ID: 1049368591

View in Genome Browser
Species Human (GRCh38)
Location 8:142252835-142252857
Sequence GAGGAAATGGCTGAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 1, 1: 1, 2: 6, 3: 104, 4: 651}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368591_1049368603 18 Left 1049368591 8:142252835-142252857 CCCCACCCCTCAGCCATTTCCTC 0: 1
1: 1
2: 6
3: 104
4: 651
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368591_1049368601 2 Left 1049368591 8:142252835-142252857 CCCCACCCCTCAGCCATTTCCTC 0: 1
1: 1
2: 6
3: 104
4: 651
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368591_1049368608 30 Left 1049368591 8:142252835-142252857 CCCCACCCCTCAGCCATTTCCTC 0: 1
1: 1
2: 6
3: 104
4: 651
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data
1049368591_1049368602 17 Left 1049368591 8:142252835-142252857 CCCCACCCCTCAGCCATTTCCTC 0: 1
1: 1
2: 6
3: 104
4: 651
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368591_1049368604 19 Left 1049368591 8:142252835-142252857 CCCCACCCCTCAGCCATTTCCTC 0: 1
1: 1
2: 6
3: 104
4: 651
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368591_1049368606 23 Left 1049368591 8:142252835-142252857 CCCCACCCCTCAGCCATTTCCTC 0: 1
1: 1
2: 6
3: 104
4: 651
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368591 Original CRISPR GAGGAAATGGCTGAGGGGTG GGG (reversed) Intronic
900001579 1:17574-17596 GAGGGCAGGGCCGAGGGGTGTGG - Intergenic
900015814 1:148608-148630 GAGGTAGTGGCTAAGGGGTATGG + Intergenic
900021298 1:188098-188120 GAGGGCAGGGCCGAGGGGTGTGG - Intergenic
900068279 1:748917-748939 GAGGTAGTGGCTAAGGGGTATGG + Intergenic
900886969 1:5422060-5422082 GAGGAAATTGCTGGGGGTGGAGG - Intergenic
901036113 1:6337200-6337222 GAGGAGAAGGCCGAGGGCTGTGG + Intronic
901418445 1:9133756-9133778 AAGGAAATGACTGAGGGGGAAGG - Intergenic
901673794 1:10871109-10871131 GGGGAAATGGCTGGGGGCGGGGG + Intergenic
902522432 1:17027612-17027634 GAGGAACTGGCACAAGGGTGGGG - Intronic
902824042 1:18960455-18960477 GGTGAAATGGCTGGGGAGTGGGG - Intergenic
902845848 1:19110207-19110229 GAGGAAAAGGCTGAGAGCTAGGG + Exonic
902862681 1:19257456-19257478 CAGCAAAAGGTTGAGGGGTGAGG + Exonic
903325030 1:22564426-22564448 GAGGAGAGGGCTGGGGGATGGGG + Intronic
903838386 1:26220703-26220725 GAGGAAATGCCTGTGGAGGGCGG + Intergenic
904490922 1:30858550-30858572 GAGGAAATGGGGTGGGGGTGGGG - Intergenic
904542117 1:31239981-31240003 GGGGGAACGGCAGAGGGGTGGGG + Intergenic
905874332 1:41422546-41422568 GAGGAGGTGGCTGAGGGACGGGG + Intergenic
905895616 1:41544173-41544195 CAGAAAATGGCTGAGCAGTGTGG - Intronic
905922267 1:41727576-41727598 GAGGAAGTGGCTGAGGGGCGCGG + Intronic
906206219 1:43988131-43988153 GAGAAAATGGCACAGGCGTGGGG + Intronic
906269975 1:44469480-44469502 GAGGAAATGTATTAGGGGGGAGG - Intronic
906382666 1:45342646-45342668 GAGGAAATGGTTGAGGGAAAGGG + Intronic
906612776 1:47214704-47214726 GAGGAAAAGGGTGAGGGAAGTGG - Intergenic
906642668 1:47450661-47450683 GAGGAGGTGGCTGAGTTGTGGGG + Intergenic
