ID: 1049368589

View in Genome Browser
Species Human (GRCh38)
Location 8:142252831-142252853
Sequence AAATGGCTGAGGGGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 940
Summary {0: 1, 1: 2, 2: 9, 3: 93, 4: 835}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368589_1049368603 22 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368589_1049368604 23 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368589_1049368598 -8 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368598 8:142252846-142252868 AGCCATTTCCTCTGCACAATGGG No data
1049368589_1049368606 27 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368589_1049368602 21 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368589_1049368601 6 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368589_1049368597 -9 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368597 8:142252845-142252867 CAGCCATTTCCTCTGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368589 Original CRISPR AAATGGCTGAGGGGTGGGGA GGG (reversed) Intronic
900079214 1:843010-843032 TAGTGGCTGTGGGGTGGGGCTGG - Intergenic
900138560 1:1129070-1129092 TATTGGCTGGGGGGTGGTGAGGG + Intergenic
901023963 1:6269408-6269430 ATATGGCTGAGGGCAGGGCAGGG - Intronic
901076940 1:6561025-6561047 GAAAGGCTGTGGGGTTGGGATGG + Intronic
901365840 1:8747349-8747371 AAATGGCATGGGGGTGGGCATGG + Intronic
901820381 1:11825476-11825498 AAATGGCTGAGCTGAGGGAAGGG - Intronic
901844011 1:11970982-11971004 GAGGGACTGAGGGGTGGGGATGG + Intronic
902204944 1:14861607-14861629 AAATGAATTAAGGGTGGGGAGGG - Intronic
902301905 1:15507803-15507825 AAGGACCTGAGGGGTGGGGAGGG + Intronic
902302475 1:15511890-15511912 AAATTGCCAAGGGCTGGGGAGGG - Intronic
902511150 1:16967686-16967708 AAAGGCCTGGGGAGTGGGGATGG - Intronic
902596115 1:17510431-17510453 AGGTGGCTCAGTGGTGGGGATGG + Intergenic
902824041 1:18960451-18960473 AAATGGCTGGGGAGTGGGGCAGG - Intergenic
902845849 1:19110211-19110233 AAAAGGCTGAGAGCTAGGGATGG + Exonic
902862599 1:19256998-19257020 ATGTTGCTGAGGGATGGGGAGGG + Intronic
902862683 1:19257460-19257482 AAAAGGTTGAGGGGTGAGGTGGG + Exonic
903130210 1:21274271-21274293 GACTGGCAGAGAGGTGGGGAAGG - Intronic
903306171 1:22414758-22414780 GAAGGGTGGAGGGGTGGGGAAGG - Intergenic
903578054 1:24351356-24351378 AGAAGGCTGAGGGTGGGGGAAGG + Intronic
903643288 1:24875014-24875036 AAATGGCTGTGGGTACGGGATGG - Intergenic
903778050 1:25805772-25805794 AGAGGGCTGTGGGGTGGGGAGGG + Intronic
903859685 1:26357222-26357244 AAATGAGTCAGGGGTGGGGAGGG - Intergenic
904449601 1:30602327-30602349 AAATGGCAGAAGGGAGTGGATGG - Intergenic
904542119 1:31239985-31240007 GAACGGCAGAGGGGTGGGGCGGG + Intergenic
904605411 1:31695388-31695410 AAATGGCTGTGGGGCTGGGTGGG - Intronic
904634508 1:31869403-31869425 AACTGGCTTAGGGGAGTGGACGG + Intergenic
905060792 1:35137409-35137431 AAATGGTTGAGGGATAGTGAGGG + Intergenic
905459910 1:38115856-38115878 CCAGGGCTGAGGGGTGGGCAGGG - Intergenic
905487448 1:38313149-38313171 ACTAGGCTAAGGGGTGGGGATGG + Intergenic
906133438 1:43476678-43476700 AACTGGCTCAGGGGCAGGGAAGG + Intergenic
906189012 1:43883687-43883709 ACAAGGGTGCGGGGTGGGGAGGG + Intronic
906224970 1:44114126-44114148 AAAAGGCTGAAAGGTGGGGCTGG + Intergenic
906557248 1:46723646-46723668 CTATGGCTGAGGTGGGGGGAAGG + Intergenic
906562028 1:46765477-46765499 AAGTGGGTGGAGGGTGGGGAAGG - Intronic
906642670 1:47450665-47450687 AGGTGGCTGAGTTGTGGGGAGGG + Intergenic
906935723 1:50212567-50212589 AGATGGTTGAGGGGAGGGGAGGG - Intergenic
907039446 1:51245441-51245463 AAAAGGCTGTTGGGTGGGCATGG - Intronic
907533531 1:55126626-55126648 AAATGGCTGAGTGATGTGAAAGG + Intronic
907804460 1:57804390-57804412 AAATGGCTCAGTGGTCTGGATGG + Intronic
908223087 1:62028306-62028328 AAAAGGCTGAGGTGGGAGGATGG - Intronic
908508318 1:64828158-64828180 AAATGGGCGGGGGGTGGGGGGGG - Intronic
908681186 1:66663214-66663236 AAGTGGGTGGGGGATGGGGAGGG - Intronic
908784142 1:67718584-67718606 AAATGGGTTGGGGGTGGGGGTGG - Intronic
909014254 1:70366186-70366208 AAATGGTTGAGGGGTGAGTAAGG - Intronic
909655537 1:78027867-78027889 AAATGGAGGAGAGGTGGGAATGG - Intronic
909923685 1:81413145-81413167 AAACGGCTGAGGTGGGTGGAGGG - Intronic
910108354 1:83655520-83655542 AAGAGGCTGAGGGGCGAGGATGG - Intergenic
910210902 1:84791900-84791922 TAGTGGCTGAGGTGTGGGGCCGG + Intergenic
910355091 1:86344171-86344193 AAAGGGTTGTGGGGAGGGGAGGG - Intergenic
910375727 1:86567486-86567508 AAATGGATCCTGGGTGGGGATGG + Exonic
911181938 1:94868950-94868972 AAATGGCTGAGGTGGAGGAAGGG + Intronic
912007526 1:104922867-104922889 AAATGGAATAGGGGTGGGGCTGG - Intergenic
912526862 1:110290001-110290023 AGATGGCTGAGGTCTGGGGCAGG - Intergenic
912624679 1:111197328-111197350 ACAAGGCTGAGGGCTGGGGAGGG + Intronic
912978643 1:114351328-114351350 CAGTGGCTGAGGTGTGGGGTGGG - Intergenic
913131655 1:115843098-115843120 AAAAGGCAAAGGGGTGGGGGAGG - Exonic
913188502 1:116392622-116392644 AAGCTGCTGTGGGGTGGGGAAGG + Intronic
913275794 1:117136700-117136722 AAAAGGGTGGGGGGTGGGGTGGG + Intergenic
913557700 1:119984950-119984972 AAATGGGGGAGGAGTGGAGAAGG + Intronic
915107046 1:153541203-153541225 AAATGGCTCTGGGGTGGAGGTGG - Intronic
915162824 1:153932146-153932168 AAATGGCTGAGAGATGAGGGAGG + Intronic
915747596 1:158176633-158176655 AAGCGGTGGAGGGGTGGGGATGG + Intergenic
916124012 1:161553210-161553232 GATTGGCTGAGGGGTGATGAAGG + Intergenic
916133895 1:161634572-161634594 GATTGGCTGAGGGGTGATGAAGG + Intronic
917262567 1:173186352-173186374 ATATCCCTGAGGGGTGGGGGCGG + Exonic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917376894 1:174358450-174358472 AAATGGCTGGCGGGTGGTGTAGG + Intronic
917470869 1:175324790-175324812 AAACAGCTGAGGGTTGGGGGTGG - Intronic
917665021 1:177218038-177218060 CCATGGGTGAGGTGTGGGGATGG + Intronic
918082445 1:181217999-181218021 AGATGGGTGAGGGTTGAGGAGGG + Intergenic
918093742 1:181318021-181318043 AAAGGGGAAAGGGGTGGGGATGG - Intergenic
918248193 1:182679247-182679269 AAATGGCAAAGGGGTTAGGAGGG - Intronic
918547528 1:185701511-185701533 GAATGACTGAGGGCTGGGGAAGG - Intergenic
918708712 1:187701213-187701235 ATATGGCTGGTGGGTGTGGAAGG - Intergenic
920282411 1:204854083-204854105 AAAAGGCTGGTGGGTGGGGGTGG - Intronic
920531686 1:206706921-206706943 GAATGAATGAGGGGTAGGGAAGG - Intronic
922013988 1:221624082-221624104 AAATGCCTGAGGGGAGGGGATGG - Intergenic
922956914 1:229610762-229610784 GAAGGGCTGAAGGGTGAGGAAGG - Intronic
923087760 1:230714148-230714170 TTATAGCTGAGGGGTGGGGATGG + Exonic
923223059 1:231913865-231913887 AAATGGCTGAGGAGAGGAGATGG - Intronic
923436158 1:233969898-233969920 AAATGGCTGGGGAACGGGGAAGG + Intronic
923818451 1:237406218-237406240 AGATGGGAGAGGGGAGGGGAGGG - Intronic
1062942356 10:1433586-1433608 AGATGACTGAGGGGTGGAGCAGG + Intronic
1063616178 10:7602286-7602308 AAATGGCAGTGAGGTGGTGAAGG - Intronic
1064066541 10:12186992-12187014 AAAAGACTGAGAGGTGGGCATGG - Intronic
1064225918 10:13485088-13485110 ACGGGGCAGAGGGGTGGGGAAGG - Intronic
1064471094 10:15636785-15636807 AAATGGCTAAGGGGCAGCGAGGG + Intronic
1064557503 10:16562028-16562050 AAATGCCTGAGGGCTGGGCGTGG - Intergenic
1064816257 10:19267405-19267427 TAATGTGTGAGGGGTGGGGGAGG - Intronic
1065218676 10:23474429-23474451 AAATGCAAGAGGGGAGGGGAGGG - Intergenic
1065726885 10:28676428-28676450 AAGGGGGTGGGGGGTGGGGAAGG - Intergenic
1065944565 10:30594892-30594914 AGATGCCCGAGGGGTGGGGGGGG + Intergenic
1066286558 10:33972117-33972139 TAATTGCTTAGGGCTGGGGAGGG - Intergenic
1067058254 10:43064730-43064752 GGATGGCGGAGGGGTGGGGGCGG - Intergenic
1067105582 10:43363923-43363945 AAGTTGTTGCGGGGTGGGGATGG - Intergenic
1067275379 10:44828844-44828866 AAAATGCAGAGGGGAGGGGAGGG + Intergenic
1067296257 10:44976700-44976722 AAGTGGTGTAGGGGTGGGGATGG + Exonic
1068288544 10:54971299-54971321 AAATGGCTGAGGGAACTGGATGG + Intronic
1068585808 10:58796921-58796943 ATCTGTATGAGGGGTGGGGAGGG + Intronic
1068667044 10:59687853-59687875 AAAAGGCTGAGGTGGGAGGATGG + Intronic
1068748163 10:60559253-60559275 AAAGGGTTGGGGGGTGGTGAGGG - Intronic
1068792687 10:61044387-61044409 GAATGGGTGTGGGGTGGGTAAGG + Intergenic
1069441468 10:68432682-68432704 AAAAGGCAGAGGGAAGGGGAAGG + Intronic
1069518688 10:69100677-69100699 TATTGGCTGTGGGGTGGGGGTGG + Intronic
1070180512 10:74009217-74009239 AAATGGCTCGGGGGGGGGGGGGG - Intronic
1070984136 10:80673606-80673628 AAATGGCTTAGGCCTGGGGATGG - Intergenic
