ID: 1049368590

View in Genome Browser
Species Human (GRCh38)
Location 8:142252832-142252854
Sequence GAAATGGCTGAGGGGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 770}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368590_1049368597 -10 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368597 8:142252845-142252867 CAGCCATTTCCTCTGCACAATGG No data
1049368590_1049368603 21 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368590_1049368606 26 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368590_1049368598 -9 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368598 8:142252846-142252868 AGCCATTTCCTCTGCACAATGGG No data
1049368590_1049368602 20 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368590_1049368601 5 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368590_1049368604 22 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368590 Original CRISPR GAAATGGCTGAGGGGTGGGG AGG (reversed) Intronic
900146570 1:1161285-1161307 GGAATGGGCGAGAGGTGGGGCGG - Intergenic
900686924 1:3954587-3954609 GATGTGGCAGGGGGGTGGGGTGG - Intergenic
900723253 1:4194382-4194404 GAAGAGGATGGGGGGTGGGGTGG + Intergenic
900733137 1:4276093-4276115 GAGGTGGGTGTGGGGTGGGGAGG + Intergenic
900735300 1:4296014-4296036 GGAATGACTGATGGGTGGGTGGG - Intergenic
901741896 1:11347265-11347287 CAAATGTCTGGGGGGTGGTGAGG - Intergenic
901931841 1:12600974-12600996 GAGATGGGTGGGGGGTTGGGGGG + Intronic
902301904 1:15507802-15507824 GAAGGACCTGAGGGGTGGGGAGG + Intronic
902772185 1:18651823-18651845 GAAGAGGCGGTGGGGTGGGGGGG - Intronic
902862682 1:19257459-19257481 CAAAAGGTTGAGGGGTGAGGTGG + Exonic
902863918 1:19265231-19265253 AAAATGGCTGAGGGAGGAGGTGG + Intergenic
903033130 1:20477468-20477490 GTGATGGCAGTGGGGTGGGGTGG - Intergenic
903325031 1:22564429-22564451 GAGAGGGCTGGGGGATGGGGAGG + Intronic
903406808 1:23104135-23104157 GGAATGGCTGTGGGTTGTGGGGG - Intronic
903475651 1:23617609-23617631 GTAATGGCAATGGGGTGGGGTGG - Intronic
903552628 1:24168676-24168698 GAAATTTGTGGGGGGTGGGGGGG - Intronic
903778049 1:25805771-25805793 CAGAGGGCTGTGGGGTGGGGAGG + Intronic
903858397 1:26350872-26350894 GAAATGGGGGAGGGGAGTGGGGG - Intronic
903859686 1:26357223-26357245 CAAATGAGTCAGGGGTGGGGAGG - Intergenic
903892432 1:26578598-26578620 GAAATGGTGGATGGGTGGGTGGG + Intergenic
904343783 1:29855163-29855185 GAGACGGCTGGGAGGTGGGGAGG - Intergenic
904542118 1:31239984-31240006 GGAACGGCAGAGGGGTGGGGCGG + Intergenic
904605412 1:31695389-31695411 AAAATGGCTGTGGGGCTGGGTGG - Intronic
904607212 1:31704367-31704389 CAGAAGGCTGCGGGGTGGGGGGG + Intergenic
904703762 1:32375258-32375280 GGAATAGGTTAGGGGTGGGGTGG + Intronic
904753865 1:32757351-32757373 GGACAGGTTGAGGGGTGGGGTGG + Intronic
905340546 1:37274649-37274671 GAAAGGGCCGGAGGGTGGGGCGG + Intergenic
905975289 1:42169854-42169876 GAAGTGGGTGAGGGGTGGCGGGG - Intergenic
906120640 1:43388264-43388286 GGAAGGGCTTATGGGTGGGGGGG - Intronic
906125056 1:43422663-43422685 GAGGTGGCGGGGGGGTGGGGGGG - Intronic
906136888 1:43506265-43506287 GCAATGGATGAGGGGAGGCGGGG - Intergenic
906642669 1:47450664-47450686 GAGGTGGCTGAGTTGTGGGGAGG + Intergenic
906721084 1:48005282-48005304 GAAAAGGCCCAGAGGTGGGGAGG + Intergenic
906935724 1:50212568-50212590 TAGATGGTTGAGGGGAGGGGAGG - Intergenic
907070970 1:51534509-51534531 GAAAGGGGTGAGGAGTGGGTTGG + Intergenic
907285288 1:53376066-53376088 GGAATGGCGGGGGGATGGGGGGG + Intergenic
907406530 1:54257020-54257042 GAAAGGATTGAGGGGTGGAGGGG - Intronic
907665229 1:56428677-56428699 GACATGGGTGGGTGGTGGGGAGG - Intergenic
907767000 1:57422627-57422649 GGAATGGCGTGGGGGTGGGGAGG - Intronic
907898903 1:58719613-58719635 GACAGAGGTGAGGGGTGGGGAGG + Intergenic
907965215 1:59322433-59322455 GAAAGCGCTGGGGGGTGGTGAGG - Intronic
908063373 1:60375369-60375391 GCAATGGGGGAGGGGTGTGGAGG + Intergenic
908508319 1:64828159-64828181 AAAATGGGCGGGGGGTGGGGGGG - Intronic
908510601 1:64847488-64847510 GAAACGGGAGAGGGGAGGGGAGG + Intronic
908598112 1:65710149-65710171 GAAAGTGATGAGGGGTTGGGGGG - Intergenic
908730654 1:67222859-67222881 GAAATTGCTGAGGGATGGTGGGG - Intronic
909314385 1:74197677-74197699 GAAAAAACAGAGGGGTGGGGTGG + Intronic
909471757 1:76037123-76037145 TATATGTCTGAGAGGTGGGGTGG - Intergenic
909939131 1:81590397-81590419 GAAATGGCTGCTGTGTGGGTGGG - Intronic
910355092 1:86344172-86344194 GAAAGGGTTGTGGGGAGGGGAGG - Intergenic
910597237 1:88992931-88992953 GAAATGGAGGAGGGAAGGGGTGG + Exonic
911087155 1:93988599-93988621 GCAATGGGTGTGGGGGGGGGGGG + Intergenic
911181937 1:94868949-94868971 GAAATGGCTGAGGTGGAGGAAGG + Intronic
911204635 1:95079956-95079978 GAAATCACTGAGGGGTAGAGAGG + Intergenic
911844966 1:102741103-102741125 CACATGGCTGAGAGTTGGGGAGG + Intergenic
911871623 1:103107373-103107395 GAAGAAGCGGAGGGGTGGGGTGG + Intronic
912480692 1:109980423-109980445 GAAAAGGCTGAGGGTAGGGAGGG + Intergenic
912624678 1:111197327-111197349 CACAAGGCTGAGGGCTGGGGAGG + Intronic
912704754 1:111903764-111903786 GAACTGGCTGAGAGGCAGGGAGG - Intronic
912978644 1:114351329-114351351 CCAGTGGCTGAGGTGTGGGGTGG - Intergenic
913230239 1:116735359-116735381 CAAATGGCTGAGCGCTGGGTGGG - Intergenic
913275793 1:117136699-117136721 AAAAAGGGTGGGGGGTGGGGTGG + Intergenic
914985133 1:152449879-152449901 GAGGAGGCTGAGGGTTGGGGTGG + Intergenic
915109239 1:153552612-153552634 GTGAGGCCTGAGGGGTGGGGTGG + Intergenic
915109595 1:153554561-153554583 GAGATGGCTGTGGGAAGGGGAGG + Intergenic
915267449 1:154729124-154729146 GAAATGGCTGGTGGGTAGAGGGG + Intronic
915782475 1:158567982-158568004 AATATGACTGAGGGGTGGGCAGG - Intergenic
916629825 1:166600447-166600469 GAAATGGGTGATGGGTGTGCTGG - Intergenic
917497109 1:175550492-175550514 GAAAAGGATGGGGGGTGAGGGGG - Intronic
918082444 1:181217998-181218020 GAGATGGGTGAGGGTTGAGGAGG + Intergenic
918538655 1:185603566-185603588 GAAGAGACTCAGGGGTGGGGAGG + Intergenic
918876184 1:190046425-190046447 GAAATGGGGGAGGGGAGGGAGGG + Intergenic
919893570 1:201993905-201993927 TAAATGATTGTGGGGTGGGGGGG - Intronic
919948531 1:202341085-202341107 GAAAGGTGTGAGTGGTGGGGAGG - Intronic
919996581 1:202757081-202757103 GCAAGGGCTGGGAGGTGGGGGGG + Intronic
920500059 1:206480196-206480218 GAGATGGGTGGGGGGTGGGCAGG + Intronic
920820290 1:209374030-209374052 GGATAGGCTAAGGGGTGGGGAGG - Intergenic
920848759 1:209614497-209614519 GATATGTGTGGGGGGTGGGGTGG - Intergenic
921275882 1:213519634-213519656 GATCTGGCTGTGGGGAGGGGTGG - Intergenic
921339952 1:214124708-214124730 GAAATGGGGGTGGGGTGGGTGGG + Intergenic
922419884 1:225452301-225452323 GATATGGCTAAGGGCTGTGGTGG + Intergenic
922627788 1:227067188-227067210 GAAATGGCTGCGGGGTGCTCAGG + Intronic
922662020 1:227438527-227438549 GGAAGAGCTTAGGGGTGGGGAGG - Intergenic
922885090 1:229013673-229013695 GAAATGGCGGCTGGGTGCGGTGG - Intergenic
923818452 1:237406219-237406241 GAGATGGGAGAGGGGAGGGGAGG - Intronic
923885569 1:238151462-238151484 GCACTGGCTGAGTGGTTGGGTGG - Intergenic
924067513 1:240240171-240240193 CATATGGCTGAGGGGTAGTGTGG + Intronic
924726720 1:246678283-246678305 GAAATGGTTGGGGGTGGGGGTGG - Intergenic
1062830768 10:604013-604035 GGCAGGGCTGGGGGGTGGGGTGG - Intronic
1063122726 10:3115841-3115863 GGAGTGGCAGAGAGGTGGGGTGG + Intronic
1063324219 10:5080972-5080994 TAGAGGGCTGAGGAGTGGGGGGG + Intronic
1063427095 10:5958991-5959013 GAAAAAGCTGAAGGGAGGGGAGG - Intronic
1064724337 10:18262302-18262324 GAAATGGTGACGGGGTGGGGTGG + Intronic
1065090985 10:22233388-22233410 GAAATGGTTGCGGGGTGGAGGGG + Intergenic
1065695309 10:28374303-28374325 GGAAGGGCTGTGGGGTGAGGTGG - Intergenic
1065944564 10:30594891-30594913 CAGATGCCCGAGGGGTGGGGGGG + Intergenic
