenic
1058633728 9:107016508-107016530 GCTGCCTGAGGGATGGGGAGTGG + Intergenic
1058842252 9:108921261-108921283 TAGGGCTGTGGGGTGGGGTGGGG - Intronic
1059006801 9:110411315-110411337 AATGTATGAGAGGTGGGCAGTGG - Exonic
1059435829 9:114275713-114275735 AAGGGCTGATGGGTGAGGACGGG + Exonic
1060754778 9:126204481-126204503 AGTGGCTGAGGGCTTGGCAGGGG + Intergenic
1060865414 9:126991282-126991304 CCTGCCTGAAGGGTGGGGAGAGG + Intronic
1061087160 9:128405880-128405902 ACTGGCTGGGGGTTGGGCAGAGG - Intergenic
1061180464 9:129022436-129022458 GAAGGCCAAGGGGTGGGGAGGGG + Intronic
1061208115 9:129176060-129176082 ACTGGGTAAGGGGTGGGGGGCGG - Exonic
1061259624 9:129472719-129472741 AATGGCTGCAGGGAGGGGTGGGG + Intergenic
1061277972 9:129580400-129580422 AAGGGCTGAGGGGCGGTGGGGGG - Intergenic
1061283998 9:129612132-129612154 TGAGGCTGAGGGGTGGGGACAGG - Intronic
1061405752 9:130392221-130392243 ACTCGCTGTGGGGTGGGGAGTGG - Intronic
1061625476 9:131838553-131838575 AGAGGCTGAGGAGTGGGGAAGGG - Intergenic
1061840627 9:133356723-133356745 AGGGGCTGAGGGGAGGGCAGGGG + Intronic
1062182660 9:135198994-135199016 AATGGCAGAAGGGTCTGGAGAGG + Intergenic
1062255205 9:135617581-135617603 GAAGGTTGAGGGGTTGGGAGGGG + Intergenic
1062261987 9:135667462-135667484 AATGGAGGTGGGGTGGGGGGTGG - Intergenic
1062292185 9:135800920-135800942 AATTACTGGGGGTTGGGGAGGGG + Intergenic
1062376266 9:136263195-136263217 ACTTGCTGGGGGGTGGGGTGGGG - Intergenic
1062413745 9:136437758-136437780 CATGGCAGTGGGGTGGGGGGAGG + Intronic
1203633462 Un_KI270750v1:91344-91366 AAAGGCAGTGGGGTGAGGAGAGG - Intergenic
1185511662 X:668309-668331 AGTGGGGGAGGGGAGGGGAGGGG - Intergenic
1185927539 X:4163928-4163950 AGAGGCTGAAGGGTGAGGAGGGG + Intergenic
1186371325 X:8950326-8950348 AGGGGCTGAGGGGAGGGGACCGG - Intergenic
1186523631 X:10228221-10228243 AATGGGGGAGGGGGGAGGAGGGG - Intronic
1186624054 X:11273108-11273130 AAAGGGTGAGGTTTGGGGAGGGG - Intronic
1187522542 X:20026408-20026430 AGGGGCTGAGGGGAGGGGAATGG - Intronic
1188308279 X:28585924-28585946 AAAGGTTGCAGGGTGGGGAGAGG + Intergenic
1188311079 X:28617259-28617281 AATGGCATGGGGGTGGGAAGGGG - Intronic
1188442052 X:30222597-30222619 ATTCGCTGAGGGGAGGGGAGTGG + Intergenic
1188618921 X:32195213-32195235 AATAGATGAGGGCTGGGGAAGGG + Intronic
1189056908 X:37707624-37707646 ATTGTCTGAGATGTGGGGAGCGG - Intronic
1189161821 X:38817161-38817183 AATCGCAGTGGGGAGGGGAGGGG - Intergenic
1189709015 X:43789928-43789950 ATTGGGTGGGGGGTGTGGAGGGG + Intronic
1189723613 X:43946477-43946499 TGGGGCTGAGGGGTGGGTAGGGG - Intergenic
1189876779 X:45444420-45444442 CATAGCTGAGTGGTTGGGAGAGG - Intergenic
1190214727 X:48472470-48472492 AATGGCTCTGGGTGGGGGAGGGG - Intergenic
1190288462 X:48975987-48976009 CAGGGCTGAGGGCCGGGGAGGGG + Intronic
1190712802 X:53081914-53081936 AGTTGCTGAGGGGAGGGGGGCGG + Intergenic
1190829251 X:54045209-54045231 ATAGCCTGAGGGGAGGGGAGAGG + Exonic