1071783987 10:88879360-88879382 AAATGGCTGCAGAGTGGGGTGGG - Intergenic
1072429850 10:95361237-95361259 AGGTGGCTGAGGGGTTGGGGTGG - Intronic
1072751555 10:97984140-97984162 CTATGTCTGAGGGGTGGGGCAGG + Intronic
1072761225 10:98058657-98058679 ATATGGCTGGGGGTTGGGTAGGG - Intergenic
1073093761 10:100967814-100967836 AAATGGCTGGGGGGGGGGGGGGG - Intergenic
1073324671 10:102635312-102635334 AAATGGGTGTGGGGTGGGTGTGG - Intergenic
1073473266 10:103736938-103736960 GATTGGCTCAGTGGTGGGGAGGG + Intronic
1073542076 10:104322794-104322816 GACTGGCTGAGGGCAGGGGAGGG + Intronic
1074378860 10:112961821-112961843 ACGTGGCTGGGGGGTGGGGTGGG + Intronic
1074406059 10:113181137-113181159 AAATGGCAGGGGGGTGAGGAGGG - Intergenic
1075025040 10:118978230-118978252 AAATGGCTTAGGGTAGGGGCGGG - Intergenic
1075261842 10:120970165-120970187 ACAGGGCTGAGGGGGTGGGAAGG - Intergenic
1075939357 10:126375985-126376007 GAGAGGCTGGGGGGTGGGGAGGG - Intronic
1076760917 10:132605368-132605390 AAGCGGCTGGGGGATGGGGAAGG + Intronic
1076870160 10:133189052-133189074 AATTGGCTTTGGAGTGGGGAGGG + Intronic
1077879616 11:6338622-6338644 AAGTGGGTTGGGGGTGGGGAAGG - Intergenic
1077892545 11:6429936-6429958 AAATGGCTGACAGGTTGGGAGGG + Intergenic
1077924138 11:6663617-6663639 CAAAGGCTGAGGGGTGAGGATGG + Intergenic
1078001328 11:7498964-7498986 GAATGGCTTGGGGATGGGGAAGG - Intronic
1078007863 11:7546099-7546121 AAGGGACTGAGGAGTGGGGAGGG - Intronic
1078362175 11:10677520-10677542 GTATGGTTGAGGGGAGGGGACGG - Intronic
1078690595 11:13576325-13576347 AAATGTCTTAGGTGTGGGCAAGG + Intergenic
1078699244 11:13665309-13665331 AAAAGGCTGAAGGCTGGGCACGG + Intergenic
1078703090 11:13708747-13708769 CCATGGCTGGGGGGTGGTGAGGG - Intronic
1079749976 11:24185078-24185100 AAATGACTTAGGGCTGGGCATGG + Intergenic
1080260578 11:30345451-30345473 AGCTGGCTGAGTGGTGGGCATGG - Intergenic
1080561484 11:33467243-33467265 AAAGAGGTGAGGGGTGGGAAAGG + Intergenic
1080646037 11:34188347-34188369 ACATTCCAGAGGGGTGGGGAGGG + Intronic
1080691426 11:34561870-34561892 AAAAGGGTGGGGGGTGGCGAGGG + Intergenic
1080892212 11:36418824-36418846 AAATGTATGTGGGGTGGGGTAGG - Intronic
1081867941 11:46369895-46369917 CACTGGGTGAGGGGTGGGCAGGG - Intronic
1082259736 11:50069528-50069550 AAGAGGCTGAGGGGGGAGGATGG + Intergenic
1082631710 11:55549901-55549923 AAATGTCTAAAGGGTGGAGAGGG + Intergenic
1083257305 11:61504555-61504577 AAATGTGTGGGGGGTGGGGAGGG - Intergenic
1083296257 11:61717170-61717192 AAATGTCTCAGGAGCGGGGAGGG - Intronic
1083341526 11:61961494-61961516 AGGTTGTTGAGGGGTGGGGAGGG + Intronic
1084209964 11:67616296-67616318 AAATGCCTGAGGACTGGGGCTGG + Intergenic
1084269925 11:68023259-68023281 AACTGGCTGAGGGCCGGGGAAGG - Intronic
1084305762 11:68282453-68282475 AAAGAGATGGGGGGTGGGGAGGG - Intergenic
1084538255 11:69770937-69770959 ACATGGCTGGGGGTTGGGGTGGG - Intergenic
1084596125 11:70118064-70118086 AAGTGCCAGAGGGGTGCGGAGGG - Intronic
1084714909 11:70867479-70867501 TGAGGGCTGAGGGGTGGGGCAGG + Intronic
1084797902 11:71520288-71520310 ACAGGGATGAGAGGTGGGGAAGG + Intronic
1084803617 11:71564104-71564126 ACAGGGGTGAGGGGTGGGGAAGG + Intronic
1084907432 11:72358822-72358844 AAGTGGAAGAGGGGTGGGGTGGG - Intronic
1084973417 11:72783511-72783533 AAACTGCTGAGGCCTGGGGAGGG - Intronic
1085290588 11:75396379-75396401 AGATGGATGGGGGGTGGGGGGGG + Intergenic
1085996068 11:81915521-81915543 AAATGTGTGTGGGGTGGGGTGGG + Intergenic
1086739747 11:90352504-90352526 TTATGGAGGAGGGGTGGGGAGGG + Intergenic
1086741909 11:90379469-90379491 AAGTGCCTGAGGGGTGGGGCAGG - Intergenic
1086903507 11:92393582-92393604 AGATAGCGGAGGGGAGGGGATGG + Intronic
1087299942 11:96420664-96420686 AAATGGGTGAGGCAGGGGGAAGG + Intronic
1087765251 11:102144943-102144965 AAATAGCTGAGAGGGAGGGAAGG - Intronic
1088194619 11:107261136-107261158 ATTTAGCTGTGGGGTGGGGACGG - Intergenic
1088992877 11:114969925-114969947 AAAAGGATGAGAGGTGGGGAGGG + Intergenic
1088997005 11:115009770-115009792 AAATGGCGGGGGAGTGTGGAAGG - Intergenic
1089254324 11:117186385-117186407 AGAAGGTTGAGGGGAGGGGATGG - Intronic
1089334471 11:117713565-117713587 AAATGGCTCTGGGAGGGGGACGG - Intronic
1089396729 11:118141044-118141066 AAGGGGCTGAGAGATGGGGAGGG + Intronic
1089453830 11:118614272-118614294 AAAGGGGTGGGGGGTGGGGGTGG - Intronic
1089491410 11:118886472-118886494 CAGGGGCTGGGGGGTGGGGACGG + Intronic
1089692821 11:120197481-120197503 AACTGGGGGTGGGGTGGGGAGGG - Intergenic
1089728939 11:120508514-120508536 AAATGGATGATGGGTGAGGTGGG + Intergenic
1089834709 11:121359822-121359844 TGATGACTGAGGGGTGGGGCTGG + Intergenic
1089984985 11:122804203-122804225 AACTGGGTGAGAGGTGGGGATGG + Intronic
1090253106 11:125264661-125264683 AAAGGAATGGGGGGTGGGGAAGG - Intronic
1090364982 11:126198151-126198173 TCATAGCTGAAGGGTGGGGACGG + Intergenic
1090418106 11:126554889-126554911 AAGTGGCTGAGTGGTGAGCAGGG + Intronic
1090618252 11:128537002-128537024 AAATGCCTAAGAGGTGGGAAAGG + Intronic
1090832087 11:130427156-130427178 AGAGGGCTGAGGGGTGGGAGTGG + Intronic
1091228019 11:133969691-133969713 AGGTGGTTGAGGGGTGGTGACGG - Intergenic
1091413839 12:262959-262981 CAGTGGCCGAGGGGAGGGGAGGG - Intergenic
1091561681 12:1619131-1619153 AAATGTCTTAGGGGTGGGGAGGG - Intronic
1091700261 12:2654327-2654349 TAATGGCTGAGAGGGAGGGAGGG + Intronic
1091979011 12:4850619-4850641 AAATGCCAGCGGGGTGAGGAAGG + Intronic
1092162847 12:6325492-6325514 AAATCGCTGAGGGAGGGAGAAGG + Intronic
1092235718 12:6807556-6807578 AAGGGGCTCAGGGATGGGGAGGG + Intronic
1092278543 12:7081426-7081448 CAATGACGGAGGTGTGGGGATGG - Intronic
1092883212 12:12903978-12904000 TAATACCTGATGGGTGGGGAAGG + Intronic
1092941975 12:13418410-13418432 TAATGCCTGAAGGCTGGGGAGGG - Intergenic
1093076037 12:14759939-14759961 ACATGGCTGTGGGGGGGGGTGGG - Intergenic
1093886801 12:24470554-24470576 AAGGGGCTGGGGGGTGGGCAGGG + Intergenic
1095686941 12:45047409-45047431 AAAGGGCTCAGGGCTAGGGAGGG - Intronic
1095744801 12:45645906-45645928 AAATGCCTGTGGGGGTGGGAGGG - Intergenic
1095964480 12:47857683-47857705 GAATGACTGTGGGGTGGGAAGGG + Exonic
1096016494 12:48280775-48280797 ACAGGCCTGAGGGGAGGGGAAGG + Intergenic
1096111068 12:49029471-49029493 AAGTATCTGAGGGGTGGGTAGGG + Exonic
1096121887 12:49093897-49093919 AAATGGCTGAGGCGTGGACCGGG - Intronic
1096159132 12:49362350-49362372 AAAAGTCTTGGGGGTGGGGATGG + Intergenic
1096242289 12:49965949-49965971 ACATGGCTGAGGGGGAGGGGTGG - Intergenic
1096499344 12:52055673-52055695 AAGGGGCTGGGGGGTGGGGACGG - Intronic
1096755819 12:53798696-53798718 GAAGGCCTGATGGGTGGGGAGGG + Intergenic
1096762028 12:53849861-53849883 AAATAGTGGAGGGGTGTGGAGGG - Intergenic
1097727762 12:63094228-63094250 GAAAGGGGGAGGGGTGGGGATGG + Intergenic
1097933109 12:65212571-65212593 AATTGGCTGAGGATTGAGGAGGG + Intronic
1098180562 12:67841756-67841778 AAATGACTGAGTAGTTGGGATGG + Intergenic
1098219323 12:68252148-68252170 AAGTTGTTGAGGGGAGGGGATGG - Intronic
1099675839 12:85759500-85759522 AAAAGGAAGAGGGGAGGGGAGGG + Intergenic
1101502748 12:105319483-105319505 CAAAGGCTCAGTGGTGGGGAGGG + Intronic
1101527943 12:105548754-105548776 CAATGGATGAGGCGTGGGGCAGG - Intergenic
1102060683 12:109928650-109928672 AAATGGAAGAAGGGTGGGGTAGG - Intronic
1102454950 12:113065500-113065522 AAAGGGGTGAGGGGAGGAGAAGG - Intronic
1102460139 12:113094963-113094985 CAATGGCTGAGGAGTGGGCAGGG + Intronic
1102521253 12:113478676-113478698 AAGGGGCTGGGGGGCGGGGACGG + Intergenic
1102549383 12:113680316-113680338 AGATGGCTGAGGGCTGGAGAGGG + Intergenic
1102843429 12:116151174-116151196 AAATCTCTTGGGGGTGGGGAGGG + Intronic
1102964341 12:117114282-117114304 TGAAGGCTGAGGGGTGGGAAGGG + Intergenic
1103244944 12:119448659-119448681 GAATGGCGGTGGGGAGGGGAGGG + Intronic
1103666415 12:122570178-122570200 TGATGGGTGAGAGGTGGGGATGG + Intronic
1103902452 12:124310477-124310499 AATGGGCTGAGCTGTGGGGAGGG + Intronic
1103949044 12:124541616-124541638 AGATGGTGGGGGGGTGGGGATGG + Intronic
1103991465 12:124802287-124802309 AAAAGGCTGATGAGTGTGGAAGG + Intronic
1104063931 12:125291010-125291032 AATTGGCTGGGGGACGGGGAAGG - Intronic
1104951879 12:132444819-132444841 GAACCGCTGTGGGGTGGGGAGGG + Intergenic
1105261976 13:18786279-18786301 GAATGGCTGGGGGTTGGGGAGGG - Intergenic
1105359642 13:19696048-19696070 AAATGGGGGAGGGGTGTGGTTGG + Intronic
1106449236 13:29864735-29864757 GATTGGTTGAGGTGTGGGGAAGG - Intergenic
1107566225 13:41607628-41607650 AGCTGTCTGTGGGGTGGGGAGGG + Intronic