1066659710 10:37727856-37727878 GCACTGCCTGTGGGGTGGGGGGG + Intergenic
1067216771 10:44310264-44310286 GAGGGGGCTGAGGGGCGGGGCGG + Intergenic
1067241632 10:44500240-44500262 GAAATGGGGGAGGCGTGGTGGGG - Intergenic
1067275378 10:44828843-44828865 GAAAATGCAGAGGGGAGGGGAGG + Intergenic
1067554841 10:47261572-47261594 GAGATGGCTGGGGGGCAGGGTGG - Intergenic
1068656338 10:59579861-59579883 GGAGAGGGTGAGGGGTGGGGTGG - Intergenic
1068748164 10:60559254-60559276 GAAAGGGTTGGGGGGTGGTGAGG - Intronic
1069818916 10:71215660-71215682 GGAAGGGCTGAAAGGTGGGGTGG - Intronic
1069871945 10:71538498-71538520 GAAATGGCTTTTGGCTGGGGCGG - Intronic
1070180513 10:74009218-74009240 AAAATGGCTCGGGGGGGGGGGGG - Intronic
1070269406 10:74938335-74938357 GGGATAGCTGGGGGGTGGGGAGG - Intronic
1070660370 10:78301509-78301531 GAGAGGACTGAGGGCTGGGGAGG + Intergenic
1070984532 10:80677436-80677458 GTAGTTGCTGAGGGCTGGGGTGG - Intergenic
1071228903 10:83563085-83563107 GAAAAGGCTGAAAGTTGGGGTGG + Intergenic
1071783988 10:88879361-88879383 GAAATGGCTGCAGAGTGGGGTGG - Intergenic
1072234926 10:93445614-93445636 CCAGTGCCTGAGGGGTGGGGAGG + Intronic
1072560354 10:96567569-96567591 GAAAGGGCTGGGGGATGGTGAGG - Intronic
1072948846 10:99835124-99835146 AAAATGGATGAGGGAAGGGGAGG + Intronic
1073033979 10:100550228-100550250 AAGGTGGCTGAGGGGTGGGAGGG + Exonic
1073093762 10:100967815-100967837 GAAATGGCTGGGGGGGGGGGGGG - Intergenic
1073357579 10:102869616-102869638 GAAGGGGCTGGGGGCTGGGGCGG - Intronic
1073480833 10:103785228-103785250 GAAATAGCTGAGCAGTGGGCAGG - Intronic
1073542075 10:104322793-104322815 GGACTGGCTGAGGGCAGGGGAGG + Intronic
1074378859 10:112961820-112961842 TACGTGGCTGGGGGGTGGGGTGG + Intronic
1074406060 10:113181138-113181160 AAAATGGCAGGGGGGTGAGGAGG - Intergenic
1074428441 10:113372446-113372468 GAAATGGGGGTGGGGTGGAGGGG + Intergenic
1074666475 10:115731814-115731836 GAGATGGGTGTGGGGTGGGGGGG - Intronic
1075025041 10:118978231-118978253 AAAATGGCTTAGGGTAGGGGCGG - Intergenic
1075327759 10:121548141-121548163 GCTATGGCTGTAGGGTGGGGCGG - Intronic
1075424317 10:122329619-122329641 GCAGTGGCTGGGGGGTGGGCAGG - Intronic
1076257090 10:129036200-129036222 GAAAAGGCACAGGGGTGGAGCGG + Intergenic
1076683475 10:132186787-132186809 GGAGTGGCTGAGGGCGGGGGCGG + Intergenic
1076980115 11:199647-199669 GAAGGGGTGGAGGGGTGGGGTGG + Intronic
1077021010 11:417183-417205 GAAATGGCTCGGGGCCGGGGAGG - Intronic
1077469630 11:2751090-2751112 GAAATTGCTGTGGGGTGCGGGGG - Intronic
1077892544 11:6429935-6429957 CAAATGGCTGACAGGTTGGGAGG + Intergenic
1078594461 11:12674623-12674645 GCAAAGGTGGAGGGGTGGGGGGG - Exonic
1079140583 11:17806909-17806931 GTCCTGGCTCAGGGGTGGGGTGG - Intronic
1079396668 11:20069527-20069549 GACATGGCTGATGGGGGTGGGGG - Intronic
1079408351 11:20164079-20164101 GAAAGGGATGGGGGGTGAGGGGG - Intergenic
1079975593 11:27087315-27087337 GAAGTTGGTGAGGGCTGGGGTGG - Intronic
1080127422 11:28753534-28753556 GAAATGGCAGGGGGCTTGGGGGG - Intergenic
1080691425 11:34561869-34561891 GAAAAGGGTGGGGGGTGGCGAGG + Intergenic
1080763342 11:35273629-35273651 GAAATGGATAAGGTGTAGGGAGG - Intronic
1080853120 11:36088621-36088643 GAATTGGCTGAGAGGTGAAGAGG - Intronic
1081766034 11:45610736-45610758 GAAATGGGTGAGGGTTGTTGTGG - Intergenic
1083161593 11:60857782-60857804 GATGTGTCTGTGGGGTGGGGTGG - Intergenic
1083230592 11:61315698-61315720 AAAATTGCTGAGGGGTGGAAGGG + Intronic
1083257306 11:61504556-61504578 GAAATGTGTGGGGGGTGGGGAGG - Intergenic
1083296258 11:61717171-61717193 GAAATGTCTCAGGAGCGGGGAGG - Intronic
1083624854 11:64067198-64067220 GAGATGGCAGATGGGAGGGGTGG + Intronic
1083796595 11:65020388-65020410 GAAAAGATAGAGGGGTGGGGTGG - Intronic
1083806182 11:65075537-65075559 CTAGTGGCTGTGGGGTGGGGGGG + Intronic
1083885444 11:65571325-65571347 GAGATGGCTCAGGGCTGAGGTGG + Intronic
1084023000 11:66429304-66429326 GAAATGGCTGTGGGGTCTGTGGG + Intergenic
1084129010 11:67119203-67119225 GAGCTGGAGGAGGGGTGGGGAGG + Intergenic
1084153041 11:67300017-67300039 GAGATGGCTGTGGGGTTGGTGGG - Exonic
1084255637 11:67940591-67940613 GAAATGGATGAGTGGTTGAGGGG + Intergenic
1084305763 11:68282454-68282476 GAAAGAGATGGGGGGTGGGGAGG - Intergenic
1084334084 11:68446807-68446829 GAAATGGCTGTGGCGTCGAGGGG + Intronic
1084538256 11:69770938-69770960 CACATGGCTGGGGGTTGGGGTGG - Intergenic
1084570427 11:69956528-69956550 GGAACGGCTCAGGGGTGGAGCGG + Intergenic
1084907433 11:72358823-72358845 GAAGTGGAAGAGGGGTGGGGTGG - Intronic
1084907444 11:72358848-72358870 GAGGTGGAGGAGGGGTGGGGTGG - Intronic
1084945594 11:72636730-72636752 GAAATGGCTGAAGAATGGAGGGG - Intronic
1085200146 11:74696955-74696977 GAAAGGGCTGTGGAGAGGGGAGG - Intronic
1085258036 11:75188059-75188081 GAGTTGGCTGTGGGCTGGGGAGG - Intronic
1085290587 11:75396378-75396400 CAGATGGATGGGGGGTGGGGGGG + Intergenic
1085446172 11:76602609-76602631 GGAAAGGCTGTGGGGAGGGGAGG + Intergenic
1085667550 11:78428387-78428409 TATCTGGCTGGGGGGTGGGGTGG + Intergenic
1085996067 11:81915520-81915542 GAAATGTGTGTGGGGTGGGGTGG + Intergenic
1087209802 11:95435635-95435657 CAACTGGCTGGGGAGTGGGGAGG + Intergenic
1087299265 11:96413482-96413504 GAAATGTCTGAGAGCTAGGGTGG - Intronic
1087762063 11:102111481-102111503 GGAGTGGAGGAGGGGTGGGGAGG + Intronic
1088539301 11:110896512-110896534 GATCAGGCTGAGGGCTGGGGTGG - Intergenic
1088992876 11:114969924-114969946 GAAAAGGATGAGAGGTGGGGAGG + Intergenic
1089157014 11:116410249-116410271 GAGAGGGCAGATGGGTGGGGTGG + Intergenic
1089396728 11:118141043-118141065 GAAGGGGCTGAGAGATGGGGAGG + Intronic
1089619083 11:119712329-119712351 GAACTGGGGGAGGGGAGGGGAGG - Intronic
1089664459 11:120009371-120009393 GACATGGATGAAGGGTGTGGGGG - Intergenic
1089692822 11:120197482-120197504 GAACTGGGGGTGGGGTGGGGAGG - Intergenic
1089694511 11:120208898-120208920 GAAATGGCTGAGGGCAGAGCTGG + Intergenic
1089728938 11:120508513-120508535 GAAATGGATGATGGGTGAGGTGG + Intergenic
1090171966 11:124613207-124613229 TAAATGGGTTAGGGGTGGTGGGG - Intronic
1090242044 11:125190800-125190822 GAGAGTGCTGAGGGGTGGGCTGG - Intronic
1090459716 11:126879905-126879927 GAGATGGCGGCGGGGTGGTGGGG - Intronic
1090887581 11:130892889-130892911 GCAAGGGCAGAGAGGTGGGGTGG + Intronic
1091561682 12:1619132-1619154 GAAATGTCTTAGGGGTGGGGAGG - Intronic
1091732925 12:2894280-2894302 GAGATGGCGGGGGGGCGGGGCGG + Intronic
1092406588 12:8225782-8225804 GCAATCCCTGAGGGGTGGGGGGG - Intronic
1092425872 12:8375325-8375347 GAAATGGATGAGTGGTTGAGGGG + Intergenic
1092488273 12:8921707-8921729 AGACTGGTTGAGGGGTGGGGAGG - Exonic
1092843239 12:12562554-12562576 GGAAAGGCGGGGGGGTGGGGTGG + Intergenic
1093076038 12:14759940-14759962 CACATGGCTGTGGGGGGGGGTGG - Intergenic
1094068423 12:26385795-26385817 GGAATTGATGGGGGGTGGGGTGG - Intronic
1094213580 12:27917975-27917997 GAAAGGACTGGGGGGAGGGGAGG + Intergenic
1095956289 12:47808319-47808341 GAAGTGGAGGTGGGGTGGGGGGG - Intronic
1095965221 12:47863048-47863070 GGCGTGGCTGAGGGATGGGGTGG + Intronic
1096076052 12:48805582-48805604 GGTGTGTCTGAGGGGTGGGGTGG - Intergenic
1096111067 12:49029470-49029492 GAAGTATCTGAGGGGTGGGTAGG + Exonic
1096121888 12:49093898-49093920 GAAATGGCTGAGGCGTGGACCGG - Intronic
1096369719 12:51058837-51058859 CAAATGTCCTAGGGGTGGGGAGG + Intronic
1096525515 12:52207871-52207893 ACAATGGGTGAGGGGAGGGGAGG - Intergenic
1096647905 12:53048230-53048252 GAGCTCGGTGAGGGGTGGGGTGG - Intronic
1096762029 12:53849862-53849884 GAAATAGTGGAGGGGTGTGGAGG - Intergenic
1096785130 12:54012950-54012972 GAAAGGGGTGAGGGGTTGAGAGG + Intronic
1096946588 12:55414302-55414324 AGACTGGTTGAGGGGTGGGGAGG + Intergenic