1191953505 X:66619579-66619601 CATTACTGAGGGTTGGGGAGAGG + Intronic
1192180120 X:68911072-68911094 CATGGCAGGGAGGTGGGGAGGGG - Intergenic
1192219771 X:69189914-69189936 CTGGGCTGAGGGGTGTGGAGGGG - Intergenic
1192258160 X:69483462-69483484 ATGGGGTGGGGGGTGGGGAGAGG + Intergenic
1192342901 X:70278668-70278690 AATGGTTGAGGGGTAGGAAATGG - Intronic
1192625401 X:72722037-72722059 AATGGCAGGGGGCAGGGGAGGGG - Intergenic
1193123832 X:77850483-77850505 AAGGGGGGGGGGGTGGGGAGTGG + Intronic
1193698733 X:84739379-84739401 AATGGAGGAGGGGAGGGTAGGGG - Intergenic
1194813258 X:98412667-98412689 AAATGCTGAGGGCTGGGGTGGGG - Intergenic
1194931076 X:99888059-99888081 CAGGGCTGAGCGGTGTGGAGCGG - Intergenic
1194984286 X:100473360-100473382 AATGGATGAGGGGTGGGGGGAGG + Intergenic
1195252640 X:103063727-103063749 AAGGGCTGGGGTGTGGGGAGGGG + Exonic
1195598318 X:106718519-106718541 ATTAGCTGGGGGGTGGGGGGAGG - Intronic
1195693700 X:107650543-107650565 ATTGGGTGGGGGGTGGGGGGTGG + Exonic
1195839228 X:109154514-109154536 CAGGGCTGAGTGGTTGGGAGAGG - Intergenic
1195889132 X:109672283-109672305 AATGGGGGTGGGGAGGGGAGAGG + Intronic
1195929179 X:110056189-110056211 AATTGCTTAGGGCTGGTGAGTGG - Intronic
1196061904 X:111417561-111417583 AACCTTTGAGGGGTGGGGAGGGG - Intergenic
1196462516 X:115944990-115945012 TATGGCTGGGGAGTGGGGAAAGG + Intergenic
1196746130 X:119073126-119073148 TGTGGCTGAGGGGAGGTGAGGGG - Intergenic
1196813577 X:119647337-119647359 AATGGAGGAAGGGAGGGGAGGGG - Intronic
1197270350 X:124418352-124418374 AATATCTGGGGGGTGGGGGGTGG - Intronic
1197322802 X:125053550-125053572 AGTGGCTGCAGGGTGGGGTGTGG + Intergenic
1197755862 X:129994200-129994222 GATGGCTGAGAAGTGGGGACTGG + Intronic
1197892343 X:131279564-131279586 ATAGGCTGCGGAGTGGGGAGGGG - Intronic
1198220085 X:134590859-134590881 AAAAGCTAAGGGGTGGGGTGGGG - Intronic
1198220146 X:134591415-134591437 AATGGCAGAGGAGTGAGGAGTGG + Intronic
1198740845 X:139840857-139840879 AAAGACTGAAGGGTGGGAAGGGG + Intronic
1198809890 X:140524576-140524598 AATGGGAGAGGGGAGGGGAAGGG + Intergenic
1198911372 X:141618508-141618530 AATTGCTTAGGGCTGGGGATGGG - Intronic
1198943536 X:141984982-141985004 AGTTGCTGAGGAGTGGGGAATGG - Intergenic
1199297841 X:146179515-146179537 AATGGCAGAGGTGTGGGAAGTGG + Intergenic
1199713797 X:150491626-150491648 AATGGCTGGGAGGTGGGGCAGGG + Intronic
1199767955 X:150954163-150954185 CCTGCCTGGGGGGTGGGGAGAGG + Intergenic
1199840062 X:151636905-151636927 AATGGGTTAGGGGTGAGGTGGGG - Intronic
1199895911 X:152127742-152127764 AATGGAGGAGGGGTGGGAACAGG - Intergenic
1200102365 X:153694453-153694475 CATGGCTGAGGGCTGGGCTGGGG + Intronic
1200179172 X:154140037-154140059 GGAGGCTGAGGGGTGGGGAAAGG + Intergenic
1200236014 X:154468064-154468086 AAAAGCTGGGGGGTGGAGAGAGG - Exonic
1201173635 Y:11294263-11294285 AATGGGGGAGGGGAGGGGAGTGG - Intergenic
1201949048 Y:19542919-19542941 AATGGGTGAGGGGAGGGGAGTGG - Intergenic