1108714805 13:53068615-53068637 AAATGGGAGAGGGGAGTGGAGGG + Intergenic
1108759977 13:53551445-53551467 AACTAGATGAGGAGTGGGGAAGG + Intergenic
1108802583 13:54117304-54117326 AAATCAGTGAGGGTTGGGGAGGG + Intergenic
1110221231 13:73076152-73076174 ACATGGGTAAGGGGTGGGGGTGG + Exonic
1110594339 13:77302365-77302387 AAAGGGCTGGGGGGTGGGGAGGG + Intronic
1111047229 13:82829588-82829610 AAATAGGTGAAGGGTGAGGAAGG + Intergenic
1111713424 13:91846927-91846949 AAATGGGTGCGGGCTGGGCACGG + Intronic
1112011351 13:95296414-95296436 AAGTGGCTGAGGGCAGGGGATGG - Intronic
1112369025 13:98778629-98778651 ACATGGCTGAGGGTTGGTCATGG - Intergenic
1112556854 13:100476845-100476867 ACCTGGTTGAGGGGTGGGGCAGG + Intronic
1112934496 13:104781497-104781519 GAATGGCTGAGTGGTGGAAATGG + Intergenic
1113050881 13:106210857-106210879 AATAGGCTGAGGGATGTGGAAGG + Intergenic
1113093241 13:106636718-106636740 AAACAGCTAAGGGGTGGGGGTGG - Intergenic
1113158487 13:107352502-107352524 ATGTGGCTGAGGGCTGGTGAGGG + Intronic
1113398127 13:109967829-109967851 AAATTGTGGAGGGGTGGAGATGG + Intergenic
1113482201 13:110629324-110629346 AAATGGGTGAGGGGTATGGTAGG - Intronic
1113871832 13:113564622-113564644 AAGTGGCTGTGGGTTGGGGAGGG - Intergenic
1114459685 14:22878487-22878509 AAATGCCTGGTGGGTGTGGAGGG - Exonic
1114883068 14:26810981-26811003 AAATGACAGATGGGAGGGGAGGG - Intergenic
1115163724 14:30424604-30424626 AAATGAGGCAGGGGTGGGGAGGG + Intergenic
1115197019 14:30812324-30812346 AGGTGGGGGAGGGGTGGGGAAGG + Intergenic
1115816675 14:37171108-37171130 AAAGGGGGGAGGGGAGGGGAGGG + Intronic
1115862873 14:37709089-37709111 AAATGGCAGATGGTAGGGGAAGG - Intronic
1116949335 14:50864479-50864501 AGATGGGTCAGGGGTGGGGTGGG + Intronic
1117427548 14:55616306-55616328 AAATAGCTGAGGAATGGGAAAGG + Intronic
1117780908 14:59230753-59230775 AAATGCTTGAGGGGAGGGGTGGG + Intronic
1117897323 14:60501200-60501222 AGAAGGCTGAGGTGTGAGGATGG + Intronic
1117963686 14:61186596-61186618 AAATTGCAGTGGGGTGGGGTGGG - Intergenic
1118377321 14:65188395-65188417 ATTTGGCTGAGGGGGTGGGAAGG + Intergenic
1119419537 14:74500360-74500382 GATTGGCTGAGTGGTGGTGATGG + Exonic
1119905415 14:78297787-78297809 AAAGGGAAGAGGAGTGGGGAAGG - Intronic
1120341121 14:83222153-83222175 ACATGGCTGAGCTCTGGGGATGG - Intergenic
1120471214 14:84927483-84927505 AAAAGGCAAAGGGGTGGGGGTGG - Intergenic
1120921645 14:89760964-89760986 AGATGGCTGAGCAGTGAGGAAGG + Intergenic
1121266049 14:92603344-92603366 AGGGGGCTGAAGGGTGGGGAGGG - Intronic
1121358676 14:93235343-93235365 AACAGGGTGAGGAGTGGGGAGGG - Intergenic
1121962967 14:98278162-98278184 AAATGGGGAAGGGGTGGTGAGGG + Intergenic
1122137737 14:99644689-99644711 ACCTGGCGTAGGGGTGGGGAGGG - Intergenic
1122302778 14:100740578-100740600 AAAGAGCCCAGGGGTGGGGATGG + Intergenic
1122790654 14:104182924-104182946 CAATGACAGAGGGATGGGGAGGG - Intergenic
1122917134 14:104864590-104864612 ACCTGGCCGAGGGGTGGGGGTGG - Intergenic
1124354477 15:28984756-28984778 AGATGGCAGTGGGGTGGGGGGGG - Intronic
1124846166 15:33292968-33292990 AAATGGTTGAGGGGCGGGAAAGG + Intergenic
1124996242 15:34725883-34725905 AGATGGGTGTGGGGAGGGGAAGG - Intergenic
1125182397 15:36892292-36892314 TCATGGCTGGGTGGTGGGGATGG + Exonic
1125297996 15:38223339-38223361 CACTGGCTGAGGGCTGGGCAAGG - Intergenic
1125324930 15:38526728-38526750 AACTGGTTGGGGGGTGGGCAGGG + Intronic
1125389957 15:39181547-39181569 ATCTGGCAGAGGGGAGGGGAGGG + Intergenic
1125487023 15:40118611-40118633 AAGTGGAGGAGGGGTGGGGCAGG - Intergenic
1125495765 15:40192292-40192314 ACAGGGTTGAGGGGTGGGGATGG - Intronic
1126201840 15:45995371-45995393 AAAGGGCTGAGGGGTGGGGGCGG + Intergenic
1126613620 15:50554187-50554209 AAAAGGCTGAAGGTTGGGGCAGG - Intronic
1126711271 15:51459288-51459310 CAATGGCTTAGGGTTGGTGATGG + Intronic
1126782173 15:52148320-52148342 GAATGGGTCAGGGGAGGGGAGGG + Intronic
1126964818 15:54039987-54040009 AAATGGGGGTGGGGTGGGGGAGG - Intronic
1127630171 15:60820627-60820649 TAAAGGCAGAGGGGTGGGGGTGG + Intronic
1127755302 15:62086228-62086250 AAGAGGCTGAGGGGTGGGCCTGG - Intergenic
1127817060 15:62620471-62620493 AAAAGGGTGTGGGGCGGGGAGGG - Intronic
1127964751 15:63915337-63915359 AAATGGTTGATGGGTTGGGGAGG - Intronic
1129007375 15:72385118-72385140 GAATGGGTGGGGGGTGGGGAGGG - Intergenic
1129082816 15:73055396-73055418 AAATGTAAGAAGGGTGGGGAGGG - Intronic
1129524407 15:76204700-76204722 AGACGGCTTAGGGGTGGGGCTGG - Exonic
1129604097 15:77016377-77016399 CAGAGGCTGAGGGGTGGGAAGGG + Intronic
1129682396 15:77665229-77665251 AGAAGGCTGAGGGTTGGGCAAGG - Intronic
1129742541 15:77996414-77996436 GATGGGCTGAGGGGTGGGGGGGG + Exonic
1129754194 15:78086427-78086449 ACATGGCTGCTGGTTGGGGAGGG - Intronic
1129842938 15:78755042-78755064 GATGGGCTGAGGGGTGGGGTGGG - Intergenic
1129857821 15:78837553-78837575 AAATGGGGGAGGGGTGGGAGGGG + Intronic
1129950287 15:79581286-79581308 AATTGGCTGAGGTGGGTGGATGG + Intergenic
1130698903 15:86159182-86159204 AAATGACTCATGGGTGTGGAGGG - Intronic
1130741278 15:86603180-86603202 AAATGGATGATGGTGGGGGATGG - Intronic
1131202217 15:90408894-90408916 ACAAGGCTGAGGTCTGGGGATGG - Intronic
1131371694 15:91887257-91887279 AAATGGCCGAGGAAGGGGGAAGG - Intronic
1132531281 16:451289-451311 ACAGGGGTGAGGTGTGGGGAAGG - Intronic
1132755301 16:1481583-1481605 AATGGGCTGGGGGGTGGGTAGGG + Intergenic
1132773408 16:1577939-1577961 AAAAGACGGAGGGGTGGGCAGGG + Intronic
1132992873 16:2806151-2806173 CAGGGGCTGTGGGGTGGGGATGG - Intergenic
1133340174 16:5030812-5030834 AAGTGGCTGCAGGGTGGTGAGGG - Intronic
1133739449 16:8640515-8640537 AAATGGATGATGGATGAGGAGGG + Intronic
1134419456 16:14071817-14071839 AAAGGGCTGAGGGGAGTGGGAGG - Intronic
1134787142 16:16954867-16954889 AAATGGAGGAAGGGTAGGGATGG + Intergenic
1134837312 16:17372042-17372064 AAATGGCTGTGGGGGAGGGGAGG + Intronic
1135070735 16:19349253-19349275 AAGTGGCTGGGGGTTGGAGAAGG + Intergenic
1135830726 16:25770553-25770575 CAATGGCTGAGGGGTGCAGTTGG + Intronic
1135868276 16:26125278-26125300 AGATGGGGGTGGGGTGGGGATGG + Intronic
1136013634 16:27381325-27381347 AGATGACTGGAGGGTGGGGAAGG + Intergenic
1136225267 16:28856122-28856144 AAATAGCTGTGGGGTGGTGGTGG + Intronic
1136570410 16:31093420-31093442 ACCTGGCAGAGGGGTGGGGTGGG + Exonic
1137689054 16:50407599-50407621 CATGGGCGGAGGGGTGGGGAGGG + Intergenic
1137768245 16:50994341-50994363 AAATGGCAGTGGGGAGGGGTTGG + Intergenic
1137815246 16:51392256-51392278 GGGTGGCTGAGGGGTAGGGAAGG + Intergenic
1138113304 16:54341091-54341113 AAATTGCTGGGGCGTGGGGAGGG - Intergenic
1138197506 16:55062367-55062389 ACATAGCAGAGGGGTGGGGCAGG - Intergenic
1138207944 16:55138592-55138614 ACCAGGCTGAGGGGTGAGGAGGG + Intergenic
1138401247 16:56746152-56746174 AATGGGCGGAGGGGTGGGGTGGG + Intronic
1138446978 16:57070677-57070699 AAGTGGGTGAGTGGTGGGGTTGG + Intronic
1138446988 16:57070714-57070736 AAGTGGGTGAGTGGTGGGGTTGG + Intronic
1138581161 16:57941268-57941290 AGGAGTCTGAGGGGTGGGGAGGG - Intronic
1139328230 16:66168016-66168038 AGAAGGCTGAGAGGAGGGGAGGG + Intergenic
1140168517 16:72579625-72579647 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1140416445 16:74777043-74777065 ACAGGGGTGAGGGGTGGGGTTGG + Intergenic
1140834236 16:78778768-78778790 AAATGGCTCAGGGTTGGGGACGG - Intronic
1140958792 16:79892777-79892799 AGAGGGTTGAGGGGTGGGGATGG + Intergenic
1140980256 16:80101990-80102012 AAATAGAAGAGGTGTGGGGAGGG - Intergenic
1141016667 16:80457341-80457363 AGATGGCTGTTGGGTGGGCAAGG - Intergenic
1141413694 16:83854009-83854031 ACATGGCTGAGGATGGGGGAGGG - Intergenic
1141605897 16:85152998-85153020 AAAAGGCTGGTGGGTGGGCACGG + Intergenic
1141752796 16:85970363-85970385 AAATGGGTGAGGGGTGTGGAAGG - Intergenic
1141896124 16:86959660-86959682 GGCTGGGTGAGGGGTGGGGATGG - Intergenic
1142127121 16:88415702-88415724 ACATGGCTGAGATGTGGGGCTGG - Intergenic
1142142731 16:88479772-88479794 AGATGGGAGAGGGGTGGGGCTGG - Intronic
1142341432 16:89525514-89525536 ACAGGGATGAGGGGTGGGGATGG - Intronic
1142358072 16:89613512-89613534 AAATGGAGGAGGGGAGGGGAAGG - Intronic
1142598184 17:1039721-1039743 AACTGGCACAGGGGTGGGGGTGG + Intronic
1142608712 17:1096445-1096467 TCCTAGCTGAGGGGTGGGGAGGG + Intronic
1142698613 17:1646673-1646695 ATATGGGTGAGGGCAGGGGATGG + Intronic
1142783530 17:2201452-2201474 AGAAGGCTGAGGTGTGTGGATGG + Intronic
1142955976 17:3522555-3522577 AAAGTGCTGGGGGGTGGGGGGGG - Intronic