1096983478 12:55742520-55742542 GAAAGGGGTGGGGGGGGGGGTGG - Intergenic
1097021912 12:56026765-56026787 GAGTTGGCTGAGGGGTGGGATGG - Exonic
1097054056 12:56239538-56239560 GAAATGGCTGAGAGGGAAGGAGG + Exonic
1099413399 12:82358967-82358989 GGATTAGTTGAGGGGTGGGGTGG + Intronic
1099675838 12:85759499-85759521 GAAAAGGAAGAGGGGAGGGGAGG + Intergenic
1099863313 12:88246552-88246574 GAAATGGATGAGGAGGGGAGAGG - Intergenic
1100581165 12:95942367-95942389 GACACAGCTGAGGGGTGGGAGGG + Intronic
1101045533 12:100801738-100801760 GCAGGGGCTGGGGGGTGGGGTGG + Intronic
1101250636 12:102931345-102931367 GAAATAGCAGTGGGGTGGGTAGG + Intronic
1101502747 12:105319482-105319504 GCAAAGGCTCAGTGGTGGGGAGG + Intronic
1102202079 12:111064121-111064143 CAAATGGCTTAGGAGTGGGCAGG + Intronic
1102460138 12:113094962-113094984 ACAATGGCTGAGGAGTGGGCAGG + Intronic
1102519704 12:113470792-113470814 GAAATGTTTAAGGGGTTGGGAGG + Intronic
1102549382 12:113680315-113680337 GAGATGGCTGAGGGCTGGAGAGG + Intergenic
1102571108 12:113827510-113827532 GAAAGGGCGGGGGGGCGGGGGGG + Intronic
1102589659 12:113947678-113947700 GAAAAGACTGAGGCATGGGGAGG - Intronic
1103268128 12:119648158-119648180 GCAAGTGATGAGGGGTGGGGTGG - Intergenic
1103688829 12:122753592-122753614 GAAACAGCTTTGGGGTGGGGAGG + Intronic
1104098919 12:125587952-125587974 GAAAAGGCTCAGGGGTGAGGTGG + Intronic
1104351165 12:128045139-128045161 GAGATGTCTGAGAAGTGGGGAGG + Intergenic
1104707888 12:130961430-130961452 AAAATGGAGGAGGGGTGGGGAGG - Intronic
1104764070 12:131315231-131315253 GACATGGCAGAGGTGTGGGTGGG + Intergenic
1104831976 12:131758657-131758679 GAAATTGCTGTGGAGTGTGGTGG + Intronic
1105018068 12:132798164-132798186 GTGAGGGATGAGGGGTGGGGGGG + Intronic
1105261977 13:18786280-18786302 TGAATGGCTGGGGGTTGGGGAGG - Intergenic
1105558064 13:21464686-21464708 CAAGTGGCGGAGGGGTGGGCTGG + Intergenic
1106018000 13:25887126-25887148 GAAATGGAAGAGGTGTGAGGAGG + Intronic
1106124414 13:26888677-26888699 GAAAGGGCTGGGGAGAGGGGTGG + Intergenic
1106876157 13:34076159-34076181 GAAGATGCTGGGGGGTGGGGTGG + Intergenic
1107301921 13:38975040-38975062 GAAATGGCTGCTGGGCGTGGTGG + Intronic
1107312477 13:39093916-39093938 GAAAAAGCTGAGGGTTGGGAGGG + Intergenic
1107561249 13:41559272-41559294 CAAATAGCTGTGGGATGGGGAGG - Intergenic
1108186396 13:47892509-47892531 GAAAAGGCTGAGGGTTGGAAAGG + Intergenic
1108230058 13:48328543-48328565 GAAATGGCTGATGGGAAGGCGGG - Intronic
1108434611 13:50389570-50389592 GAAATGGGTTAGGGGTAGTGGGG + Intronic
1108714804 13:53068614-53068636 GAAATGGGAGAGGGGAGTGGAGG + Intergenic
1109522964 13:63535835-63535857 GATATGGGTGTGGGGTGGTGAGG + Intergenic
1109691255 13:65892753-65892775 GAAATGGATGGTGGGTGGTGGGG + Intergenic
1110594338 13:77302364-77302386 AAAAGGGCTGGGGGGTGGGGAGG + Intronic
1110922672 13:81108517-81108539 GGTATGGGTGGGGGGTGGGGGGG - Intergenic
1111592772 13:90371217-90371239 CAGATGGGTGAGGGGTGGGGTGG + Intergenic
1111718318 13:91909826-91909848 GAACTGGCAGAGGAGGGGGGTGG - Intronic
1112613517 13:100979607-100979629 GAAATGGCAGAGGGTTGAAGGGG + Intergenic
1112619131 13:101036720-101036742 GGAATTGCAGAGGGGTGTGGAGG + Intergenic
1112709500 13:102111158-102111180 GTGATGGCTGAGGGGTGTGGAGG - Intronic
1113142731 13:107173284-107173306 GGAATGGGTGAGGGTTTGGGGGG - Intronic
1113214986 13:108029423-108029445 TAAATGGGTTGGGGGTGGGGTGG + Intergenic
1113219407 13:108082367-108082389 GAAATGGCTGATGGAGGGGTGGG + Intergenic
1113369721 13:109712562-109712584 AAAATGCCTGAGGGCTGGAGGGG + Intergenic
1113871808 13:113564546-113564568 GGAAGGTCTGTGGGGTGGGGAGG - Intergenic
1113871833 13:113564623-113564645 GAAGTGGCTGTGGGTTGGGGAGG - Intergenic
1114267962 14:21083796-21083818 GACAGGGATGAGGGGAGGGGTGG - Intronic
1114650971 14:24284459-24284481 GATAGGGCTGAGGGGTCAGGAGG + Intergenic
1115027860 14:28764920-28764942 GAAAAGGTTGGGGGGGGGGGAGG - Intergenic
1115654346 14:35429078-35429100 GAAACGGGGGTGGGGTGGGGTGG + Intergenic
1115873484 14:37833982-37834004 CAAAGTGCTGAGGGGTTGGGGGG - Intronic
1116015039 14:39395890-39395912 GAAAAGGGTGGGGGGGGGGGGGG + Intergenic
1116342863 14:43748290-43748312 CAAAAGGGTGAGGGGTTGGGAGG + Intergenic
1116914252 14:50506981-50507003 GAATTGGCTGAGAGGTGGACAGG - Intronic
1116949334 14:50864478-50864500 TAGATGGGTCAGGGGTGGGGTGG + Intronic
1116952758 14:50894384-50894406 GACATGGAGAAGGGGTGGGGGGG - Intronic
1117419799 14:55533004-55533026 GCACTGGGTGACGGGTGGGGTGG + Intergenic
1117780907 14:59230752-59230774 TAAATGCTTGAGGGGAGGGGTGG + Intronic
1117841922 14:59869829-59869851 GAAAAGGCGGAGGGATGTGGGGG + Intronic
1117963687 14:61186597-61186619 GAAATTGCAGTGGGGTGGGGTGG - Intergenic
1119201226 14:72754233-72754255 GAAGAGGCTGAGGGGTGAGGAGG + Intronic
1120940874 14:89948003-89948025 AAGATGGCAGACGGGTGGGGCGG - Intronic
1120967795 14:90182950-90182972 GAGAAGGCTGATGGGTGGAGGGG - Intronic
1122012358 14:98760661-98760683 GCAATGGGGGAGGGGGGGGGCGG - Intergenic
1122068756 14:99191658-99191680 GAAATGGCAGAGGGGGCAGGGGG + Intronic
1122530262 14:102420450-102420472 GAAATGTCTGATGAGTGGGTTGG - Intronic
1122615714 14:103016423-103016445 GGATTGGCTGGGGTGTGGGGTGG + Intronic
1122879365 14:104683179-104683201 GCAATGGGGGAGGGGAGGGGTGG + Intergenic
1123040513 14:105488411-105488433 GAGGAGGCTGTGGGGTGGGGTGG - Intronic
1124354478 15:28984757-28984779 GAGATGGCAGTGGGGTGGGGGGG - Intronic
1125437461 15:39662160-39662182 GAAAGGGCTGTGAGGAGGGGAGG + Intronic
1126457699 15:48882239-48882261 GAAATGGCTGGGGGATATGGGGG - Intronic
1126792453 15:52233537-52233559 CAAATGTCTGGGGGGTGAGGTGG + Intronic
1127312014 15:57760748-57760770 GTAAGGGCTGGGGAGTGGGGAGG + Intronic
1127817061 15:62620472-62620494 GAAAAGGGTGTGGGGCGGGGAGG - Intronic
1128462976 15:67884972-67884994 GCAAAGGCTGAGGGACGGGGTGG + Intergenic
1128664071 15:69525600-69525622 GAAATGGCCGTTGGGTGGGTGGG - Intergenic
1129007376 15:72385119-72385141 GGAATGGGTGGGGGGTGGGGAGG - Intergenic
1129604096 15:77016376-77016398 GCAGAGGCTGAGGGGTGGGAAGG + Intronic
1129742540 15:77996413-77996435 CGATGGGCTGAGGGGTGGGGGGG + Exonic
1129842939 15:78755043-78755065 CGATGGGCTGAGGGGTGGGGTGG - Intergenic
1129857820 15:78837552-78837574 CAAATGGGGGAGGGGTGGGAGGG + Intronic
1130275156 15:82472578-82472600 GCACTGGCTGCGGGGGGGGGGGG + Intergenic
1130411290 15:83650684-83650706 GAGGTGACTGAGGGGTGGTGAGG + Intergenic
1130467504 15:84199946-84199968 GCACTGGCTGCGGGGGGGGGGGG + Intergenic
1130486125 15:84399306-84399328 GCACTGGCTGCGGGGCGGGGTGG - Intergenic
1130654052 15:85779502-85779524 AAAATGGCTTAGGGGTAGGGAGG + Intronic
1130698904 15:86159183-86159205 GAAATGACTCATGGGTGTGGAGG - Intronic
1131678904 15:94701351-94701373 GAAAGGGGTGGGGGCTGGGGGGG - Intergenic
1132497233 16:269621-269643 GAGCTGGCTGAGAGGTGAGGAGG - Intronic
1132591709 16:728939-728961 GAACAGGCTTCGGGGTGGGGGGG + Intronic
1132755300 16:1481582-1481604 GAATGGGCTGGGGGGTGGGTAGG + Intergenic
1134106120 16:11486862-11486884 TGAATGGATGATGGGTGGGGGGG + Intronic
1134224676 16:12381217-12381239 TAGATGGATGAGGGGTGGGTGGG - Intronic
1134544650 16:15098539-15098561 CAAATGGCTGAAAGGTAGGGAGG - Intronic
1134544854 16:15100175-15100197 CAAATGGCTGAATGGTAGGGCGG + Intronic
1134855339 16:17514043-17514065 GAAATGGCTGAGGCCAGGCGTGG - Intergenic
1135259520 16:20968779-20968801 GAGTTGGGGGAGGGGTGGGGTGG - Intronic
1135362270 16:21825241-21825263 CAAATGGCTGAAAGGTAGGGAGG - Intergenic
1135362484 16:21826892-21826914 CAAATGGCTGAATGGTAGGGAGG + Intergenic
1135490120 16:22901781-22901803 GGAGTGGCTGAGGTGTGGGCGGG - Intronic
1135836077 16:25826485-25826507 GAAATGGGGAAGGGGTTGGGTGG + Intronic
1136081758 16:27856847-27856869 GATTTGGGTGAGGAGTGGGGTGG + Intronic