907557600 1:55358286-55358308 GAGGAATGAGCTAAGGGGTGAGG + Intergenic
908063372 1:60375366-60375388 CAGGCAATGGGGGAGGGGTGTGG + Intergenic
908540664 1:65119251-65119273 GAGGACATAACTGAGAGGTGAGG + Intergenic
910993743 1:93081945-93081967 GAGGAAATGCCTGAGAACTGAGG + Intronic
912007527 1:104922871-104922893 GAGAAAATGGAATAGGGGTGGGG - Intergenic
912300217 1:108508143-108508165 GAGGAAATTGTTGAGAAGTGAGG - Intergenic
912490353 1:110059435-110059457 CAGGAAATGTCTGAGCTGTGGGG - Intronic
912624677 1:111197324-111197346 GAGCACAAGGCTGAGGGCTGGGG + Intronic
912698097 1:111856214-111856236 GAGGGCATGGATGTGGGGTGGGG + Intronic
912969106 1:114263814-114263836 GAGAAAGTGGCTGAGAAGTGAGG + Intergenic
912978646 1:114351332-114351354 GAGCCAGTGGCTGAGGTGTGGGG - Intergenic
913212698 1:116594878-116594900 GAGGGAATGGGGTAGGGGTGAGG - Intronic
914422374 1:147541320-147541342 GAGGAAAAGGTGGAGGGGGGAGG + Intergenic
914938734 1:152003455-152003477 GAGGGATTGGGTGAGGGATGAGG + Intergenic
915109238 1:153552609-153552631 GAGGTGAGGCCTGAGGGGTGGGG + Intergenic
915532435 1:156510416-156510438 CAGCAGATGGCTGATGGGTGTGG - Intergenic
915573585 1:156760252-156760274 CAGGAAAGGGCTGAAGAGTGTGG - Intronic
915916750 1:159945192-159945214 GGAGAAGTGGCTGGGGGGTGGGG - Intronic
915940325 1:160114710-160114732 TTGGAAATGTCTGAGGAGTGAGG - Intergenic
916504485 1:165415729-165415751 GAGGAACAGGCTGGGGTGTGGGG + Intronic
917306802 1:173634841-173634863 CAGGTAGTGGGTGAGGGGTGAGG - Intronic
917457894 1:175201264-175201286 GAGGCAAGGGTTGAGGGGTTGGG - Intergenic
917470871 1:175324794-175324816 GAGGAAACAGCTGAGGGTTGGGG - Intronic
917497112 1:175550495-175550517 GGGGAAAAGGATGGGGGGTGAGG - Intronic
918243632 1:182640933-182640955 GAGGTCAGGGATGAGGGGTGTGG - Intergenic
918399854 1:184152699-184152721 GAGGAAATGACTCAGTGGTTTGG - Intergenic
918547529 1:185701515-185701537 AAGGGAATGACTGAGGGCTGGGG - Intergenic
920136580 1:203774169-203774191 GAGGAAAGAGATGAGGGCTGTGG + Exonic
920720446 1:208381860-208381882 GAGGCTGTGGCTGAGGGATGTGG - Intergenic
921275883 1:213519637-213519659 GAGGATCTGGCTGTGGGGAGGGG - Intergenic
921928125 1:220730257-220730279 GAGGAAATGGTTGGGGTGGGGGG - Intergenic
922103641 1:222494304-222494326 GAGGTAGTGGCTGAGGGGTATGG + Intergenic
922263958 1:223966819-223966841 GAGGTAGTGGCTAAGGGGTATGG + Intergenic
922672460 1:227521495-227521517 GAGTAGAAGTCTGAGGGGTGAGG + Intergenic
922987545 1:229877618-229877640 GAGGATAGGGCTGAGGGAAGCGG + Intergenic
923081605 1:230662007-230662029 GAGGAGAGGGCTGAGGACTGAGG - Intronic
924345805 1:243071815-243071837 GAGGTAGTGGCTAAGGGGTATGG + Intergenic
1062830769 10:604016-604038 GAGGGCAGGGCTGGGGGGTGGGG - Intronic
1062909720 10:1204919-1204941 GAGGAAATGCCTGTTGGGTGGGG - Intronic
1064957930 10:20931989-20932011 TAGTAAATGGGTGAGTGGTGTGG - Intronic
1065089095 10:22211763-22211785 GAGGCTGTGGCGGAGGGGTGGGG - Intergenic
1065127149 10:22584609-22584631 GAGGAAATGGCTGAGGACATTGG + Intronic