1143053319 17:4144102-4144124 TGATGGATGTGGGGTGGGGATGG - Intronic
1143360273 17:6363804-6363826 ACCTGGCTGAGGGGTAGGCAGGG - Intergenic
1143521611 17:7447351-7447373 TAATGGGGGAGGGATGGGGAGGG - Intronic
1143751684 17:9032734-9032756 AAAGGGCTGAGGGTAGGGGCTGG - Intronic
1144486807 17:15673217-15673239 AAATTGAAAAGGGGTGGGGAGGG - Intronic
1144616857 17:16783940-16783962 GAGTGCCTGAGGGGTGGGGCAGG - Intronic
1144895834 17:18531734-18531756 GAGTGCCTGAGGGGTGGGGCAGG + Intergenic
1144914215 17:18709078-18709100 AAATTGAAAAGGGGTGGGGAGGG + Intronic
1145136383 17:20412498-20412520 GAGTGCCTGAGGGGTGGGGCAGG - Intergenic
1145816440 17:27798365-27798387 CCATGGCGGAGGGGTGGGGGTGG - Intronic
1146017787 17:29247743-29247765 AAGTGGCTGTGGGCTGGAGAAGG + Intronic
1146125677 17:30229386-30229408 CGACGGCTTAGGGGTGGGGAGGG + Intronic
1146602704 17:34232593-34232615 AAGTAGCTGAGATGTGGGGAAGG - Intergenic
1146656789 17:34639197-34639219 AAATGGCTGTGGGATGGGGTAGG - Exonic
1146690458 17:34871460-34871482 AAATGGCTGGGGGAGAGGGAAGG + Intergenic
1146967739 17:37047276-37047298 AAAAAGCAGAGGGGTGGGGGAGG - Intronic
1147265426 17:39231680-39231702 AACTGGCACAGGGCTGGGGAGGG - Intergenic
1147912564 17:43864719-43864741 AAATGGGTGAGGGATGGGAGTGG - Intergenic
1148196416 17:45716453-45716475 AAGTTGCTGGGGGGTGGGGTGGG + Intergenic
1148682855 17:49484635-49484657 AAGGGGAGGAGGGGTGGGGAGGG - Intergenic
1148858811 17:50593477-50593499 AAAGGGCTGAGTGCTGGGGAGGG - Intronic
1148869701 17:50649612-50649634 AGAGAGATGAGGGGTGGGGAGGG + Intronic
1148914000 17:50959247-50959269 AAATGGGGGGGGGGTGGGGTGGG + Intergenic
1149023786 17:52000898-52000920 AAGTGGCTGGGGGGTGGGGGTGG + Intronic
1149665009 17:58359042-58359064 AAATGGCTGAGGGGAGGTTTAGG - Intronic
1149771747 17:59327917-59327939 AAAGGGCTGAGGGGTGGGGAAGG + Intergenic
1150227918 17:63533803-63533825 AGAGGGCTGAGGCCTGGGGAAGG - Intronic
1150472531 17:65449313-65449335 AAATGATTGAGGGGAGGGGGTGG + Intergenic
1150475086 17:65468814-65468836 AAGTGGCTGAGTGTAGGGGAGGG - Intergenic
1150984450 17:70179806-70179828 ACTTTGCTGAGGGTTGGGGATGG - Exonic
1151153911 17:72111193-72111215 CATTGGCTTGGGGGTGGGGAAGG - Intergenic
1151988007 17:77556419-77556441 AGCTGGCTGAGAGGTGGGCAGGG - Intergenic
1152160744 17:78667171-78667193 AAATGACTGAAGTGTGGGGACGG - Intergenic
1152199404 17:78936277-78936299 AACAGGGAGAGGGGTGGGGAGGG + Intergenic
1152270871 17:79324165-79324187 AAAGGGCTGAGGGATGAGAAGGG + Intronic
1152730768 17:81968663-81968685 AAACCGGAGAGGGGTGGGGACGG + Intergenic
1152755845 17:82086678-82086700 AAATAGCTGAGGGTTGAGGAAGG + Intronic
1153536450 18:6107276-6107298 AATGGGCTGAGGGGTGGGCCTGG + Intronic
1153633026 18:7089788-7089810 AAAGGTGTGAGGGGTGGAGATGG + Intronic
1153713651 18:7824072-7824094 AAGTGGCCTAGGAGTGGGGATGG - Intronic
1155888994 18:31243187-31243209 CAATGGGTGAGGGGGTGGGAAGG + Intergenic
1155929508 18:31690759-31690781 AAATGACTGGGGGCTGGGCATGG - Intergenic
1156462102 18:37326828-37326850 AAGTGGCAGAGGGATGGGGAGGG - Intronic
1156508282 18:37613070-37613092 CCATGGCTGTGAGGTGGGGAAGG - Intergenic
1156526510 18:37772958-37772980 AAATGGCTTAGTGGAGAGGATGG + Intergenic
1156608203 18:38694108-38694130 AAATGGAAGAGGGCTGGGTAAGG - Intergenic
1157222972 18:45840325-45840347 AAATGGCAAAGGGCTGGGGCTGG + Intronic
1157418457 18:47525875-47525897 GAAAGGCTGAGGGGAGGGGTGGG - Intergenic
1158321706 18:56270676-56270698 AAATGGAAGAGGGGAAGGGAAGG + Intergenic
1158421409 18:57298050-57298072 AAATGGATGAGAGGTGGGATGGG - Intergenic
1158452304 18:57578187-57578209 ATATGGCTGAGGTGGGGAGAGGG + Intronic
1158530272 18:58254834-58254856 AAATAGCTAAGTGGAGGGGAGGG - Intronic
1158578469 18:58660751-58660773 AACTAGATGAGGGGTGGGGTGGG - Intergenic
1158720329 18:59918775-59918797 TACTGGCTGAGGAGTGAGGAGGG + Intergenic
1158887002 18:61838082-61838104 AAAGGGCTGAGGGTTTGGGAGGG - Intronic
1158941129 18:62406573-62406595 AAGTGGCTGGGGGATGGGAAAGG - Intergenic
1159060828 18:63512210-63512232 AAATGGCTGTGGGGTCGCGGTGG + Intergenic
1160050603 18:75429907-75429929 AAAGGAGGGAGGGGTGGGGAAGG - Intergenic
1160490777 18:79335369-79335391 ACAAGGCTGAGGGGTGGTGCAGG - Intronic
1160503220 18:79412454-79412476 AAAGGAGTGGGGGGTGGGGAGGG - Intronic
1160579059 18:79873423-79873445 AGGTGGCTGGGGGGGGGGGAGGG - Intronic
1160684673 19:427943-427965 ACATGGCACAGGGGAGGGGACGG + Intronic
1160744282 19:703573-703595 ACATGGCTCAGGGTTGGGGTGGG + Intergenic
1160960668 19:1719222-1719244 ACCACGCTGAGGGGTGGGGAGGG + Intergenic
1161327070 19:3669112-3669134 AAGAGGCTGAGGGTTGGGGAAGG + Intronic
1161631186 19:5356594-5356616 TGGTGGCTGAGGGGTGGGGTGGG + Intergenic
1161839000 19:6667342-6667364 AATTGACCGAGGGGTGGGGGTGG + Intronic
1162340326 19:10087714-10087736 CAAAGGCTGGGAGGTGGGGAAGG + Intronic
1162368829 19:10266689-10266711 CAATGGCTGATGGATGAGGAAGG - Intergenic
1162892176 19:13741630-13741652 AAAAAGCTGAGGTGTGAGGACGG + Intronic
1162959120 19:14115970-14115992 CAATGGGTGGGGGCTGGGGAGGG - Intronic
1163174161 19:15552510-15552532 ATATAGCAGAGGGATGGGGATGG + Intergenic
1163488467 19:17603419-17603441 ACATGGCTGAGGGTAGGGGTCGG - Exonic
1163598528 19:18234158-18234180 GCATGGCTTTGGGGTGGGGAGGG - Intronic
1164300711 19:23960151-23960173 TAATAACTGAGGAGTGGGGAGGG + Intergenic
1164398425 19:27886471-27886493 CAAGGACTGAGGGGTGGGGTTGG - Intergenic
1165070144 19:33251094-33251116 ACGGGGCTGAGGGGTGGGGGAGG - Intergenic
1165122631 19:33570471-33570493 AAATTGTTGAGGTGAGGGGAGGG - Intergenic
1165615337 19:37194655-37194677 AAATTGCTGAGGTGAGGGAAGGG - Intronic
1166126645 19:40718752-40718774 AATAGGCTAAGGGGTGGTGAAGG - Intronic
1166294120 19:41880737-41880759 AAGTGAGTGAAGGGTGGGGATGG + Exonic
1166301065 19:41912591-41912613 AAGTGAGTGAGGGGTGAGGACGG - Intronic
1166304353 19:41929186-41929208 GAGTGGCTGTGGGTTGGGGAAGG - Intronic
1166552377 19:43674711-43674733 AAATGGGTCTGGGGTGGGTAGGG + Intergenic
1166568623 19:43779976-43779998 AACTGCCTTGGGGGTGGGGATGG - Intronic
1166851695 19:45764406-45764428 GAGTGGCTCTGGGGTGGGGAAGG - Exonic
1166873054 19:45882474-45882496 TGACGGCTGGGGGGTGGGGAAGG + Intergenic
1166884965 19:45954565-45954587 GGAGGGCTGAGGGGTGGGGGAGG + Intronic
1166913063 19:46174608-46174630 AAATGTATGAGGAGTGGGTAGGG + Intergenic
1167032200 19:46970207-46970229 AAATAGCTTAGGGCTGGGTAAGG - Intronic
1167047772 19:47060890-47060912 AAAAGGAAGAAGGGTGGGGAAGG + Intergenic
1167321136 19:48797736-48797758 AAATGGGTGAGGGCTGGGCGCGG - Intronic
1167412324 19:49352071-49352093 AAGAGGCTGAGGGGTTGGGAGGG + Intronic
1167494388 19:49809173-49809195 AACTGGCTGAGGGGTGGGCTCGG + Exonic
1167557284 19:50204081-50204103 AAGAGGCGGAGGGGTAGGGAAGG + Intronic
1167601881 19:50459374-50459396 TAAGAGATGAGGGGTGGGGAAGG + Intronic
1167685779 19:50955072-50955094 AGATGGCTCAGGAGTGGAGAGGG - Intergenic
1167777385 19:51568014-51568036 AAATGGCTGAGGGCTTTGGCTGG - Intergenic
1168083797 19:54029990-54030012 AAATGGGGGAGGGGGGGAGAGGG + Intergenic
1168288946 19:55347721-55347743 AAGGGGCTGAGGGGGGCGGATGG - Exonic
1168388759 19:55988642-55988664 AAAAGCCTCAGGGGTGGGTAAGG - Intergenic
1202637671 1_KI270706v1_random:56111-56133 AGATGGTTGGGGGGTGGGGAGGG - Intergenic
925206606 2:2012759-2012781 AAGTGACTGACGGGTGGGTAGGG - Intronic
925269150 2:2590096-2590118 AAATGGGGCAGGGGTGGGGTTGG - Intergenic
925348782 2:3187628-3187650 AGGTGGATGAGGAGTGGGGAGGG - Intergenic
925348848 2:3187799-3187821 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925348883 2:3187887-3187909 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
926122863 2:10254269-10254291 AGAGGGCTGACGGGTGGGGCTGG + Intergenic
926285866 2:11487750-11487772 AAAGGGTTGTGGTGTGGGGAGGG - Intergenic
926399377 2:12480936-12480958 AAATGACTGAGATTTGGGGATGG - Intergenic
928170483 2:28999945-28999967 AAACGGAGGAGGGGTGGGGGAGG - Intronic
928301069 2:30124601-30124623 AAAGGGCTGAGGTGGGAGGACGG + Intergenic
928402008 2:30985816-30985838 CCAAGGCTGAGGGGAGGGGAGGG - Intronic
929379205 2:41330127-41330149 AAATGTTTGAGGGTTGAGGAAGG + Intergenic
929536611 2:42788037-42788059 TAGTGGCTGAGGGGTAGGCATGG - Intronic
929794636 2:45049578-45049600 GAAAGGAAGAGGGGTGGGGAAGG + Intergenic
929830899 2:45345509-45345531 GAATGGCCTTGGGGTGGGGATGG + Intergenic
929885319 2:45872822-45872844 AAATGGCTGTGGTGTTGGGGTGG + Intronic
929972950 2:46599495-46599517 AAATGAATGCGGGGTAGGGAGGG - Intronic
929978732 2:46659030-46659052 AAAGGGCTGCAGGGTGGAGAAGG - Intergenic