1136318573 16:29467966-29467988 GAAATGGAGGTGGGGGGGGGGGG - Intergenic
1136403870 16:30032109-30032131 GAAAGGACTGCGGGGTGGGCTGG + Intronic
1136499663 16:30664175-30664197 GAGATGAGTGAGGGGTTGGGAGG - Intronic
1136570409 16:31093419-31093441 CACCTGGCAGAGGGGTGGGGTGG + Exonic
1136777492 16:32879591-32879613 GTCATGGCTGAGGGCTGGGCTGG - Intergenic
1136893132 16:33981923-33981945 GTCATGGCTGAGGGCTGGGCTGG + Intergenic
1137529738 16:49271217-49271239 GGAGTGGTAGAGGGGTGGGGTGG - Intergenic
1137558956 16:49490863-49490885 GAAGGGGGTGGGGGGTGGGGGGG + Exonic
1137674613 16:50298140-50298162 GACAGGGCTTAGGGGTGGGGAGG - Intronic
1137874682 16:51984622-51984644 GAAAGTGATGAGGGGTGGTGAGG + Intergenic
1138096824 16:54218556-54218578 GAGTTGGTTGGGGGGTGGGGTGG + Intergenic
1138113305 16:54341092-54341114 AAAATTGCTGGGGCGTGGGGAGG - Intergenic
1138122535 16:54411964-54411986 AAAATGGGGGTGGGGTGGGGGGG + Intergenic
1138401246 16:56746151-56746173 TAATGGGCGGAGGGGTGGGGTGG + Intronic
1138503617 16:57464665-57464687 GAAGTGACTGGGGGGCGGGGGGG - Intronic
1138553729 16:57760515-57760537 GAGAGGCCTGAGGGATGGGGTGG + Intronic
1138573440 16:57890963-57890985 GAGAAGGCTGAGGTGTGGGTGGG - Intronic
1138615488 16:58162093-58162115 GGGAGGGCTGAGGAGTGGGGTGG + Intronic
1139218022 16:65148502-65148524 GAAATGATTTAGGGGTGGGATGG + Intergenic
1139328229 16:66168015-66168037 GAGAAGGCTGAGAGGAGGGGAGG + Intergenic
1139514520 16:67445405-67445427 GGAAAGGCTGAGGAGTGGAGTGG + Intronic
1142064218 16:88051291-88051313 GAAAAGATTGAGGTGTGGGGCGG + Intronic
1203079905 16_KI270728v1_random:1141700-1141722 GTCATGGCTGAGGGCTGGGCTGG - Intergenic
1142708198 17:1709651-1709673 GAACTGGGAGAGGGGCGGGGCGG - Intronic
1142955977 17:3522556-3522578 CAAAGTGCTGGGGGGTGGGGGGG - Intronic
1143290779 17:5826259-5826281 GAAGTGTCTGAGGGGCAGGGAGG + Intronic
1143360274 17:6363805-6363827 GACCTGGCTGAGGGGTAGGCAGG - Intergenic
1143528108 17:7483981-7484003 GTAATGGCGGCGGGGCGGGGCGG - Intronic
1143684298 17:8501624-8501646 GAAATGGCTTAAGGTTGGGGAGG + Intronic
1143989202 17:10942333-10942355 GTAAGGGATGAGAGGTGGGGTGG + Intergenic
1144486808 17:15673218-15673240 GAAATTGAAAAGGGGTGGGGAGG - Intronic
1144572332 17:16407716-16407738 GATGGGGGTGAGGGGTGGGGGGG + Intergenic
1144914214 17:18709077-18709099 GAAATTGAAAAGGGGTGGGGAGG + Intronic
1145252277 17:21303163-21303185 GATCTGGCGGTGGGGTGGGGAGG - Exonic
1145797500 17:27664353-27664375 GACAAGGCTCAGGGGTTGGGAGG - Intergenic
1145966604 17:28923268-28923290 CAAATGGCAGACGGGTGGGAGGG + Intronic
1146489976 17:33273860-33273882 GAAATGACTGGGGGAGGGGGAGG + Intronic
1146655167 17:34630781-34630803 GAAGGAGCTCAGGGGTGGGGTGG - Intronic
1147249514 17:39144665-39144687 GGAGTGGCTGAGGGTTGGGCAGG - Intronic
1147585643 17:41652750-41652772 GCAGAGGCTGAGGGATGGGGTGG - Intergenic
1147890017 17:43710557-43710579 GAAATGGCTGAGTAGGGTGGTGG + Intergenic
1147918853 17:43904292-43904314 GGAATGGCTGAGTGGTAGGGTGG + Intronic
1147998471 17:44374567-44374589 GAAAAGTCTGAGGGGTGGTACGG - Intronic
1148103458 17:45106702-45106724 GAAATGGCTAATGGGTTGGAAGG - Exonic
1148196415 17:45716452-45716474 GAAGTTGCTGGGGGGTGGGGTGG + Intergenic
1148214055 17:45824916-45824938 GGATGGGCTGGGGGGTGGGGCGG - Intronic
1148323160 17:46769622-46769644 GAAGTGGCTGTGGGGTGGGGAGG + Intronic
1148346391 17:46906185-46906207 GACCAGGCTGATGGGTGGGGTGG + Intergenic
1148457144 17:47817112-47817134 GACATGGGTAAGGGGTGGGGAGG + Intronic
1148601216 17:48895596-48895618 GGAAGGGGTGAGGGGAGGGGAGG - Intronic
1148647191 17:49225821-49225843 GAAAAGGCAGAGGAGTGGGAGGG + Intronic
1148682856 17:49484636-49484658 GAAGGGGAGGAGGGGTGGGGAGG - Intergenic
1148746635 17:49921971-49921993 GAAATGGATGCGTGGTGGGATGG - Intergenic
1148858812 17:50593478-50593500 GAAAGGGCTGAGTGCTGGGGAGG - Intronic
1148869700 17:50649611-50649633 GAGAGAGATGAGGGGTGGGGAGG + Intronic
1148913999 17:50959246-50959268 AAAATGGGGGGGGGGTGGGGTGG + Intergenic
1150039344 17:61842275-61842297 GGAAGGGGTGAGGGGAGGGGAGG + Intronic
1151560256 17:74866077-74866099 CCAAGGGCTGAGGGGCGGGGAGG + Intronic
1151988008 17:77556420-77556442 GAGCTGGCTGAGAGGTGGGCAGG - Intergenic
1152207517 17:78982262-78982284 GAAGGGGCTGGGGGGAGGGGTGG - Intergenic
1152270870 17:79324164-79324186 GAAAGGGCTGAGGGATGAGAAGG + Intronic
1152671963 17:81613833-81613855 GGAATGGCTGAGGGAGGTGGGGG - Intronic
1154000145 18:10475783-10475805 AAGATGGCTGAGGGGGGGGGGGG + Intronic
1156128307 18:33935440-33935462 GTGATGGCTGGTGGGTGGGGTGG + Intronic
1156462103 18:37326829-37326851 AAAGTGGCAGAGGGATGGGGAGG - Intronic
1157166554 18:45363064-45363086 GATTTGGCCGAGGGTTGGGGGGG - Intronic
1157418458 18:47525876-47525898 TGAAAGGCTGAGGGGAGGGGTGG - Intergenic
1157528747 18:48405098-48405120 GGAATGGGGGTGGGGTGGGGTGG - Intronic
1158068687 18:53444533-53444555 GGAATTGCTGAAGGGTGGGGTGG - Intronic
1158421410 18:57298051-57298073 CAAATGGATGAGAGGTGGGATGG - Intergenic
1158578470 18:58660752-58660774 CAACTAGATGAGGGGTGGGGTGG - Intergenic
1158720328 18:59918774-59918796 GTACTGGCTGAGGAGTGAGGAGG + Intergenic
1158887003 18:61838083-61838105 TAAAGGGCTGAGGGTTTGGGAGG - Intronic
1160165127 18:76504431-76504453 GATGTGGGGGAGGGGTGGGGCGG - Intergenic
1160579060 18:79873424-79873446 GAGGTGGCTGGGGGGGGGGGAGG - Intronic
1160714627 19:570663-570685 GGAGGGGCGGAGGGGTGGGGTGG + Intergenic
1160744281 19:703572-703594 GACATGGCTCAGGGTTGGGGTGG + Intergenic
1160960667 19:1719221-1719243 GACCACGCTGAGGGGTGGGGAGG + Intergenic
1160965758 19:1746268-1746290 GAAATGGAGGAGGAGTGGGGAGG + Intergenic
1161069750 19:2254150-2254172 GGCATGGGTGAGGTGTGGGGTGG - Intronic
1161093840 19:2377485-2377507 GGAAGGGGAGAGGGGTGGGGGGG - Intergenic
1161331317 19:3688943-3688965 GATGGGGCTGGGGGGTGGGGGGG + Intronic
1161335166 19:3709039-3709061 GAACAGGGTGAGGGGTTGGGGGG - Intronic
1161631185 19:5356593-5356615 GTGGTGGCTGAGGGGTGGGGTGG + Intergenic
1161994950 19:7706281-7706303 GAAAGGGTGCAGGGGTGGGGAGG + Intergenic
1163124453 19:15237237-15237259 CAAATGGGTGGGGGGGGGGGGGG + Exonic
1163366489 19:16878598-16878620 GGACTGGCTGATGGGTGAGGAGG + Exonic
1163414975 19:17180911-17180933 CAAATCGCTGAGGGGAGGGGTGG - Exonic
1163634460 19:18431711-18431733 GAAAGGGATGAGGGGAGGGCGGG + Intronic
1163677751 19:18663746-18663768 GAAATAGCAAAGGGGTGGTGGGG + Intronic
1164084672 19:21890098-21890120 GAAAGTGGTGGGGGGTGGGGGGG - Intergenic
1165835199 19:38750803-38750825 GACATGGAGAAGGGGTGGGGGGG - Intronic
1165872063 19:38980137-38980159 AAAATAGATGAAGGGTGGGGAGG - Intergenic
1165914571 19:39249875-39249897 GAGTTAGCTGTGGGGTGGGGAGG - Intergenic
1166067528 19:40368734-40368756 GAGATGGTTGAGGGGAGGTGGGG - Intronic
1166109013 19:40611564-40611586 AAAAGGGAGGAGGGGTGGGGAGG - Intronic
1166141177 19:40806231-40806253 GAAATGGCTGAGGTGGGGTTTGG + Intronic
1166324496 19:42040989-42041011 GACCTGCCTGTGGGGTGGGGTGG + Intronic
1166338123 19:42121497-42121519 GTGGTGGCTGAGGGATGGGGTGG - Intronic
1166408482 19:42540496-42540518 GGGATGGGTGAGGGGTGGTGTGG + Intronic
1166552376 19:43674710-43674732 GAAATGGGTCTGGGGTGGGTAGG + Intergenic
1166560108 19:43727190-43727212 GAACTGGCTGAGGGCTGGCTGGG - Intergenic
1167214469 19:48155184-48155206 GGAAGGGCTGTGAGGTGGGGAGG - Intronic
1167412323 19:49352070-49352092 GAAGAGGCTGAGGGGTTGGGAGG + Intronic
1167567065 19:50263280-50263302 GAAATGGGTGAGGGGCAGAGTGG - Intronic
1167900989 19:52622132-52622154 GAACTGGGTGTGGGGAGGGGAGG - Intronic
1168083796 19:54029989-54030011 GAAATGGGGGAGGGGGGGAGAGG + Intergenic
1168239178 19:55080724-55080746 GAAGTGGGTGCGGCGTGGGGAGG + Intronic
1168559376 19:57370488-57370510 GAAATGCCTGTGGTGTGGGCTGG + Intronic