1065392099 10:25193282-25193304 CAGAGAATGGCTGAGGGGTAGGG + Intronic
1065665727 10:28057859-28057881 GAGGAAAATGCTGTGGGCTGGGG + Intronic
1066387398 10:34952864-34952886 GAGCAAATGGCTAAGGGTGGAGG - Intergenic
1066730539 10:38433002-38433024 GAGGTAGTGGCTAAGGGGTATGG - Intergenic
1066758005 10:38730084-38730106 GGGGAAGTGGCCGAGGGGTCCGG + Intergenic
1066963690 10:42242625-42242647 GGGGAAGTGGCTGAGGGGTCGGG - Intergenic
1068273498 10:54760818-54760840 ATGGAAATGGCTGAGGAGTATGG + Intronic
1068809250 10:61237481-61237503 GGGGAAAGGGTTGGGGGGTGAGG + Intergenic
1069107386 10:64399731-64399753 GGGGAAAGGGTGGAGGGGTGAGG - Intergenic
1069723449 10:70563549-70563571 GAGGAAGTGGCTCAGGAGAGGGG - Intronic
1069945270 10:71981321-71981343 GAGGAGGAGGCTTAGGGGTGGGG - Intronic
1070386923 10:75934250-75934272 AAGGAAATGGCTCAGGGGAAAGG - Intronic
1070771750 10:79086299-79086321 GAGGAGAAGGCTGAGGGCTGAGG - Intronic
1070984533 10:80677439-80677461 GAGGTAGTTGCTGAGGGCTGGGG - Intergenic
1072156427 10:92728084-92728106 AAGGACATGTCTGTGGGGTGGGG + Intergenic
1072260524 10:93666057-93666079 TATGAAATGGGTGAGGGGTGGGG + Intergenic
1072337354 10:94409869-94409891 GGGGAACTGGGGGAGGGGTGTGG - Intronic
1073093765 10:100967818-100967840 GATGAAATGGCTGGGGGGGGGGG - Intergenic
1074162727 10:110847244-110847266 GAGGAAAAGGCCTGGGGGTGAGG - Intergenic
1074320501 10:112397708-112397730 GAGGAAATGGATTAGTGGTGGGG - Intronic
1074666478 10:115731817-115731839 TAGGAGATGGGTGTGGGGTGGGG - Intronic
1074775128 10:116762312-116762334 GTAGAAATGGATTAGGGGTGAGG - Intergenic
1074865120 10:117540443-117540465 GAAGACATGGCAGAGGGGGGAGG - Intergenic
1075061010 10:119256628-119256650 GAGGCGACGGGTGAGGGGTGGGG - Intronic
1076179886 10:128398983-128399005 GAGGACATGTCTGTGCGGTGTGG + Intergenic
1076763100 10:132615490-132615512 GAGGAAGTGGCTGCTGGGTGCGG + Intronic
1076801924 10:132834964-132834986 GAGGAGATGGGTGGGGGCTGGGG - Intronic
1077009960 11:375319-375341 GAGGAGATGGCAGAGGGGTCCGG - Intronic
1077026689 11:442774-442796 GAGGGAAGGGCTGCGGGGAGTGG + Intergenic
1077469633 11:2751093-2751115 CAAGAAATTGCTGTGGGGTGCGG - Intronic
1077472187 11:2769323-2769345 GAGGACAGGGCTGGGGGGTCTGG - Intronic
1077892543 11:6429932-6429954 GAGCAAATGGCTGACAGGTTGGG + Intergenic
1078474299 11:11618501-11618523 CAGAGGATGGCTGAGGGGTGAGG - Intronic
1080042182 11:27770510-27770532 GAGCAAATGCATGAGTGGTGGGG + Intergenic
1081557430 11:44178383-44178405 GAGGAAATGGATGAGGAGAAAGG - Intronic
1081668909 11:44932595-44932617 GAGGCAGTGGCAGAGGGGTGAGG - Exonic
1083207921 11:61164204-61164226 TAAGAAAGGGCTGAAGGGTGGGG - Intergenic
1083208601 11:61168476-61168498 GAGCACATGGATGAAGGGTGTGG + Intergenic
1083296259 11:61717174-61717196 GAGGAAATGTCTCAGGAGCGGGG - Intronic
1083753904 11:64778707-64778729 GAGGAAATGGCGGCGGAGTTCGG + Intronic
1083883355 11:65558837-65558859 GAGGAAAGGGCTAAAGGGTGGGG + Intronic
1083885443 11:65571322-65571344 AAGGAGATGGCTCAGGGCTGAGG + Intronic