930076385 2:47409060-47409082 TAATTTCTGAGGGGAGGGGAGGG + Intronic
930372848 2:50526014-50526036 AAATGGGTGGGAGGTGAGGAGGG - Intronic
930474564 2:51864848-51864870 AAAAGGGTGAGTGGTGGGAAAGG - Intergenic
930635168 2:53796687-53796709 AAAAGGCTGAGGCGGGTGGATGG - Intronic
930736746 2:54787281-54787303 AGATGGGTGAGGGTTGGGGGGGG + Intronic
930851741 2:55968467-55968489 ACATGGTGGAGGGGTGGGGGTGG - Intergenic
931235022 2:60405917-60405939 AGCTGGCTGAAGGTTGGGGAGGG + Intergenic
931339889 2:61390284-61390306 AAAGAGCTGAGGGCTGAGGAAGG + Intronic
931461951 2:62457229-62457251 AAAAGGCTGCGGGGCTGGGACGG - Intergenic
931506463 2:62932661-62932683 AAATGGTTAAGGGCTGGGCATGG + Intronic
931601295 2:64005714-64005736 AAATGTCCTAGGGTTGGGGAAGG + Intronic
931716992 2:65037161-65037183 AAATGACTGGGGGGCTGGGATGG + Intergenic
932147848 2:69339635-69339657 AGATGGGTGAGAGATGGGGAGGG - Intronic
932312373 2:70754045-70754067 TTATGGCTGAGGGGTGAGGCAGG + Intronic
932714187 2:74089747-74089769 AAAGGGGTTGGGGGTGGGGAAGG + Intronic
932803791 2:74766012-74766034 AAATGGATTAGGGCTGGGAAGGG + Intergenic
933392537 2:81690128-81690150 AGATGCCTAAGGGGAGGGGAGGG + Intergenic
933656401 2:84890739-84890761 AGATGGGTGTGGGGTGGGGGAGG + Intronic
933695291 2:85213016-85213038 AAGTGGGTGAGGTGTGGGGTGGG + Intronic
934619148 2:95793554-95793576 AACAGGGTGAGGGGTGGGAATGG + Intergenic
934641743 2:96031003-96031025 AACAGGGTGAGGGGTGGGAATGG - Intronic
934686975 2:96328139-96328161 AAATGTCTTAGGGATTGGGATGG - Exonic
934973943 2:98787177-98787199 GAAGGGCTCAGGGGTGGGGCTGG + Intergenic
935643276 2:105310448-105310470 AGATGTCTTAGGGGTGGGGCAGG - Intronic
935675072 2:105587989-105588011 GAATGGCTGGGGGTGGGGGAAGG + Intergenic
936510427 2:113140876-113140898 AAATGGTTGCTGGGTGGGCACGG + Intergenic
937049313 2:118875604-118875626 ACAGGGCTGGGGTGTGGGGAGGG - Intergenic
937228791 2:120384859-120384881 ATTTGGCTGAGGCCTGGGGAGGG - Intergenic
937387525 2:121449602-121449624 AAATGGGCCGGGGGTGGGGAGGG + Intronic
938035703 2:128033146-128033168 AAATGGCAGAGGTGGTGGGATGG + Intergenic
938064468 2:128273581-128273603 ACAAGGCAGAGGGGAGGGGAGGG - Intronic
938539263 2:132273127-132273149 AAGGGGGTGAGGGGTGGGGACGG - Intergenic
938891725 2:135712366-135712388 AAGTGGCTGAGGTGGGAGGATGG - Intronic
939197636 2:138992002-138992024 CAATGGCTGTGGGCGGGGGAGGG - Intergenic
939370601 2:141294633-141294655 AAAAGGCTGAGGTGGGGGGATGG + Intronic
940111200 2:150156136-150156158 ACAGGGCTGAGGGGAGGGGTGGG + Intergenic
940332535 2:152490824-152490846 AAATTACAGATGGGTGGGGATGG + Intronic
940659882 2:156532989-156533011 AAAGGCCTGAGGGGTGGTCAGGG + Intronic
941834786 2:170004560-170004582 AAAGGGGGCAGGGGTGGGGAAGG + Intronic
941969284 2:171332272-171332294 AAAAAGCTGAGGGGCGGGGGTGG - Intronic
941983346 2:171484748-171484770 TTATACCTGAGGGGTGGGGAGGG - Exonic
942189228 2:173454638-173454660 AAATGGCGGAGGGTTGGAGGGGG - Intergenic
942212862 2:173688977-173688999 TAATGGTGGAGGGGAGGGGAGGG + Intergenic
942608549 2:177717298-177717320 AGATGGATGAGGGCGGGGGAGGG - Intronic
943142238 2:183997517-183997539 AAAATGCTGGGGGGTGGGGAGGG - Intergenic
943550063 2:189327349-189327371 AAATTGTTGAGGGTTGGGCATGG + Intergenic
943592115 2:189811295-189811317 AAAAGTCTGAGGGCTGGGCACGG + Intronic
943818667 2:192290180-192290202 AAATGGGTGCGGGGTGGGGACGG + Intergenic
944025120 2:195155633-195155655 ATATGGTTGTGGGGTGGGGTGGG - Intergenic
944189305 2:196984288-196984310 CAATGGCTGGGGGGTGGGCAGGG - Intronic
944369205 2:198961992-198962014 AACAGGCTGAGGCTTGGGGAGGG - Intergenic
944504895 2:200401239-200401261 AGATGGATGGTGGGTGGGGAGGG - Intronic
944593030 2:201236186-201236208 AAAAGGAGCAGGGGTGGGGAGGG - Intronic
945198284 2:207257483-207257505 AAATCCCTCTGGGGTGGGGAGGG - Intergenic
945800823 2:214428100-214428122 AAATGGACGAAGAGTGGGGAAGG + Intronic
946114776 2:217451781-217451803 AAGTGGCAGAGGGGAGGGGGCGG - Intronic
946292133 2:218753451-218753473 CCATGCCTGAGGGGTAGGGAAGG + Intronic
946369201 2:219270342-219270364 AAAGGACTGAGGGCTGGGGCAGG + Intronic
946420256 2:219560814-219560836 AGCTGCCTGAGGAGTGGGGAAGG + Intronic
946494430 2:220181524-220181546 GTAGGGCTGAGGGGTGGTGAAGG + Intergenic
946529416 2:220555784-220555806 AACTGTGTGTGGGGTGGGGATGG + Intergenic
947840264 2:233203260-233203282 GAGAGGCTGCGGGGTGGGGATGG + Intronic
948050279 2:234974798-234974820 ACAAGGGTGAGGGGAGGGGAAGG + Intronic
948744389 2:240076024-240076046 AGATTGCTAAGGGGTGGGCATGG + Intergenic
948874261 2:240818913-240818935 AAAGGGCTGACGCTTGGGGAAGG + Intronic
1169078506 20:2778303-2778325 AAATGGCTGAGAGCTGGGTGTGG - Intergenic
1169273192 20:4216446-4216468 AAAGGGCTGGGGATTGGGGAAGG + Intergenic
1169466742 20:5848247-5848269 AATGGGCTGAGGGCTGGGCATGG + Intronic
1170112544 20:12821591-12821613 CAATGCCTGAGGGATGAGGAGGG + Intergenic
1170643046 20:18172859-18172881 AAATGGGGGAGGTGTGGGCAGGG + Intronic
1171868204 20:30505980-30506002 AAGGGGGTGCGGGGTGGGGACGG - Intergenic
1172407778 20:34702418-34702440 CCAAGGCTGAGGGGTGGAGAGGG - Intronic
1172608277 20:36230500-36230522 AATTGGTTGATTGGTGGGGAGGG + Exonic
1173191000 20:40875489-40875511 AAAGGGCTGGGGGGTGGGGGTGG - Intergenic
1173526041 20:43733542-43733564 AAAAGGTTGTGGGGTGGGCAGGG - Intergenic
1173560527 20:44002165-44002187 AATGGGCAGAGGGGTTGGGAAGG - Intronic
1173639946 20:44594661-44594683 AGAGGGGTGAGGGGTGGGAATGG - Intronic
1174033959 20:47654587-47654609 CTAAGGCTGGGGGGTGGGGAAGG - Intronic
1174509681 20:51041674-51041696 TGATGGCTGAGGAGTGGGCAGGG - Intergenic
1175186779 20:57184182-57184204 ACCAGGCTGAGGGGTGCGGAAGG + Intronic
1175303052 20:57956642-57956664 CAATGCCTGTGGGGTGGGCAAGG - Intergenic
1175350856 20:58316903-58316925 CACTGGCTGAGGGGAGGAGATGG - Intronic
1175395585 20:58657781-58657803 AAATAGCAGAATGGTGGGGAGGG + Intronic
1175782448 20:61691105-61691127 TGCTGGCCGAGGGGTGGGGAGGG - Intronic
1175891541 20:62318116-62318138 AAAGGGATGAGGATTGGGGAGGG + Intronic
1176296361 21:5075510-5075532 GAAAGGATGAGGGGTGGGGAGGG - Intergenic
1176848034 21:13891544-13891566 GGATGGCTGGGGGTTGGGGAGGG - Intergenic
1177412579 21:20749349-20749371 TGGTGGATGAGGGGTGGGGAGGG + Intergenic
1177553265 21:22654045-22654067 AAGAGGCTGAGGTGTGAGGATGG + Intergenic
1177739527 21:25136785-25136807 AAGTGGCTGGGGGGTAAGGAGGG - Intergenic
1178035724 21:28580450-28580472 AAATGGGTGGGGAGTGGGGTGGG - Intergenic
1178342786 21:31800455-31800477 AACTGGGAGAGGGGTGAGGATGG - Intergenic
1178835204 21:36091519-36091541 AAAAGGCTGAGTCTTGGGGAGGG - Intergenic
1178879892 21:36441055-36441077 ACATGGCAGGGGGGTGGGGGCGG - Intergenic
1179421361 21:41239181-41239203 AGATGGGGGTGGGGTGGGGAGGG + Intronic
1179498422 21:41790617-41790639 GAATGGGGGAGGGATGGGGAGGG + Intergenic
1179860688 21:44186611-44186633 GAAAGGATGAGGGGTGGGGAGGG + Intergenic
1180125609 21:45788190-45788212 AGATGGGTGAGGGATGGGGAGGG + Intronic
1180717579 22:17882185-17882207 AAAAGGCAAAAGGGTGGGGAAGG + Intronic
1180867897 22:19129968-19129990 GCATGTCTGAGGGGTGGGGCAGG - Intergenic
1180898373 22:19353687-19353709 ACATGGCTGGGGCGTGGGGATGG - Intronic
1180937426 22:19634780-19634802 ACATGGCAGCGGGATGGGGAGGG + Intergenic
1181049284 22:20231110-20231132 AGGGTGCTGAGGGGTGGGGATGG - Intergenic
1181065103 22:20301953-20301975 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1181271857 22:21663724-21663746 AAAGGGCCGGGGTGTGGGGAGGG - Intronic
1181387904 22:22558354-22558376 AAGGGGGGGAGGGGTGGGGATGG + Intronic
1181527069 22:23496106-23496128 AAAGGGCTGAATGGTGGGGTGGG - Intergenic
1182030028 22:27151396-27151418 AAATAGCTCAGGATTGGGGAAGG + Intergenic
1182444990 22:30384767-30384789 AAATGGGTGAGGGGATGGGAAGG - Intronic
1182950781 22:34373739-34373761 ATATGGCTGGGGAGGGGGGAAGG + Intergenic
1183024250 22:35052297-35052319 AAAGGGATGGGGGGTGGGGGTGG - Intergenic
1183112322 22:35659458-35659480 AAGGGCCAGAGGGGTGGGGAAGG + Exonic
1183273216 22:36874868-36874890 AAGAGGATGAGGGGTGAGGAAGG - Intronic
1183314734 22:37130540-37130562 ATGTGGCTGGGGGTTGGGGATGG - Intronic
1183471228 22:38007732-38007754 AAATGCCTGAGGGAGGGAGAGGG + Intronic
1183704273 22:39467324-39467346 AGATGGGAAAGGGGTGGGGAAGG + Intronic
1184595902 22:45514153-45514175 ATATGTCTGAGGGGTGGGAGTGG + Intronic
1184727398 22:46354986-46355008 AAATGGCTGAGGAGAAAGGAGGG - Intronic
1184875306 22:47270515-47270537 AATTGGCTGGGGGGTAGGGGGGG + Intergenic