1168562542 19:57396082-57396104 GAAATGCCTGTGGTGTGGGCTGG + Intronic
1202637672 1_KI270706v1_random:56112-56134 TAGATGGTTGGGGGGTGGGGAGG - Intergenic
925147550 2:1591297-1591319 GAAATGGCAGAGTGGAGGAGGGG + Intergenic
925455695 2:4014733-4014755 GTAGTGGCGGTGGGGTGGGGTGG + Intergenic
925849731 2:8068688-8068710 CCAAGGGATGAGGGGTGGGGAGG - Intergenic
925913728 2:8589618-8589640 GAAAAGGGAGAGGGGAGGGGAGG + Intergenic
925913776 2:8589728-8589750 GAAAGGGGAGAGGGGAGGGGAGG + Intergenic
925913786 2:8589750-8589772 GAAAGGGGAGAGGGGAGGGGAGG + Intergenic
925913796 2:8589772-8589794 GAAAGGGGAGAGGGGAGGGGAGG + Intergenic
925913806 2:8589794-8589816 GAAAGGGGAGAGGGGAGGGGAGG + Intergenic
925913816 2:8589816-8589838 GAAAGGGGAGAGGGGAGGGGAGG + Intergenic
926568031 2:14499296-14499318 TAAATGGCTGAGGGTTTGGTTGG - Intergenic
926904444 2:17792819-17792841 GAAGGGCTTGAGGGGTGGGGGGG - Intronic
927225477 2:20760941-20760963 GAAAGAGCTTAGGGGTGTGGCGG - Intronic
927649528 2:24903677-24903699 GAAGTGGGTGAGGGGCGGGGAGG + Intronic
927681834 2:25144867-25144889 GCAAAGGCAGAGGGGTAGGGAGG + Intronic
927713635 2:25340352-25340374 GAAATGGCAGAGGGGCGCTGGGG + Intronic
929654575 2:43717576-43717598 GGTATGGCTGAGGGGATGGGTGG + Intronic
929801953 2:45111917-45111939 GAGAAGGCTAGGGGGTGGGGTGG + Intergenic
929875710 2:45794846-45794868 GAAATGGTGGATGGGGGGGGGGG - Intronic
930611667 2:53551230-53551252 GAAGTGGGGGTGGGGTGGGGGGG + Intronic
930736745 2:54787280-54787302 GAGATGGGTGAGGGTTGGGGGGG + Intronic
930828299 2:55716379-55716401 GTAAAGGCTGAGGGGAAGGGGGG + Intergenic
931166881 2:59757985-59758007 GTAATGGCTGGGGGGGTGGGCGG + Intergenic
931252743 2:60548954-60548976 TAAATGGCTGAGGGTTAGGAAGG - Intronic
931261118 2:60620207-60620229 AAAAAGGCAGTGGGGTGGGGAGG + Intergenic
931797030 2:65721211-65721233 GAGTTGGCTTGGGGGTGGGGTGG + Intergenic
932147849 2:69339636-69339658 GAGATGGGTGAGAGATGGGGAGG - Intronic
932328954 2:70886676-70886698 GGAGTGGGTGAGGGGTGTGGGGG - Intergenic
932356895 2:71074592-71074614 TAAATGTCTGAGGGGGTGGGTGG - Intronic
932493247 2:72134357-72134379 GAAAAGGCTGGGGGTGGGGGAGG + Intronic
932583759 2:73009358-73009380 GCAGTGGCCCAGGGGTGGGGAGG + Intronic
933695290 2:85213015-85213037 GAAGTGGGTGAGGTGTGGGGTGG + Intronic
933697512 2:85230859-85230881 GAAAAGCCTGAGGGGATGGGTGG + Intronic
934496817 2:94809785-94809807 GAAATAGCTGCCGGGTGTGGTGG - Intergenic
935295329 2:101644272-101644294 GAAATGGCTGGTCAGTGGGGTGG + Intergenic
935860205 2:107321258-107321280 GAAATTGCTGAGGGGCTGGGCGG - Intergenic
936972180 2:118186446-118186468 GAACTGGCGGAGGGGTGGGCAGG - Intergenic
937049314 2:118875605-118875627 GACAGGGCTGGGGTGTGGGGAGG - Intergenic
937152493 2:119695555-119695577 GCAAGGGCAGAGAGGTGGGGAGG + Intergenic
937228792 2:120384860-120384882 GATTTGGCTGAGGCCTGGGGAGG - Intergenic
937356117 2:121199207-121199229 GGTATGGCGGAGGGGTGTGGGGG - Intergenic
937856630 2:126676747-126676769 GATGTGGCAGAGGGGTGGTGGGG + Intronic
938064469 2:128273582-128273604 GACAAGGCAGAGGGGAGGGGAGG - Intronic
938090176 2:128426168-128426190 GGAAGGGCTGAGGGCTGGGTGGG - Intergenic
939738874 2:145881496-145881518 GAAATTGTTGTGGAGTGGGGTGG + Intergenic
940111199 2:150156135-150156157 CACAGGGCTGAGGGGAGGGGTGG + Intergenic
940897197 2:159092161-159092183 GAAGTGGCTGAGGTGGGGTGGGG - Intronic
941946015 2:171097940-171097962 GAAAGGGGAAAGGGGTGGGGCGG + Intronic
941983347 2:171484749-171484771 GTTATACCTGAGGGGTGGGGAGG - Exonic
942085742 2:172442172-172442194 GCAATGAATGAGGGGTGTGGCGG - Intronic
942189229 2:173454639-173454661 GAAATGGCGGAGGGTTGGAGGGG - Intergenic
942396439 2:175554866-175554888 GAAAAGGTGGAGGGGTGGGTGGG + Intergenic
942396723 2:175557488-175557510 GAAATGGCGGTAGGGTAGGGGGG + Intergenic
943142239 2:183997518-183997540 GAAAATGCTGGGGGGTGGGGAGG - Intergenic
943380691 2:187142334-187142356 AAAATGGCTGAGGCATGGAGGGG + Intergenic
944025121 2:195155634-195155656 CATATGGTTGTGGGGTGGGGTGG - Intergenic
944189306 2:196984289-196984311 ACAATGGCTGGGGGGTGGGCAGG - Intronic
944229040 2:197375119-197375141 AAAATGGCTGAGCAGAGGGGAGG + Intergenic
944369206 2:198961993-198962015 GAACAGGCTGAGGCTTGGGGAGG - Intergenic
944504896 2:200401240-200401262 GAGATGGATGGTGGGTGGGGAGG - Intronic
944507226 2:200425129-200425151 CAAATGGCGGGGGGGGGGGGGGG - Intronic
945206259 2:207335321-207335343 GGCCTGGCTGAGGGGAGGGGAGG + Intergenic
945490804 2:210452492-210452514 CAAATGGCTGGGGAGTGGAGGGG - Intronic
945907481 2:215611495-215611517 AAAATGGCTGATGGGGGGGGGGG + Intergenic
946419279 2:219555966-219555988 GAAAAGGCTGTGGTGTAGGGTGG + Intronic
947156079 2:227164277-227164299 GAGGTGGCTGCGCGGTGGGGAGG - Intergenic
947452367 2:230220546-230220568 AAAATGGCTGAGAGCTGGGCAGG + Intronic
947871246 2:233440003-233440025 GAAATGGCTGTGGGCAGGGCAGG + Intronic
948150929 2:235744227-235744249 GGAAGGACTGAGGGGTGGGGAGG + Intronic
948760300 2:240186111-240186133 GAAAAGGTTGAGGGGTGCAGTGG + Intergenic
1168780047 20:481484-481506 CAATTGGGTGGGGGGTGGGGGGG - Exonic
1170269452 20:14507904-14507926 GAAATTTCTGAGGGCTGGAGTGG + Intronic
1170643045 20:18172858-18172880 GAAATGGGGGAGGTGTGGGCAGG + Intronic
1170812357 20:19684445-19684467 GAAATGGCTGAGGGATGCTGCGG - Intronic
1171995289 20:31726011-31726033 GGGATGGCTGAGGGGAGTGGTGG + Intergenic
1172117169 20:32579903-32579925 AAGATGGGTGTGGGGTGGGGAGG - Intronic
1173123559 20:40316157-40316179 CAAATGGCTCAGGGATGGGTGGG + Intergenic
1173220214 20:41126202-41126224 GAAAGGGCTGAGGGTTGTGAAGG - Intergenic
1173561835 20:44011617-44011639 CAGATGGCTGAGGGATGGTGCGG + Intronic
1173767155 20:45623019-45623041 GAAATGGCTCAGGAGTGAGGGGG + Intronic
1174127134 20:48314976-48314998 GGCATGGCTAGGGGGTGGGGAGG + Intergenic
1174177962 20:48656969-48656991 GTGGTGGCTGAGGGCTGGGGTGG - Intronic
1174438062 20:50526050-50526072 AAAATGCCTGAGGGGTGCGGGGG + Intronic
1174498228 20:50964915-50964937 ATAATGGCTGGGGGCTGGGGTGG + Intergenic
1174513427 20:51073177-51073199 CAAATGGCTCATGGGTGTGGGGG + Intergenic
1175091445 20:56507753-56507775 TAAAGGGCCCAGGGGTGGGGAGG - Intronic
1175185550 20:57177775-57177797 GAACTTGCTGAAGGCTGGGGCGG + Intronic
1175267608 20:57711881-57711903 GAAATGGCTGAAAGCAGGGGTGG - Intergenic
1175891540 20:62318115-62318137 GAAAGGGATGAGGATTGGGGAGG + Intronic
1175985049 20:62760465-62760487 GAGATGGGGGAGGGGTGGGGAGG - Exonic
1176020118 20:62958531-62958553 GGAACTGCTGATGGGTGGGGTGG - Intronic
1176154124 20:63609441-63609463 GAAATGGATGTGGGGTGAGAGGG - Intronic
1176154158 20:63609610-63609632 GAAATGGATGTGGGGTGAGAGGG - Intronic
1176249599 20:64114073-64114095 GAGAGGGGTCAGGGGTGGGGTGG + Intergenic
1176296362 21:5075511-5075533 AGAAAGGATGAGGGGTGGGGAGG - Intergenic
1177210946 21:18070022-18070044 GAAATGGGTGGGGGGGGGGAGGG - Intronic
1177404625 21:20649134-20649156 GTAGTTGCTGAGGGTTGGGGTGG - Intergenic
1177412578 21:20749348-20749370 GTGGTGGATGAGGGGTGGGGAGG + Intergenic
1177501299 21:21959541-21959563 GAAAAGGGTGTGGGGTGGTGAGG + Intergenic
1177739528 21:25136786-25136808 GAAGTGGCTGGGGGGTAAGGAGG - Intergenic
1177848823 21:26322582-26322604 GAATTTGCTGATGGATGGGGTGG + Intergenic
1178035725 21:28580451-28580473 CAAATGGGTGGGGAGTGGGGTGG - Intergenic
1178740431 21:35195137-35195159 GAAATGCATGAGAGGTGGAGAGG - Intronic
1178822085 21:35984463-35984485 GAAGTGGGGGTGGGGTGGGGAGG + Intronic
1178835205 21:36091520-36091542 GAAAAGGCTGAGTCTTGGGGAGG - Intergenic
1179498421 21:41790616-41790638 GGAATGGGGGAGGGATGGGGAGG + Intergenic
1179860687 21:44186610-44186632 AGAAAGGATGAGGGGTGGGGAGG + Intergenic
1180125608 21:45788189-45788211 CAGATGGGTGAGGGATGGGGAGG + Intronic