949736131 3:7173707-7173729 AAATGAATGTGGGGTGGGGCTGG - Intronic
950490428 3:13301396-13301418 ATATTCATGAGGGGTGGGGAAGG - Intergenic
950644894 3:14371311-14371333 AAGAGGCTGAGAGGTGGGAATGG - Intergenic
951706866 3:25552390-25552412 AAATGGCTGGGGTTGGGGGAGGG + Intronic
952555789 3:34529113-34529135 CAGTGGCTGGGGGGAGGGGAGGG - Intergenic
953295354 3:41710421-41710443 ATATGGCTGGGGGCAGGGGAGGG - Intronic
953781436 3:45874570-45874592 GAATGGCTGAGTGGTGGGAAGGG - Intronic
954332471 3:49898302-49898324 AAATGGCTGGAGCGTGGGGAAGG - Intronic
954338894 3:49937740-49937762 AAGGGGCTGAGTGGAGGGGAAGG + Intergenic
955288513 3:57668648-57668670 AGGTGGCGGAGGGGCGGGGAAGG + Intronic
955859068 3:63307609-63307631 GAAAGGCTGAGGTGAGGGGATGG - Intronic
955982285 3:64539289-64539311 CAGTGGCTGTGGGGTGGAGAAGG + Exonic
956143170 3:66165942-66165964 AACTGTCTGTGGGGTTGGGATGG - Intronic
956150570 3:66237976-66237998 TGATGGCTGGGGGATGGGGAAGG - Intronic
956587295 3:70878265-70878287 AAATGTCTCCTGGGTGGGGAGGG + Intergenic
956748717 3:72329697-72329719 AAAAGCCTGGGGGATGGGGAGGG + Intergenic
956890097 3:73604895-73604917 ACAGTGGTGAGGGGTGGGGAAGG + Intronic
957623370 3:82624401-82624423 AAAGGGTGGAGAGGTGGGGATGG - Intergenic
957899995 3:86476954-86476976 AAATGGGTGAGAGGTGGGGATGG - Intergenic
958440984 3:94155549-94155571 AAATGGCTAAGAGGAGGGGTGGG - Intergenic
958620531 3:96552501-96552523 AAGGGGCTGAGGGTTGAGGAGGG - Intergenic
958650517 3:96931153-96931175 AAATGGCTGGGAGGTGGGGCAGG - Intronic
959521143 3:107324291-107324313 AGAGAGGTGAGGGGTGGGGAGGG - Intergenic
960038728 3:113127796-113127818 AAATGTCTGGGGTGTGGGGTGGG - Intergenic
960159816 3:114338412-114338434 AAAGGGCTGTGGGGGTGGGAAGG - Intronic
960488522 3:118281950-118281972 AAAAGGCTGAAGAGTGGTGATGG + Intergenic
960513477 3:118577643-118577665 AAAGGGTTGAAGGGTAGGGAGGG + Intergenic
960628262 3:119702687-119702709 AAAGGGCTGGGGGGAGGGGCGGG + Intergenic
960695418 3:120391249-120391271 AAGGGACTGAGGGGTGAGGAAGG - Intergenic
961166387 3:124766631-124766653 TAATGGTTTCGGGGTGGGGACGG + Intronic
961832892 3:129633292-129633314 AAAGGGCAGAGGGGCAGGGACGG + Intergenic
962327656 3:134449373-134449395 AAGTGGCTGACTGCTGGGGAAGG - Intergenic
962357768 3:134709480-134709502 AAATAACTGGGGGGTGGGGGTGG + Intronic
962715912 3:138125924-138125946 GAATTGGAGAGGGGTGGGGAGGG + Intronic
963007268 3:140737874-140737896 AACTGACTGAGGGGTGTGCAAGG - Intergenic
963274341 3:143315341-143315363 ACAGGGCTGATGGGTGGTGAGGG + Intronic
963633046 3:147758027-147758049 CAACTGCTGAGGGGTGGGGATGG + Intergenic
963946074 3:151146801-151146823 AAAAGGAGGAGGGGTGGGGATGG - Intronic
965496128 3:169401314-169401336 AAGTGGGTCAGGGGTGGGGGTGG - Intronic
965700886 3:171458913-171458935 AAGGGGGTGAGGGGTGGGGATGG - Intronic
966786819 3:183629928-183629950 AAATGGGGTAGGGGTGGGGTGGG + Intergenic
966961259 3:184941639-184941661 AAAGGGCTGAGAAGTGGGGCTGG - Intronic
967352427 3:188528326-188528348 AAAAAGCTGGGGGGCGGGGAGGG - Intronic
967908916 3:194524936-194524958 AACTGTATGTGGGGTGGGGAAGG + Intergenic
968136682 3:196224752-196224774 GAATGGGAGAGGGGAGGGGAGGG + Intronic
968190402 3:196663057-196663079 CAATGGGGGAGGGATGGGGAGGG + Intronic
968518079 4:1023234-1023256 AAAGGACTGTGGGGTGGGGGTGG - Intronic
968570711 4:1338885-1338907 AAATGGATGAAGGGGTGGGAAGG + Intronic
968584386 4:1409346-1409368 AGATGGGGGAGGGGTGGGGCAGG - Intergenic
969052387 4:4382472-4382494 AAATCGATGAGGAGTGGGGAAGG + Intronic
969058764 4:4418417-4418439 GAAAGGCTGTGGGGTGGGGGTGG + Exonic
969112614 4:4853130-4853152 AAACGACTGAGCGGTAGGGAGGG + Intergenic
969495659 4:7524779-7524801 CAGTGGCGGCGGGGTGGGGAGGG - Intronic
969546442 4:7832514-7832536 AAAGGGCTCAGGAGTGGGGTGGG - Intronic
969879501 4:10161426-10161448 AAATGGCTGACAGGTTGGCATGG + Intergenic
970208876 4:13686236-13686258 AAATGGTGGAGGGGAAGGGAGGG - Intergenic
970715447 4:18916720-18916742 AAGGGGGTTAGGGGTGGGGAAGG - Intergenic
970908760 4:21249369-21249391 AAATGGCAGTGGGCTGGGGAAGG + Intronic
970966484 4:21934355-21934377 AAATGCTTGAGGGGTTTGGATGG - Intronic
971239367 4:24873822-24873844 TACTGGCTGCAGGGTGGGGAGGG - Intronic
971594235 4:28508574-28508596 GAATGGCTTTGGGGTGGGGGAGG + Intergenic
972267070 4:37471701-37471723 AAATGGGAGAGGGGAGGGAAGGG + Intronic
972503535 4:39698700-39698722 ATGTGGCTGTGGGGTGGGGAGGG + Intronic
973234965 4:47891214-47891236 AGAAGGCTGAGGTGTGAGGATGG - Intronic
973304676 4:48632258-48632280 AAATGGCTGAGGCCAGGTGATGG + Intronic
973393141 4:49572952-49572974 AGATGGTTGGGGGGTGGGGAGGG + Intergenic
973531958 4:51843703-51843725 AAAGGGCTGAGTGGTGCGGGCGG + Intronic
973770119 4:54198552-54198574 AAGGGGCTCAGGGGTGAGGAAGG + Intronic
973968361 4:56186509-56186531 AAATAGCAGAGAGATGGGGATGG + Intronic
973971586 4:56218506-56218528 AAATGAGGGAGGGGAGGGGAGGG - Intronic
974876892 4:67712806-67712828 AGGTGACTGAGGGGAGGGGAGGG + Intergenic
975317355 4:72969970-72969992 AAAGGGCAGAGTGGTGGTGATGG - Intergenic
978546261 4:109875418-109875440 AAGTGGCTGAAGGTTGGTGAAGG - Intergenic
978628466 4:110714910-110714932 AAGTGGCTGAGGTGGGAGGATGG + Intergenic
979670937 4:123359616-123359638 AAAGGGCAGAGAGGTCGGGAAGG + Intergenic
980757492 4:137184815-137184837 CAAAGGCTGAGGGGGTGGGAGGG - Intergenic
980864193 4:138535541-138535563 AAATGTGTGGGGAGTGGGGAGGG + Intergenic
981397711 4:144273522-144273544 ATATGGCTGAGTGATTGGGAAGG + Intergenic
981701663 4:147614117-147614139 AAATGGCTGAGCGGCGAGAATGG + Intergenic
982124901 4:152176020-152176042 AAAAGCCTGAAGGGTGGGGTGGG - Intergenic
982288898 4:153760285-153760307 AAATGGCGGTGGGGGGGCGAGGG + Intergenic
982971459 4:161993011-161993033 ACAAGGCGGAGGGGTGTGGAGGG + Intronic
983045329 4:162980151-162980173 AAATCTCTGAAGGGTGGGGTTGG - Intergenic
983279491 4:165662237-165662259 ATATGGCACAGGGGTGGGAATGG + Intergenic
983647817 4:170009719-170009741 CAATGGCTGGGAGGTAGGGAAGG - Intronic
983902945 4:173155943-173155965 GGTTTGCTGAGGGGTGGGGAAGG - Intergenic
984281114 4:177672003-177672025 AAATGGTTGAAGGCTGGGCATGG - Intergenic
984694722 4:182767976-182767998 AAATGACAGAGGTGTGGGGAGGG + Intronic
984811599 4:183800055-183800077 AACTGCCTGGGGGGTGGGGTGGG + Intergenic
984960337 4:185091254-185091276 AGAGGGCTGAGGAGAGGGGATGG - Intergenic
985505983 5:280560-280582 CCAGGGCAGAGGGGTGGGGAGGG + Intronic
986215496 5:5715563-5715585 AAATGACAGAGGGGTGGGGTGGG + Intergenic
986234138 5:5892137-5892159 AAATGCTTGTGGGGAGGGGAGGG + Intergenic
986259710 5:6133746-6133768 AAGTGGATGTGGGGTGGGGTAGG + Intergenic
986296622 5:6444698-6444720 AAGCCACTGAGGGGTGGGGAAGG - Intergenic
986470101 5:8065009-8065031 ACATTCCTGGGGGGTGGGGAGGG - Intergenic
986735610 5:10665470-10665492 GAATTGCTGGGGGGTGGGGGAGG - Intergenic
986761285 5:10882283-10882305 AAATGCCTCTGGGGTGGTGATGG + Intergenic
987368073 5:17167753-17167775 AAAAGGATGAGGGGTGAGGATGG + Intronic
988813238 5:34805885-34805907 GAATAGCTGAGGGTTCGGGAAGG - Intronic
988914295 5:35876777-35876799 AAATGATTGAGGAGTGAGGAAGG + Exonic
988934030 5:36065223-36065245 AAAAGCCTGCGGGGTGGGGGTGG + Intronic
990512278 5:56499645-56499667 AACTTTGTGAGGGGTGGGGAAGG - Intergenic
990691403 5:58368233-58368255 AAATAACTCAGGGGTGGGGGTGG + Intergenic
990768356 5:59213620-59213642 AAAAGGCTGATGGGTGGAGTAGG - Intronic
990974317 5:61544331-61544353 AATGGGGTGGGGGGTGGGGATGG + Exonic
991076851 5:62549597-62549619 AAGTGCTTGAGAGGTGGGGAAGG - Intronic
991100513 5:62787239-62787261 AAATGGCTGAGGAGTGTGCTTGG + Intergenic
991632812 5:68673785-68673807 GCAGGGCTGAGGGGTGGGCAGGG + Intergenic
992044563 5:72872740-72872762 AAAAAGCTGGGGGGTTGGGAGGG - Intronic
992261724 5:74977438-74977460 AAAGGGCTGGGGTGTGGGGGTGG + Intergenic
992349470 5:75914235-75914257 AAATGAATGAGGTGTGGGGAAGG - Intergenic
992509108 5:77416090-77416112 AAATGGCTGGGAGGTAGGGAAGG - Intronic
992609462 5:78494708-78494730 AAATGGCAGTGGGGTGTGGCAGG - Intronic
992968359 5:82027292-82027314 AAAAGGCTGAGGTGGGAGGATGG + Intronic
993475711 5:88361704-88361726 AAATGGACTAGGGGTGAGGAAGG - Intergenic
994117142 5:96073565-96073587 GGATGGCAGTGGGGTGGGGATGG + Intergenic
994242080 5:97435105-97435127 AAATGGCTGAAGGAAGAGGAGGG + Intergenic
994264070 5:97693704-97693726 ATAATGCTGAGGGGTGGGAAAGG - Intergenic
994967014 5:106685610-106685632 AAAGTGCTGGGGAGTGGGGATGG + Intergenic
997264841 5:132489570-132489592 AGCTGGCTGAGGTGAGGGGAGGG - Intronic
998121317 5:139580379-139580401 GAATGGCTGAGGAGAGTGGATGG + Intronic
998218004 5:140252117-140252139 AAATGGGAGTGGGGTGGGGGTGG - Intronic
998621648 5:143801051-143801073 AAATCCCAGAGGGGTGAGGAAGG + Intergenic
998850639 5:146347394-146347416 AAATGGTTGAGGGTGGGGGATGG - Intergenic
999135494 5:149316119-149316141 AAATGGGTCAGGGGAGTGGAGGG - Intronic
999388204 5:151170667-151170689 AAAGGGCTGATGGTTGGGGTTGG + Intergenic
1000229463 5:159301619-159301641 AAAAGGGAGCGGGGTGGGGAAGG - Intergenic
1000792412 5:165624156-165624178 AAATGTCTAATGGGTGGGTATGG + Intergenic
1000822230 5:165998810-165998832 AAATGGCTCAGTGGTGGAAAAGG + Intergenic
1001154016 5:169257386-169257408 AAATGGTTGTGGGGCGGGGTGGG - Intronic
1001825024 5:174737541-174737563 GAATGGATGTGGGGTGGGGGCGG + Intergenic
1001969110 5:175939485-175939507 AGATGACTGGTGGGTGGGGAGGG - Intronic
1001975685 5:175996773-175996795 AGATGACTGGTGGGTGGGGAGGG - Intronic
1002241743 5:177846999-177847021 AGATGACTGGTGGGTGGGGAGGG + Intergenic
1002248330 5:177904258-177904280 AGATGACTGGTGGGTGGGGAGGG + Intergenic
1002412929 5:179098026-179098048 AAATGGCTGAAAGGTGAGGAGGG + Intergenic
1002419712 5:179139276-179139298 AAGTGGCTGCGGGCTGAGGAGGG + Intronic
1002436207 5:179233439-179233461 GAAAGGCTGAGGGTGGGGGAGGG + Intronic
1002439978 5:179259186-179259208 AAGTACCTGAGGGGTGAGGACGG - Intronic
1002655851 5:180746040-180746062 ACATCGCTGAGAAGTGGGGAAGG + Intergenic
1002787778 6:417511-417533 AAAATGCTGAGGGTTGAGGAAGG + Intergenic
1002949921 6:1799642-1799664 AATTGGCTGAGGGGCTGGGGAGG + Intronic
1003507485 6:6751706-6751728 AAATTGCTGGGGGAGGGGGAGGG - Intergenic
1003756716 6:9128963-9128985 CAATGGGTGGGGGGTGGGGGTGG + Intergenic
1005331540 6:24755572-24755594 AAATGGCTGGGGGGTGGGTAGGG - Intergenic
1005520357 6:26595920-26595942 AAACGCCTCAAGGGTGGGGACGG + Intergenic
1005842618 6:29753359-29753381 GGATGGCTGGGGGGTGGGGGTGG + Intergenic
1006619512 6:35353423-35353445 AAATGGATATGGGGTAGGGATGG - Intronic
1006868688 6:37230583-37230605 ACATGGCGCAGGGGTGGTGAGGG + Intronic
1007086786 6:39153754-39153776 AGATGACTGAGGAGTGAGGAAGG + Intergenic
1007208013 6:40168369-40168391 AAAGAGCTGAGGGGAGAGGAGGG - Intergenic
1007238751 6:40410173-40410195 GGATGGCTGGTGGGTGGGGACGG - Intronic
1007431624 6:41780268-41780290 AGAGGGTTGAGGGGAGGGGAAGG + Intronic
1007451713 6:41945124-41945146 AATTGGAGGAGGGGTGGGAATGG + Intronic
1007589780 6:43014119-43014141 AGAGGGCTGAGGAGTGGGCAGGG - Intronic
1007614844 6:43173830-43173852 ATAGGCCTGAGGGGTGAGGAGGG - Exonic
1007960601 6:45955732-45955754 CAAGGACTGAGGGGTGGGGGAGG - Intronic
1008267301 6:49444279-49444301 AAATGGCTGTGGGGTGGGGAGGG - Intronic
1008342895 6:50389041-50389063 AAATGACTGTGGGCTGGGGCTGG - Intergenic
1008410113 6:51167656-51167678 CAATGGCTGACTGGTGGGGTGGG + Intergenic
1008786637 6:55175696-55175718 CAATTTCTGAGGGTTGGGGAGGG + Intronic
1008999155 6:57693079-57693101 AAATGGTTGGGGGGGGGGGTGGG + Intergenic
1009344572 6:62597255-62597277 AAATTTCTGTGTGGTGGGGAAGG + Intergenic
1010804110 6:80214561-80214583 AAACAGTTGAGGGGTTGGGATGG + Intronic
1010927005 6:81755045-81755067 AAATGGAGGAAGGGAGGGGAAGG + Intergenic
1011788635 6:90874045-90874067 AGATGGATGAGGGGAGGGGTGGG - Intergenic
1012199039 6:96382500-96382522 AAGTGACTGATGGGTGGGTAGGG + Intergenic
1012303928 6:97626890-97626912 AAATGGATAGGGGGTTGGGAGGG - Intergenic
1012902339 6:105020698-105020720 AGAAGGGTGAGGGGTTGGGAGGG - Intronic
1013229870 6:108152533-108152555 AAATGGATGGGGGGTGGGGGTGG + Intronic
1013331495 6:109106189-109106211 ACCTGGGTTAGGGGTGGGGATGG - Intronic
1014717442 6:124882868-124882890 AAATGGCTCCAGGGTGGGGCAGG + Intergenic
1015016988 6:128425396-128425418 AAAAGGGTGAGGGGTTGTGAGGG - Intronic
1015363770 6:132373675-132373697 AAAGGGCTATGGGTTGGGGAGGG + Intronic
1016045849 6:139479645-139479667 GGATGGAGGAGGGGTGGGGAGGG + Intergenic
1016312005 6:142744234-142744256 GAATAGATGAGGGGTTGGGAGGG - Intergenic
1016330301 6:142946727-142946749 AAATGGGGAAGGGGTGGGGACGG - Intergenic
1016423754 6:143912868-143912890 AAGTGCCTGAAGGGTGGGGCAGG - Intronic
1016448398 6:144156071-144156093 AAAATCCTGAGGAGTGGGGAGGG - Intronic
1016881605 6:148917188-148917210 AAATGGCTGAGGGGGAAGAAAGG - Intronic
1017374675 6:153754919-153754941 CAATGCCTGAAGGTTGGGGATGG - Intergenic
1018279808 6:162173022-162173044 GAATGGCTTGGGGATGGGGAAGG + Intronic
1018428311 6:163702829-163702851 GAAGGGCAGAGGGGTGGGGTGGG + Intergenic
1018790757 6:167145788-167145810 GGGTGGCAGAGGGGTGGGGATGG - Intergenic
1018813711 6:167316322-167316344 TAATGGGGGAGGGCTGGGGAGGG - Intergenic
1018847817 6:167567309-167567331 GAAGGGCTGAGGCGTGGGGCTGG + Intergenic
1019833590 7:3358310-3358332 AAATGAATGAGGGCTGGGCATGG - Intronic
1019941203 7:4292776-4292798 AAATGAATGAGGGGTAGAGATGG - Intergenic
1020607786 7:10360139-10360161 AAGTGGCTGAGGGGTGGCCATGG + Intergenic
1021044490 7:15905970-15905992 AATTGGCTAAGGGGTAGGGCAGG + Intergenic
1022008494 7:26289026-26289048 CAATTTCTGTGGGGTGGGGAAGG - Intergenic
1022460529 7:30601173-30601195 AACTGGCTCAGGGGTGAGCATGG - Exonic
1022626821 7:32045197-32045219 ACATGGCTGGGGGTGGGGGAAGG - Intronic
1023040948 7:36172887-36172909 TGAAGGCTGGGGGGTGGGGAGGG + Intronic
1023374262 7:39540217-39540239 AAACGGCTGAAGGGTAGTGATGG - Intergenic
1023415777 7:39930980-39931002 AAATGGTTTAGGGCTGGGGGTGG - Intergenic
1023424638 7:40022599-40022621 TAATGGCTGAGGATTGGGGCTGG + Intronic
1023596388 7:41833347-41833369 AAATGGAGGAGAGGTGGGGGAGG - Intergenic
1023609469 7:41958586-41958608 AAAGGGAGGAGGGGAGGGGAGGG - Intergenic
1023685387 7:42728908-42728930 AAATGGGAGTGAGGTGGGGAGGG + Intergenic
1023843866 7:44110489-44110511 ACCAGGCTGAGGAGTGGGGATGG - Intronic
1023872720 7:44271524-44271546 CATTGGCTGTGGGGTGGGGCAGG + Intronic
1024399662 7:48909514-48909536 AAATGGATGAGGTGTGGGCTTGG + Intergenic
1024587851 7:50856811-50856833 GAATGGCTGAGGTGTGGGCAGGG - Intergenic
1024587924 7:50857107-50857129 GAATGGCTGAGGTGGGGGGTGGG + Intergenic
1026020352 7:66700580-66700602 AAGGGGCTTAGGGGTGTGGAAGG + Intronic
1026327276 7:69321507-69321529 AAATAGATGAGGGCTGGGCATGG - Intergenic
1026846462 7:73701555-73701577 AAAGGGCTGTGGGCTGGGCAGGG - Intronic
1026879936 7:73901785-73901807 AAGGGGCTTAGGGGTGGGGAAGG - Intergenic
1027195513 7:76027319-76027341 GAATGGAAGAGGGGAGGGGATGG + Intronic
1027397121 7:77767731-77767753 AAAGGGGGGAGGGGAGGGGAGGG - Intronic
1027441967 7:78229130-78229152 AAATGGATGAGGGGAGAGAATGG + Intronic
1028166810 7:87547577-87547599 AAATAGCTGGGGGCTGGGCACGG + Intronic
1028424876 7:90675100-90675122 AGATGGCTTAGGGTTGGGAATGG + Intronic
1029506250 7:100965687-100965709 AGATGGCTGGGGGTTGGGGAGGG - Exonic
1030185042 7:106753437-106753459 TAATTGCTGAGGGCTGGGGGAGG - Intergenic
1031045638 7:116884417-116884439 TAGAAGCTGAGGGGTGGGGAAGG - Intronic
1031491792 7:122398771-122398793 GAAGGGGTGAGGGGTGGGGAGGG - Intronic
1031927935 7:127656005-127656027 AAGTGGGTGAGGGGAGGGTAAGG - Intronic
1033133346 7:138764233-138764255 AGATGGAGGAGGGGTGAGGAGGG + Intronic
1033706787 7:143895932-143895954 AAATGGGTGGGGGGAGGGGCAGG + Intronic
1033912868 7:146285929-146285951 AAAAGGGGGAGGGGAGGGGAAGG - Intronic
1033969778 7:147025335-147025357 AAAGGGGGGAGGGGAGGGGAGGG + Intronic
1033977144 7:147116451-147116473 AAGTGCCTGAAGGGTGGGGCAGG - Intronic
1034627697 7:152506087-152506109 ACATGGCTGAGGTATGGAGATGG + Intergenic
1034895603 7:154874639-154874661 CAAGGGCTGAGGAGTGGGGTGGG - Intronic
1034921300 7:155084555-155084577 ACATGGCTGTTGGGTGGGGATGG - Exonic
1034934569 7:155190577-155190599 AAATCGCTGCGGGGGGGGGGGGG - Intergenic
1035196522 7:157225844-157225866 AAAAGGCTGAGGCGGGAGGATGG + Intronic
1035374376 7:158397644-158397666 GAGTGACTGGGGGGTGGGGAGGG - Intronic
1035526419 8:316673-316695 TAGTGGCTGTGGGGTGGGGCTGG + Intergenic
1036172077 8:6496872-6496894 AACTGGGGGTGGGGTGGGGAAGG - Intronic
1036191810 8:6677892-6677914 ACATGGATGGGGGATGGGGAGGG - Intergenic
1036222124 8:6929745-6929767 AAAAGGCTGAGGGGAGGGACAGG - Intergenic
1036224397 8:6945461-6945483 AAAGGGCTGAGGGGAGGGGCAGG - Intergenic
1036236500 8:7043560-7043582 AAAGGGCTGAGGGGAGGGACAGG - Intergenic
1036558607 8:9883086-9883108 AGATGGCTGAGGTGTGGAGATGG + Intergenic
1037135578 8:15455810-15455832 AAATGGCTGAGTTTTGGGGAAGG - Intronic
1037835457 8:22212584-22212606 AAGTGGCTGTTTGGTGGGGAGGG + Intergenic
1038854808 8:31319825-31319847 AAATGGCAGTGTGGTGGGCAAGG - Intergenic