1180143794 21:45908830-45908852 GAGAAGGCTGAGGTGGGGGGCGG - Intronic
1180755117 22:18155760-18155782 CCCATGGCTGCGGGGTGGGGAGG - Intronic
1180937425 22:19634779-19634801 GACATGGCAGCGGGATGGGGAGG + Intergenic
1181527070 22:23496107-23496129 GAAAGGGCTGAATGGTGGGGTGG - Intergenic
1181641491 22:24202467-24202489 GAAAAGGCAGAGGGGCTGGGAGG - Intergenic
1182751207 22:32643542-32643564 GAAATGGTGGGGGGGCGGGGGGG + Intronic
1183815140 22:40293600-40293622 GGAATGCCTGAGGGCGGGGGCGG + Intronic
1184257025 22:43293113-43293135 GACATGGCTGAGGCTTGGAGGGG - Intronic
1184266245 22:43348081-43348103 CAAAGGGCTGAGGGGCGTGGGGG + Intergenic
1184643714 22:45885287-45885309 AAATTCGCTGAGGGGAGGGGCGG - Intergenic
1184781971 22:46654156-46654178 GAGGTGGCTGGGGGGTAGGGTGG + Intronic
1184875305 22:47270514-47270536 TAATTGGCTGGGGGGTAGGGGGG + Intergenic
1184911838 22:47540369-47540391 GGACTGGCTGGGGGGGGGGGCGG - Intergenic
1184980877 22:48095550-48095572 GAACATGCTGAGGGCTGGGGAGG + Intergenic
1185019181 22:48363835-48363857 GGAATGGGTGAGAGGTGTGGTGG - Intergenic
1185079458 22:48701695-48701717 GAAAGGGCTGAGATGTGGGCGGG - Intronic
1185182841 22:49372997-49373019 GAAAGGGCAGAGCTGTGGGGAGG + Intergenic
1185261954 22:49871710-49871732 CAGATTGCTGAAGGGTGGGGTGG + Intronic
949207161 3:1453981-1454003 TCCATGGATGAGGGGTGGGGAGG + Intergenic
950620665 3:14202843-14202865 GAAATGGGTGAGGAGATGGGAGG + Intergenic
950706523 3:14785850-14785872 GGGAAGGCTGAGGGGTGGAGTGG - Intergenic
951082649 3:18469935-18469957 CAACTGGCTGGGGGGTGGGGAGG - Intergenic
951499456 3:23367761-23367783 GCAAAGGCGGAGGGGTGGGAGGG + Intronic
952324540 3:32309169-32309191 GAAATGGGTGGAGGGTGGTGGGG + Intronic
952711012 3:36432086-36432108 GATATGGCAGAGGTGTGGTGGGG + Intronic
952942234 3:38453946-38453968 GAACGGGGGGAGGGGTGGGGGGG - Exonic
953150277 3:40318391-40318413 GAGATAGCTGGGGGGTGGGGGGG + Intergenic
953781437 3:45874571-45874593 AGAATGGCTGAGTGGTGGGAAGG - Intronic
953879048 3:46682127-46682149 GAGGTTGCTGAGGGGTGGGTAGG - Intronic
953991821 3:47489769-47489791 GAAAGGGGTGGGGGGAGGGGGGG - Intergenic
954453064 3:50582121-50582143 GGACTGGCTGAGGTGTAGGGGGG - Exonic
954800884 3:53186363-53186385 GACATGGCTGTGGCATGGGGTGG - Intronic
954907407 3:54074603-54074625 GAAATGGTTTAGGGTAGGGGAGG - Intergenic
956420456 3:69081450-69081472 CAGAAGGCTGAAGGGTGGGGTGG - Intergenic
956823376 3:72973702-72973724 GAATTGGATGAGGGTTGTGGGGG + Intronic
957150021 3:76475011-76475033 GAAAAGGCTGAGGAATGGGGAGG + Intronic
957499501 3:81035397-81035419 GGGATGGATGAGGGGTGAGGAGG - Intergenic
958440985 3:94155550-94155572 GAAATGGCTAAGAGGAGGGGTGG - Intergenic
958620532 3:96552502-96552524 GAAGGGGCTGAGGGTTGAGGAGG - Intergenic
960038729 3:113127797-113127819 AAAATGTCTGGGGTGTGGGGTGG - Intergenic
960131864 3:114065379-114065401 GTGATGGGTGAGGTGTGGGGCGG - Exonic
960513476 3:118577642-118577664 GAAAGGGTTGAAGGGTAGGGAGG + Intergenic
960628261 3:119702686-119702708 AAAAGGGCTGGGGGGAGGGGCGG + Intergenic
960844715 3:121994972-121994994 GGAATTTCTCAGGGGTGGGGTGG + Intronic
961095366 3:124150530-124150552 GAATTTGTTGTGGGGTGGGGAGG - Intronic
961109918 3:124275262-124275284 GAAATGGATTGGGGTTGGGGTGG - Intronic
961810129 3:129517432-129517454 GAAAGGGCTGAGGGGGCTGGAGG - Intronic
962034949 3:131642005-131642027 GGAAAGGGTGAGGGGTGGCGAGG + Intronic
962386947 3:134939366-134939388 GTAATGAATGGGGGGTGGGGGGG + Intronic
962674880 3:137748341-137748363 GAATAGGCTGAGGGGAGGGAAGG - Intergenic
962928462 3:140016128-140016150 GGCATGGCTGTGGGGTGGGTGGG + Intronic
963274340 3:143315340-143315362 GACAGGGCTGATGGGTGGTGAGG + Intronic
964074245 3:152674005-152674027 GAAAGCGGTGGGGGGTGGGGGGG - Intergenic
965321437 3:167256611-167256633 GAAAGGGTAGTGGGGTGGGGTGG - Intronic
965777527 3:172247599-172247621 GACATGGCTGAGGGGTAGCTTGG - Exonic
966201250 3:177361413-177361435 GAAATGGGGGTGGGGTGGGAGGG - Intergenic
966454762 3:180102336-180102358 TAAATTCCTGAGGGGAGGGGCGG + Intergenic
966786818 3:183629927-183629949 AAAATGGGGTAGGGGTGGGGTGG + Intergenic
967251706 3:187546726-187546748 TAAATACCTGAGAGGTGGGGAGG + Intergenic
967858164 3:194134017-194134039 GGAAGGGCTGAGGGGGCGGGAGG + Intergenic
968136681 3:196224751-196224773 GGAATGGGAGAGGGGAGGGGAGG + Intronic
968190401 3:196663056-196663078 GCAATGGGGGAGGGATGGGGAGG + Intronic
968287474 3:197517404-197517426 GAAATGACTGATGGGGTGGGGGG - Intronic
969254419 4:5992602-5992624 GACCTGGATGGGGGGTGGGGAGG - Intergenic
969495660 4:7524780-7524802 GCAGTGGCGGCGGGGTGGGGAGG - Intronic
969546443 4:7832515-7832537 AAAAGGGCTCAGGAGTGGGGTGG - Intronic
969689523 4:8696547-8696569 GCATGGGCTGAGGGGTGGGCAGG - Intergenic
969759549 4:9172201-9172223 GCAATCCCTGAGGGGTGGGGGGG + Intronic
969939066 4:10712299-10712321 TATATGGATCAGGGGTGGGGTGG + Intergenic
971396008 4:26228076-26228098 GAAATGGTTAAGGGATGGGTGGG - Intronic
971464206 4:26937398-26937420 GAAAAGGCTGAGGGAAGGAGTGG - Intronic
972503534 4:39698699-39698721 AATGTGGCTGTGGGGTGGGGAGG + Intronic
973277660 4:48327026-48327048 GATATGGGTGAGGGGTGGAGAGG - Intergenic
973393140 4:49572951-49572973 TAGATGGTTGGGGGGTGGGGAGG + Intergenic
973971587 4:56218507-56218529 GAAATGAGGGAGGGGAGGGGAGG - Intronic
973993815 4:56436540-56436562 GAAATGGCCAAGGGGTGGAAAGG + Intronic
974586300 4:63883079-63883101 GAAGGGGATGGGGGGTGGGGAGG - Intergenic
975331238 4:73116201-73116223 GATATGTCTGAAGGGTGGTGGGG + Intronic
975395652 4:73870308-73870330 GGAATGGGGGTGGGGTGGGGCGG - Intronic
975983259 4:80182821-80182843 AAGACAGCTGAGGGGTGGGGAGG + Intergenic
977809817 4:101346473-101346495 CAAATGGCTGAGCCGCGGGGAGG - Intronic
979283099 4:118889340-118889362 GCAATCGATGAGGGGTGGGTGGG + Intronic
979783090 4:124680823-124680845 GAAATAGCTGGGGGTAGGGGAGG + Intronic
981191399 4:141869003-141869025 GAATTGGCTGATTGATGGGGAGG + Intergenic
982124902 4:152176021-152176043 GAAAAGCCTGAAGGGTGGGGTGG - Intergenic
982288897 4:153760284-153760306 GAAATGGCGGTGGGGGGGCGAGG + Intergenic
982702323 4:158671352-158671374 GAAACCAGTGAGGGGTGGGGCGG + Intronic
983199930 4:164850442-164850464 GAAATGGCTGAGGAGGGTGATGG + Intergenic
983235679 4:165176784-165176806 GAAACGGATGAGGGGAGGGATGG + Intronic
984157660 4:176211221-176211243 GAAATGGCACAGGAGTTGGGGGG + Intergenic
984638626 4:182140991-182141013 CAAAGGGCTGGGGGGCGGGGGGG - Intergenic
984694721 4:182767975-182767997 AAAATGACAGAGGTGTGGGGAGG + Intronic
984811598 4:183800054-183800076 GAACTGCCTGGGGGGTGGGGTGG + Intergenic
985505981 5:280559-280581 GCCAGGGCAGAGGGGTGGGGAGG + Intronic
985559332 5:574579-574601 AAATTGGCTGGGGGCTGGGGAGG - Intergenic
985891823 5:2721852-2721874 GAAAGGGCTGAGGGAGAGGGAGG + Intergenic
986215495 5:5715562-5715584 GAAATGACAGAGGGGTGGGGTGG + Intergenic
986384174 5:7215636-7215658 GAAATTGTTGAGGGGAAGGGTGG - Intergenic
987004200 5:13692607-13692629 GATTTAGCTGGGGGGTGGGGAGG - Intronic
987258500 5:16180233-16180255 GAACTGGCTGAGCAGTGGAGCGG + Intronic
990173184 5:53078009-53078031 GAAATGAGTGAGGAGAGGGGAGG + Intronic
990497221 5:56360528-56360550 GAAAGGGCTGAGGGTTGGACAGG - Intergenic
991003086 5:61802594-61802616 GAAATGATGCAGGGGTGGGGTGG + Intergenic
992251248 5:74877973-74877995 GAAATGGATTAGTGCTGGGGTGG + Intergenic
994009622 5:94885600-94885622 GAAAGGCCAGCGGGGTGGGGTGG - Intronic
995015416 5:107303973-107303995 GGAAAGGCTGAGGGGTGGTCGGG + Intergenic
996272912 5:121630025-121630047 GGAAAGGGTGGGGGGTGGGGAGG - Intergenic
996416635 5:123217758-123217780 GAAAGGGAGGAGGGGAGGGGTGG + Intergenic
996483895 5:124008022-124008044 GAAATAGCAGTGGGGAGGGGGGG - Intergenic