1039040164 8:33400148-33400170 AGATGGTGGGGGGGTGGGGAGGG + Intronic
1039762394 8:40591528-40591550 AAATGGTACTGGGGTGGGGAGGG - Intronic
1039780265 8:40778412-40778434 AACTGACTCAAGGGTGGGGAGGG - Intronic
1039800982 8:40954345-40954367 AGCTGGCTGAGGGATGGGGTGGG - Intergenic
1040454189 8:47579717-47579739 AATTGGGTTGGGGGTGGGGATGG - Intronic
1040549386 8:48426945-48426967 ACATGGCTGAGGCCTGTGGAGGG - Intergenic
1040737247 8:50523123-50523145 TAAAGGCTGAGAGGTGAGGAAGG - Intronic
1041095241 8:54343130-54343152 GAAGGGCTGAGGGGAGAGGAGGG - Intergenic
1041709277 8:60877921-60877943 AAATGGCTGAGCTATGGGCAAGG + Intergenic
1041802948 8:61819766-61819788 AAATTGCTGAGGTATGTGGATGG - Intergenic
1042667318 8:71221297-71221319 AAATGGCAGTGAGGTGGGGTGGG + Intronic
1042906057 8:73773421-73773443 AAATATCTGGGGAGTGGGGATGG - Intronic
1044940996 8:97343677-97343699 ACCTGGCTGTGGGGTGGGGGAGG - Intergenic
1044947214 8:97400598-97400620 GAAGGGCAGTGGGGTGGGGATGG - Intergenic
1044947394 8:97402509-97402531 GAAAGGGTCAGGGGTGGGGAGGG - Intergenic
1045004404 8:97905393-97905415 AAGTTACTGGGGGGTGGGGAAGG - Intronic
1045190566 8:99878570-99878592 TAATGGCAGGGGGGTGGGGGCGG - Intronic
1045204637 8:100025447-100025469 ACATGGGTGAGGGGTGAGGTTGG - Intronic
1045706607 8:104930747-104930769 ACATGGGGGAGGGGAGGGGAGGG - Intronic
1046508258 8:115164406-115164428 AAATGGCTCTGGGGGGAGGAAGG + Intergenic
1047509561 8:125505958-125505980 AAACGGCTGGGAGGTGGGGGTGG + Intergenic
1047566683 8:126051521-126051543 AACTGGATGAGGGGTGGATAAGG + Intergenic
1047959885 8:130003628-130003650 AAATAGCTGCTGGGTGAGGAGGG - Intronic
1048161377 8:132024842-132024864 GAAGGGCTGAGGGGTGGCCAGGG - Intronic
1048262483 8:132956768-132956790 ATGTGGCTGAGGGATGGGAAGGG + Intronic
1048307778 8:133296018-133296040 ATATGGGGGAGGGGTGGGTAAGG + Intronic
1048509835 8:135052170-135052192 AAATGATTGAGGAGGGGGGAGGG + Intergenic
1048512037 8:135071842-135071864 GGATGGTTGAGGGGTGGTGATGG - Intergenic
1049096599 8:140551853-140551875 AAATGGTTGATGGGTGGATAAGG + Intronic
1049368589 8:142252831-142252853 AAATGGCTGAGGGGTGGGGAGGG - Intronic
1049525169 8:143121765-143121787 ATGTGGCAGATGGGTGGGGAGGG + Intergenic
1049594469 8:143477082-143477104 GCAGGGCTGAGTGGTGGGGATGG - Intronic
1050391802 9:5151498-5151520 AAATGGACGGGGGGTGGGGATGG + Intronic
1050484143 9:6115840-6115862 GAAAGGGTGAGGGGTGGTGAGGG - Intergenic
1050621890 9:7462381-7462403 AGATGCCTGGAGGGTGGGGAGGG + Intergenic
1050646473 9:7725111-7725133 AAATGGCAGAGTGATGGGGAAGG - Intergenic
1051164772 9:14249797-14249819 AAAGGGCTTAAGGGTGGTGAAGG - Intronic
1051271100 9:15355782-15355804 AGATGGCTGGGGCGAGGGGAGGG - Intergenic
1051454015 9:17231808-17231830 AAATGGGTGGGGGGTAGGGAAGG - Intronic
1052352263 9:27469911-27469933 AGATGGCTGGGGGAGGGGGAAGG - Intronic
1052809189 9:33041926-33041948 CAAAGGCTGAGGGGAAGGGAAGG + Exonic
1053248105 9:36551902-36551924 CAATGTCTGGGGGGCGGGGAGGG + Intergenic
1053277692 9:36795731-36795753 AAATGGCTGAGGTGGAGAGAAGG - Intergenic
1053365564 9:37520196-37520218 AAATCACTGTGGGGTGGGGGTGG - Intronic
1054690412 9:68317882-68317904 AAATAGCCGGGGGGGGGGGAAGG + Intergenic
1055364621 9:75529214-75529236 AAATGGATGAAGGATGGGGTGGG - Intergenic
1055692787 9:78851753-78851775 TAACACCTGAGGGGTGGGGACGG + Intergenic
1055968243 9:81886357-81886379 AAATGGTGGTGGGGTGGGGGAGG - Intergenic
1056115202 9:83434802-83434824 AAAAAGCAGAGGGGTGGGGGAGG - Intronic
1056169800 9:83973620-83973642 AAATGGCTGCAGTGTGGGTATGG - Intronic
1056533455 9:87507593-87507615 AGATGCCAGAGTGGTGGGGAGGG + Intronic
1056606792 9:88092704-88092726 AAATTGCGGAGGGGTGGGGGGGG - Intergenic
1057210820 9:93200135-93200157 AAGGTGCTGAGGGGTGGGGAAGG + Intronic
1057497991 9:95575278-95575300 CAGTCCCTGAGGGGTGGGGAGGG + Intergenic
1057690506 9:97279509-97279531 AAATGGGGCAGGGTTGGGGATGG + Intergenic
1057762454 9:97887900-97887922 ATAATGCTGAGGGGAGGGGAGGG + Intergenic
1058108505 9:101003408-101003430 AAGTTGTTGAGGGGTGGGGTGGG + Intergenic
1059160417 9:112029334-112029356 GAAGGGCAGAGGGGTGGGAATGG + Intergenic
1059250279 9:112881988-112882010 CTGTGGCTGAGGGTTGGGGAGGG + Intronic
1059258849 9:112956462-112956484 AAAAGGCGGGGGGGTGGGGGCGG + Intergenic
1059348598 9:113648992-113649014 ACAGGGCTGAGGGGCAGGGAGGG - Intergenic
1059435828 9:114275712-114275734 GAAGGGCTGATGGGTGAGGACGG + Exonic
1059540547 9:115125958-115125980 GGAGGGCTGGGGGGTGGGGATGG + Intergenic
1059674248 9:116522514-116522536 GAAAGGGTGAGGGGTGGCGAGGG + Intronic
1059819503 9:117956536-117956558 GAATGGCTGAGGGTAGGGTAGGG + Intergenic
1060221439 9:121766112-121766134 CACTGGCAGAGAGGTGGGGAGGG + Intronic
1060382332 9:123188027-123188049 TAAGGGCTTGGGGGTGGGGAAGG - Intronic
1061016692 9:127985125-127985147 CACTGGCTTAGGTGTGGGGAAGG + Intergenic
1061259623 9:129472718-129472740 AAATGGCTGCAGGGAGGGGTGGG + Intergenic
1061277973 9:129580401-129580423 AAAGGGCTGAGGGGCGGTGGGGG - Intergenic
1061371643 9:130200846-130200868 ACATGGCCGTGGGGAGGGGAGGG + Intronic
1061625477 9:131838554-131838576 CAGAGGCTGAGGAGTGGGGAAGG - Intergenic
1062255204 9:135617580-135617602 AGAAGGTTGAGGGGTTGGGAGGG + Intergenic
1062404668 9:136389741-136389763 AAAGGACTGGGGGGTGGGGCGGG + Intronic
1062675379 9:137740173-137740195 AAATGGGCGTGGGGTGGGGGTGG - Intronic
1203545739 Un_KI270743v1:126855-126877 AGATGGTTGGGGGGTGGGGAGGG - Intergenic
1185511663 X:668310-668332 AAGTGGGGGAGGGGAGGGGAGGG - Intergenic
1186153447 X:6700920-6700942 AAATGGGGGTGGGGTGGGGAGGG + Intergenic
1186624055 X:11273109-11273131 AAAAGGGTGAGGTTTGGGGAGGG - Intronic
1186742163 X:12529900-12529922 ATATGGTTGGGGGGTGGGGGTGG + Intronic
1187301471 X:18054614-18054636 ACATTGCTGGGGGGTGGGGATGG + Intergenic
1187792778 X:22968939-22968961 AATTGGTTGAGGGATGGGGTGGG + Intergenic
1187915670 X:24150172-24150194 ATATCGGTGAGGGGGGGGGAGGG + Intronic
1188618920 X:32195212-32195234 AAATAGATGAGGGCTGGGGAAGG + Intronic
1188917053 X:35924953-35924975 CAAAGGCTGAGGGTTGGGGTGGG + Intronic
1189234254 X:39475585-39475607 CAAAGGCTGAGAGGTGGGGCGGG + Intergenic
1189333780 X:40158051-40158073 AAATGGCTTGGGTGTGGGGCTGG + Intronic
1189581674 X:42413721-42413743 GAGTGCCTGAGGGGTGGGGCAGG - Intergenic
1189593731 X:42542755-42542777 AAATGGCAGAGGGGTAGTGTTGG - Intergenic
1190361458 X:49653265-49653287 AAATTGCTGGTGGGTGGGGCAGG - Intergenic
1191804052 X:65115193-65115215 AAAAGGGTGGGGGGTGGCGAGGG - Intergenic
1191862626 X:65678291-65678313 ATATGGGGGAGGAGTGGGGAAGG + Intronic
1191862868 X:65680082-65680104 AAATGGCTGTTGGTTTGGGAAGG + Intronic
1192207806 X:69107686-69107708 AAAAGGGTGAGGGGAGGGGAGGG - Intergenic
1192625402 X:72722038-72722060 AAATGGCAGGGGGCAGGGGAGGG - Intergenic
1195252639 X:103063726-103063748 GAAGGGCTGGGGTGTGGGGAGGG + Exonic
1195401599 X:104466798-104466820 AAGTGGCCAAGGGGTGAGGAAGG + Intergenic
1195431179 X:104791226-104791248 AGATGGGGGAGGGGTGGGGGTGG - Intronic
1196061905 X:111417562-111417584 AAACCTTTGAGGGGTGGGGAGGG - Intergenic
1197042950 X:121962119-121962141 AAAGTGCTGAGGGGTTGGGTTGG + Intergenic
1197145411 X:123166842-123166864 TAATGGCTCAGAGGTGGGGCAGG - Intergenic
1197215074 X:123859916-123859938 AAATGGCGGAGGGGGGAAGAAGG + Intronic
1197260047 X:124307718-124307740 AAACTGCTGTTGGGTGGGGAGGG + Intronic
1197894036 X:131292092-131292114 GACTGGCTGAGGAGTGGGGTGGG - Intronic
1197897312 X:131328832-131328854 ATAAGAGTGAGGGGTGGGGAGGG + Intronic
1198170367 X:134099432-134099454 AAATTGGTGGGGGGTGGGGGCGG - Intergenic
1198425509 X:136515979-136516001 AAATGAATGTGGGGTGGGGGAGG - Intergenic
1198611862 X:138410909-138410931 CACTGCCAGAGGGGTGGGGAGGG - Intergenic
1198740844 X:139840856-139840878 AAAAGACTGAAGGGTGGGAAGGG + Intronic
1198809889 X:140524575-140524597 AAATGGGAGAGGGGAGGGGAAGG + Intergenic
1198911373 X:141618509-141618531 GAATTGCTTAGGGCTGGGGATGG - Intronic
1199249780 X:145647201-145647223 AACTGACAGAGGGGTGGGGGGGG + Intergenic
1199713796 X:150491625-150491647 GAATGGCTGGGAGGTGGGGCAGG + Intronic
1199722544 X:150552347-150552369 AACTGCCTGGGGGGTGGAGAGGG - Intergenic
1199840063 X:151636906-151636928 AAATGGGTTAGGGGTGAGGTGGG - Intronic
1201559457 Y:15300734-15300756 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1201712258 Y:17005593-17005615 AAATGGGTGAGTGGGTGGGAGGG + Intergenic
1201904831 Y:19077466-19077488 AAAGGGCTGAAGGGGAGGGACGG + Intergenic