996559334 5:124811720-124811742 GAAAGCAATGAGGGGTGGGGTGG + Intergenic
996743492 5:126824837-126824859 GAAAGGGTGGGGGGGTGGGGTGG - Intronic
996815116 5:127565876-127565898 GACAATGCTGAGGGGAGGGGAGG - Intergenic
997246829 5:132356872-132356894 GTAATGGCGGGGGGCTGGGGTGG + Intergenic
998003279 5:138640886-138640908 TGGAAGGCTGAGGGGTGGGGAGG + Intronic
998147853 5:139740397-139740419 GAAATGGGTAGGGGGTAGGGAGG + Intergenic
998214442 5:140226845-140226867 GAGAAGGCCAAGGGGTGGGGTGG + Intronic
998371063 5:141661798-141661820 GGAATGGAGGAGGGTTGGGGAGG + Intronic
998449141 5:142220856-142220878 GATTTGGCTGTGGGGTGGGTGGG + Intergenic
998457901 5:142287830-142287852 GAAAAGGCTGGCGGGTGGTGGGG + Intergenic
998551134 5:143079183-143079205 GAAATGGTAGAGGGATGGGAGGG + Intronic
999101066 5:149026718-149026740 GAAATGGCAGAGGGATTTGGTGG + Exonic
999129368 5:149271524-149271546 GAGCCGGCTGAGGGGTGCGGTGG + Intergenic
999135495 5:149316120-149316142 GAAATGGGTCAGGGGAGTGGAGG - Intronic
999285754 5:150393318-150393340 GTTATGGCAGTGGGGTGGGGTGG + Intronic
999297477 5:150468657-150468679 GTACAGCCTGAGGGGTGGGGCGG - Intergenic
1000267657 5:159653160-159653182 GAGATGGGTGAGGGGCAGGGAGG - Intergenic
1000388372 5:160697586-160697608 GAAATGTATGCAGGGTGGGGTGG + Intronic
1000633008 5:163612534-163612556 GAAATGGTGGCAGGGTGGGGGGG - Intergenic
1001154017 5:169257387-169257409 TAAATGGTTGTGGGGCGGGGTGG - Intronic
1001155609 5:169270083-169270105 GCAATGGCTGAGGAGAGGGCGGG - Intronic
1001252725 5:170159982-170160004 TAAAAGGCCAAGGGGTGGGGGGG - Intergenic
1001668109 5:173450286-173450308 GCATTGGATGAGGGGTGGGCAGG + Intergenic
1001740958 5:174052291-174052313 GCAGTGGCAGTGGGGTGGGGAGG + Intronic
1002050600 5:176568528-176568550 GACTTGGCTGATGGTTGGGGAGG + Intronic
1002169182 5:177366006-177366028 GAACTGGCTGAGTGGGAGGGAGG + Intronic
1002283681 5:178148359-178148381 GACTTGGCTGAGGGCAGGGGTGG - Exonic
1002350835 5:178582652-178582674 GAAAATGCTGAGGGCTGGAGGGG - Intronic
1002412928 5:179098025-179098047 AAAATGGCTGAAAGGTGAGGAGG + Intergenic
1002558493 5:180063017-180063039 GAAATGACCTGGGGGTGGGGAGG + Intronic
1003207594 6:4027585-4027607 TATTTGGCGGAGGGGTGGGGGGG + Intronic
1003727634 6:8783571-8783593 GTAAAGGCTGGGAGGTGGGGAGG - Intergenic
1004314351 6:14572856-14572878 GAGATGGGGGCGGGGTGGGGAGG + Intergenic
1004373112 6:15069478-15069500 GTAGTGGCTGTGGGGTGGAGAGG + Intergenic
1004757974 6:18633893-18633915 GAATTGCCTGAGTGTTGGGGTGG + Intergenic
1004914674 6:20320531-20320553 CCAAGGGCTGAGGAGTGGGGGGG + Intergenic
1005331541 6:24755573-24755595 AAAATGGCTGGGGGGTGGGTAGG - Intergenic
1005737105 6:28758004-28758026 GAAATGCCCGGGGGGCGGGGGGG + Intergenic
1005772638 6:29091003-29091025 GAAGCAGCTGAGGGCTGGGGCGG + Intergenic
1006734549 6:36263742-36263764 GAGATAGCAGAGGGCTGGGGTGG + Intronic
1007589781 6:43014120-43014142 GAGAGGGCTGAGGAGTGGGCAGG - Intronic
1008267302 6:49444280-49444302 AAAATGGCTGTGGGGTGGGGAGG - Intronic
1008410112 6:51167655-51167677 TCAATGGCTGACTGGTGGGGTGG + Intergenic
1008581778 6:52914426-52914448 GAGTTGCCTGAGGGGTGGGTAGG - Intergenic
1008999154 6:57693078-57693100 TAAATGGTTGGGGGGGGGGGTGG + Intergenic
1009498991 6:64387139-64387161 GAAAGGTCTGAGGGATGGGGAGG - Intronic
1011178475 6:84591468-84591490 GAAGTTGCTGAAGGTTGGGGTGG + Intergenic
1011788636 6:90874046-90874068 AAGATGGATGAGGGGAGGGGTGG - Intergenic
1012428324 6:99138696-99138718 CAATTGACTAAGGGGTGGGGTGG + Intergenic
1012712409 6:102624425-102624447 GTAGTGGGTGGGGGGTGGGGCGG - Intergenic
1013287068 6:108690875-108690897 GAGATGGAGGAGGAGTGGGGAGG + Intergenic
1013362194 6:109404316-109404338 ATAATGGCTGTGGGGTGGAGAGG + Intronic
1014641811 6:123920982-123921004 GATATGACTGTGGGGTGGAGTGG + Intronic
1014813584 6:125911327-125911349 GAAAAAGCTGAGTGGTGGGAGGG - Intronic
1015016989 6:128425397-128425419 GAAAAGGGTGAGGGGTTGTGAGG - Intronic
1015407588 6:132855112-132855134 GGGATGGCTGTGGGGCGGGGAGG + Intergenic
1016448399 6:144156072-144156094 GAAAATCCTGAGGAGTGGGGAGG - Intronic
1017388681 6:153914283-153914305 GAAAGGGCACAGGGGAGGGGAGG + Intergenic
1017451135 6:154555475-154555497 GAGAAGGCTGGTGGGTGGGGTGG + Intergenic
1017980645 6:159398334-159398356 GCAATGGGTTTGGGGTGGGGTGG + Intergenic
1018017663 6:159727100-159727122 GAAGCGGCCGAGGGGAGGGGCGG - Exonic
1018111523 6:160540986-160541008 GAAAAGGAAGAGAGGTGGGGAGG + Intronic
1018313048 6:162530227-162530249 GAAATGGAAGTGGGATGGGGCGG + Intronic
1018428310 6:163702828-163702850 AGAAGGGCAGAGGGGTGGGGTGG + Intergenic
1018813712 6:167316323-167316345 GTAATGGGGGAGGGCTGGGGAGG - Intergenic
1019055333 6:169219210-169219232 GAAATGGATGAGTGGGTGGGTGG + Intronic
1019258177 7:64801-64823 GGAACTGCTGAAGGGTGGGGAGG + Intergenic
1019516636 7:1443051-1443073 GCACTGGCTCGGGGGTGGGGAGG - Intronic
1019532215 7:1509446-1509468 GAGAAGGCTGAGGTGCGGGGTGG - Intergenic
1019592342 7:1841941-1841963 GGTCTGGCTGAGGGCTGGGGTGG - Intronic
1019942675 7:4303462-4303484 GAAACGGGTGAGGGGTGAGGCGG + Intergenic
1020773047 7:12420133-12420155 GAAATGGCTGGAGGGTAGGATGG + Intergenic
1021452660 7:20797505-20797527 GCAATGGCCGAGGGGTAAGGCGG + Intergenic
1021634097 7:22674200-22674222 GAAAGGGATCGGGGGTGGGGTGG + Intergenic
1022408747 7:30119106-30119128 GAAATGGCTGTGAGCTGGGAGGG + Intronic
1022612148 7:31886580-31886602 GAAATGGCAGAGGTGTGATGGGG + Intronic
1023609470 7:41958587-41958609 GAAAGGGAGGAGGGGAGGGGAGG - Intergenic
1023685386 7:42728907-42728929 GAAATGGGAGTGAGGTGGGGAGG + Intergenic
1023896550 7:44438573-44438595 GCACTGGGTGTGGGGTGGGGTGG - Intronic
1024222559 7:47299868-47299890 GACAGGGATGAGGGGAGGGGAGG + Intronic
1024587852 7:50856812-50856834 GGAATGGCTGAGGTGTGGGCAGG - Intergenic
1024587923 7:50857106-50857128 GGAATGGCTGAGGTGGGGGGTGG + Intergenic
1024776835 7:52797770-52797792 CAAATGGCTGCTGGGTGTGGTGG + Intergenic
1025095410 7:56092212-56092234 GAAAGGTGTGAGGGGTGGGTGGG - Intronic
1026112420 7:67469111-67469133 GAAAGGGCGGAGGGGGGAGGGGG - Intergenic
1027170303 7:75866952-75866974 GGAATGGTTGAGGGTTGGGTGGG - Intronic
1027770194 7:82397063-82397085 GGAATGGAGGTGGGGTGGGGAGG - Intronic
1029506251 7:100965688-100965710 CAGATGGCTGGGGGTTGGGGAGG - Exonic
1029538398 7:101169049-101169071 GAAGGGACTGAGGGGTGGGCTGG + Intergenic
1029652459 7:101902898-101902920 GAAATATCAGAGGGGTGTGGTGG - Intronic
1031491793 7:122398772-122398794 GGAAGGGGTGAGGGGTGGGGAGG - Intronic
1032328093 7:130951043-130951065 GAACAGCCTGAGGGGTGGGCAGG + Intergenic
1032338464 7:131048505-131048527 GAAGAGGCAGAGGGGTGGGAGGG - Intergenic
1032621622 7:133539578-133539600 GGAAAGTCTGTGGGGTGGGGGGG + Intronic
1032735880 7:134692268-134692290 GTGGTGGGTGAGGGGTGGGGTGG - Intergenic
1033133345 7:138764232-138764254 GAGATGGAGGAGGGGTGAGGAGG + Intronic
1033153194 7:138934451-138934473 GGAGTGGTTGAGGGATGGGGCGG + Intronic
1033388116 7:140899204-140899226 GAGTGGGCTGAGGGGTGGGGGGG - Intronic
1033758295 7:144415227-144415249 GAAGTGGGTGAGGTGTGGGTAGG - Intergenic
1033969777 7:147025334-147025356 GAAAGGGGGGAGGGGAGGGGAGG + Intronic
1034415401 7:150961961-150961983 GGAAGAGCTGTGGGGTGGGGCGG - Intronic
1034563170 7:151894609-151894631 GAGAGGGCGGAGGAGTGGGGAGG - Intergenic
1034620352 7:152451942-152451964 GGAATGGCTGAGGCCTCGGGCGG + Intergenic
1034895604 7:154874640-154874662 CCAAGGGCTGAGGAGTGGGGTGG - Intronic
1034934570 7:155190578-155190600 CAAATCGCTGCGGGGGGGGGGGG - Intergenic
1034982747 7:155489225-155489247 GAAGTTGCAGAGGGGTGGGTGGG - Intronic
1035587491 8:787133-787155 TAAATGAATGAGGGGTAGGGAGG - Intergenic
1036007003 8:4676397-4676419 GAAGTGGTTGAGGGGTGGATGGG - Intronic
1036658638 8:10693410-10693432 GAGGTGGTTGAGGAGTGGGGAGG - Intronic
1036846958 8:12176719-12176741 GCAATCCCTGAGGGGTGGGTGGG - Intergenic
1038494197 8:27990164-27990186 GGACCAGCTGAGGGGTGGGGAGG - Intronic
1038669279 8:29569409-29569431 GAAAGGGCTGAGAGGTGAGTTGG - Intergenic
1039474774 8:37833931-37833953 GAAGTTGCTGAGGGCAGGGGCGG - Intronic
1039762395 8:40591529-40591551 GAAATGGTACTGGGGTGGGGAGG - Intronic
1039800983 8:40954346-40954368 CAGCTGGCTGAGGGATGGGGTGG - Intergenic
1039934052 8:42024580-42024602 GAGATGGGCGAGGGGTGGGGTGG - Intronic
1040506319 8:48051881-48051903 GAGTTGGCACAGGGGTGGGGGGG - Intronic
1040662693 8:49594431-49594453 ACAATGGCTGAGGGCTGGCGTGG + Intergenic
1041095242 8:54343131-54343153 GGAAGGGCTGAGGGGAGAGGAGG - Intergenic
1041214122 8:55583022-55583044 GAGATGGCTGTTGGGTGAGGTGG - Intergenic
1041483413 8:58348086-58348108 GAAAGGGCAAAGGGGTGGGATGG + Intergenic
1042667317 8:71221296-71221318 CAAATGGCAGTGAGGTGGGGTGG + Intronic
1042809505 8:72808724-72808746 GAGCTGGCTTGGGGGTGGGGTGG - Intronic
1044415196 8:91930610-91930632 GAAATGGCAGTGGGGAGGGATGG + Intergenic
1044433263 8:92133788-92133810 GACGGGGGTGAGGGGTGGGGAGG + Intergenic
1044591584 8:93917728-93917750 GAATGGGCTGGGAGGTGGGGGGG - Intronic
1044947395 8:97402510-97402532 GGAAAGGGTCAGGGGTGGGGAGG - Intergenic
1044978243 8:97688295-97688317 GAAACAACTGAGGTGTGGGGAGG - Intronic
1046194796 8:110847425-110847447 GAAATAGCAGTGGGGAGGGGTGG + Intergenic
1046871035 8:119206180-119206202 GAAGAGGCAGAGGAGTGGGGTGG + Intronic
1047186158 8:122635154-122635176 GAAATCACTGAGCGGTGGAGAGG + Intergenic
1047701373 8:127452636-127452658 GAAAGAGATGAGGAGTGGGGCGG + Intergenic
1047916846 8:129592356-129592378 GAAGAGGCAGTGGGGTGGGGAGG + Intergenic
1048509834 8:135052169-135052191 GAAATGATTGAGGAGGGGGGAGG + Intergenic
1049368590 8:142252832-142252854 GAAATGGCTGAGGGGTGGGGAGG - Intronic
1049544544 8:143223834-143223856 GAAAAGGCTGGGGGGTGAGGAGG - Intergenic
1049566803 8:143344530-143344552 GGAGTGGCTGGGGAGTGGGGAGG - Intronic
1049784190 8:144442818-144442840 GAAGTGGCTGAGTGTTTGGGGGG - Intronic
1050119437 9:2293339-2293361 GAAAAGGCTTAGGAGTTGGGAGG - Intergenic
1050442964 9:5684287-5684309 GAGATGGCGGGGGGGGGGGGGGG - Intronic
1050484144 9:6115841-6115863 GGAAAGGGTGAGGGGTGGTGAGG - Intergenic
1051220102 9:14839173-14839195 GCAATGGCAGTGAGGTGGGGAGG + Intronic
1051532837 9:18124366-18124388 GAAGTGGCTGTCGGGTGTGGTGG - Intergenic
1051605831 9:18917118-18917140 GAAATGGAGGAGAGGTGAGGGGG - Intergenic
1051741923 9:20260793-20260815 GGAAAGGGTGAGGGGTGGTGAGG - Intergenic
1051893986 9:21969801-21969823 GAATTGGCGGGGGGGAGGGGAGG + Intronic
1052817149 9:33110584-33110606 GTCATGGCTGTGGGATGGGGTGG - Intronic
1053123235 9:35561114-35561136 GGAAGGGCTGAGGGGGGCGGGGG + Intronic
1053469830 9:38338440-38338462 ACAAATGCTGAGGGGTGGGGAGG - Intergenic
1054758357 9:68981463-68981485 GGAATGGCGGAGGGTGGGGGTGG + Intronic
1054967984 9:71051587-71051609 AAAATGGCGGCGGGGTGGGGGGG + Intronic
1055364622 9:75529215-75529237 TAAATGGATGAAGGATGGGGTGG - Intergenic
1055520549 9:77076549-77076571 AAAATGGTGGGGGGGTGGGGAGG - Intergenic
1056063126 9:82905338-82905360 GAAAGAGCTGAGGGTTTGGGTGG - Intergenic
1056170418 9:83979999-83980021 GAAATGGCGGAGGTGGGGGAGGG + Intronic
1056533454 9:87507592-87507614 GAGATGCCAGAGTGGTGGGGAGG + Intronic
1056606793 9:88092705-88092727 AAAATTGCGGAGGGGTGGGGGGG - Intergenic
1056975009 9:91245080-91245102 GGAAGGGATGAGAGGTGGGGAGG + Intronic
1057134024 9:92674054-92674076 GAAAGGGCTTATGGGTTGGGGGG - Intergenic
1057173629 9:92978414-92978436 GGAATGGGGGTGGGGTGGGGGGG - Intronic
1057874455 9:98743294-98743316 GAAAGGGCTTTGGGGAGGGGAGG - Intronic
1058108504 9:101003407-101003429 AAAGTTGTTGAGGGGTGGGGTGG + Intergenic
1058808965 9:108620524-108620546 GAAATGTTTGAGGGGCAGGGTGG + Intergenic
1058842254 9:108921263-108921285 GGTAGGGCTGTGGGGTGGGGTGG - Intronic
1058951270 9:109906088-109906110 GAAGTGGCTGAGAGGTGGGCTGG + Intronic
1059645922 9:116267584-116267606 GAAATGGCGGCCGGGTGCGGTGG + Intronic
1059674247 9:116522513-116522535 GGAAAGGGTGAGGGGTGGCGAGG + Intronic
1060869848 9:127030763-127030785 GAGAAGGCAGAGGGGTGGGATGG + Intronic
1061212481 9:129201895-129201917 GACATGTATGGGGGGTGGGGTGG + Intergenic
1061213348 9:129206161-129206183 GGAATGTCTATGGGGTGGGGTGG + Intergenic
1061259622 9:129472717-129472739 GAAATGGCTGCAGGGAGGGGTGG + Intergenic
1061277974 9:129580402-129580424 TAAAGGGCTGAGGGGCGGTGGGG - Intergenic
1061371642 9:130200845-130200867 GACATGGCCGTGGGGAGGGGAGG + Intronic
1061462194 9:130748963-130748985 GTCATGGCTGAGGGCTGGGAGGG - Intronic
1061592594 9:131607550-131607572 GCACTGGCTGAGGGGTGGGACGG + Intronic
1061620137 9:131806644-131806666 GAAAAGGCAGTGGGGTGGTGAGG + Intergenic
1061999097 9:134207125-134207147 GAAATAGCTGTGGGGTGTTGTGG - Intergenic
1062404667 9:136389740-136389762 CAAAGGACTGGGGGGTGGGGCGG + Intronic
1062592448 9:137280445-137280467 GACCTGAGTGAGGGGTGGGGTGG - Exonic
1062710087 9:137970761-137970783 GAAAAGGCTGCTGGGTTGGGTGG + Intronic
1203545740 Un_KI270743v1:126856-126878 TAGATGGTTGGGGGGTGGGGAGG - Intergenic
1185502174 X:605378-605400 GAAATGGCTTAGGGCTTGGAGGG + Intergenic
1185511664 X:668311-668333 GAAGTGGGGGAGGGGAGGGGAGG - Intergenic
1185867904 X:3639385-3639407 GAAGGGGTAGAGGGGTGGGGGGG + Intronic
1186153446 X:6700919-6700941 AAAATGGGGGTGGGGTGGGGAGG + Intergenic
1187792777 X:22968938-22968960 TAATTGGTTGAGGGATGGGGTGG + Intergenic
1188767402 X:34112439-34112461 GAGATAACGGAGGGGTGGGGGGG - Intergenic
1188917052 X:35924952-35924974 CCAAAGGCTGAGGGTTGGGGTGG + Intronic
1189196876 X:39160754-39160776 GAGAAGCCTGTGGGGTGGGGAGG - Intergenic
1189234253 X:39475584-39475606 ACAAAGGCTGAGAGGTGGGGCGG + Intergenic
1189404317 X:40705950-40705972 GAAATGGTTTAGGGGAGAGGAGG - Intronic
1189700704 X:43714790-43714812 GAAATGGGGCGGGGGTGGGGTGG + Intronic
1190284174 X:48951133-48951155 GAAGTGGGGGTGGGGTGGGGGGG + Intronic
1190496951 X:51035821-51035843 GAAATGTCTCTGGGTTGGGGAGG - Intergenic
1190526361 X:51332851-51332873 GAAAGGGCCGAGGAGAGGGGCGG - Intronic
1190542882 X:51496548-51496570 GAAAGGGCCGAGGCGAGGGGCGG + Exonic
1191851378 X:65588521-65588543 GAGGTGGCTGATGGGTGGTGTGG - Intronic
1191858662 X:65648118-65648140 GAAATGGCTGGAGGGGGTGGGGG + Intronic
1192152427 X:68720451-68720473 GAGATGGTGCAGGGGTGGGGTGG + Intronic
1192207807 X:69107687-69107709 GAAAAGGGTGAGGGGAGGGGAGG - Intergenic
1192327313 X:70143716-70143738 GCAATGCCTGGGGGTTGGGGGGG + Intronic
1192422446 X:71045680-71045702 GAAATGGCTGGGGAATGGGTGGG - Intergenic
1192782117 X:74304786-74304808 CAAAAGGGTGGGGGGTGGGGGGG - Exonic
1194764150 X:97829663-97829685 GAAATAGCTGGGGCGTGGGAGGG - Intergenic
1195853250 X:109305686-109305708 GGACAGGATGAGGGGTGGGGTGG + Intergenic
1196859757 X:120015822-120015844 GAAAAGGCTGAGCGGTCTGGTGG + Intergenic
1197782688 X:130172862-130172884 GAGATGGCGGTGGAGTGGGGTGG + Intronic
1197894037 X:131292093-131292115 GGACTGGCTGAGGAGTGGGGTGG - Intronic
1198002065 X:132449979-132450001 GAAGTGGCGGGGGGGGGGGGGGG - Intronic
1198590612 X:138176280-138176302 GAAATGACTCTGGGGTGGAGAGG + Intergenic
1198745428 X:139885283-139885305 TAAATGGCAGGGTGGTGGGGGGG - Intronic
1198945708 X:142011281-142011303 GCAATTGTTGGGGGGTGGGGGGG + Intergenic
1199249779 X:145647200-145647222 AAACTGACAGAGGGGTGGGGGGG + Intergenic
1199337019 X:146630294-146630316 GCACAGGATGAGGGGTGGGGCGG - Intergenic
1199722545 X:150552348-150552370 GAACTGCCTGGGGGGTGGAGAGG - Intergenic
1199840064 X:151636907-151636929 GAAATGGGTTAGGGGTGAGGTGG - Intronic
1200102363 X:153694451-153694473 GTCATGGCTGAGGGCTGGGCTGG + Intronic