1084085562 11:66853524-66853546 GAGGAGAGGGCTGAGGGACGGGG - Intronic
1084172921 11:67409313-67409335 CAGGAAGTGGCTGAGGACTGAGG - Intronic
1084269926 11:68023263-68023285 GAGGAACTGGCTGAGGGCCGGGG - Intronic
1084614458 11:70226458-70226480 GCTGGAATGGCTGGGGGGTGGGG + Intergenic
1084907434 11:72358826-72358848 GGGGAAGTGGAAGAGGGGTGGGG - Intronic
1084958720 11:72704830-72704852 TAGGAAATGGCTGTGGAATGAGG - Intronic
1085297378 11:75438786-75438808 GAGGAAAAGGCTGTGTGTTGCGG + Intronic
1086062750 11:82717354-82717376 GAGGAAGTGGGTGGGGGGGGGGG - Intergenic
1086260211 11:84930906-84930928 GAGGAAATGGATGGAGAGTGAGG - Intronic
1086741910 11:90379473-90379495 GATGAAGTGCCTGAGGGGTGGGG - Intergenic
1087198578 11:95322716-95322738 GGGGAAATGCCTAAGAGGTGAGG - Intergenic
1087237223 11:95733477-95733499 GAGGAAATGGAGGAGGGGTGGGG - Intergenic
1087429625 11:98036185-98036207 GATGAAAGGGTGGAGGGGTGAGG + Intergenic
1087798306 11:102477402-102477424 CAGGAAATGGCTGAGTTATGGGG + Intronic
1087968166 11:104445010-104445032 GATGAAGTGGGTGAGGAGTGGGG - Intergenic
1088062241 11:105668998-105669020 CCGCAAATGGCAGAGGGGTGAGG - Intronic
1088928698 11:114327528-114327550 GAGGAAATGGCTGTGTGCTCAGG + Intergenic
1088971867 11:114780919-114780941 GAGGAGAGTGATGAGGGGTGAGG + Intergenic
1089080678 11:115773902-115773924 GATGAGTTGGCTGAGGTGTGTGG + Intergenic
1089396727 11:118141040-118141062 GAGGAAGGGGCTGAGAGATGGGG + Intronic
1089532942 11:119143379-119143401 GAGGCAATGGGTGAGGCATGTGG - Intergenic
1089614291 11:119686593-119686615 GAGGAAGTGGCTGGAGGTTGGGG - Intronic
1089723392 11:120450960-120450982 GAGGAGATGGAGGAGGGGTGAGG - Intronic
1090136412 11:124204014-124204036 GAGGAAATGGAAGAGTGGGGAGG - Intergenic
1090597720 11:128336894-128336916 AAGGATATGTCTGTGGGGTGGGG - Intergenic
1091561683 12:1619135-1619157 GAAGAAATGTCTTAGGGGTGGGG - Intronic
1091602906 12:1928732-1928754 GAGGAAGTGGCAGAGGCGAGTGG + Intergenic
1091905957 12:4189298-4189320 GTGGAAATGGCAATGGGGTGGGG + Intergenic
1091908077 12:4205539-4205561 TGGGTTATGGCTGAGGGGTGAGG + Intergenic
1093282438 12:17211009-17211031 GAGGAAATCCCAGAGGCGTGAGG + Intergenic
1093282590 12:17212559-17212581 GAGGAAAGGGAAGAGGGGGGAGG - Intergenic
1093824751 12:23670346-23670368 GAGGAAGTTGATGAGAGGTGAGG + Intronic
1095522579 12:43085251-43085273 GTGTAAATTGCTGAGGTGTGGGG - Intergenic
1096156138 12:49342460-49342482 GAGGCATTGGCCGAAGGGTGGGG + Intergenic
1096509997 12:52122321-52122343 GAGGGAGTTGCTGGGGGGTGGGG + Intergenic
1098370541 12:69755535-69755557 GAGGATAAAGCTGAAGGGTGTGG - Exonic
1098448408 12:70591224-70591246 GAGGAAATGGGAGCAGGGTGCGG - Intronic
1099424303 12:82503617-82503639 GGGGAAATGGCAGAAGGGAGAGG + Intergenic
1101239243 12:102821773-102821795 AAGGAAAGGGCAGAAGGGTGGGG + Intergenic
1101887558 12:108679306-108679328 GTGGAACTGGCTAATGGGTGAGG - Intronic
1102519703 12:113470789-113470811 GAGGAAATGTTTAAGGGGTTGGG + Intronic
1103052158 12:117789717-117789739 GAGGAATTGGTGGAGGGGAGGGG - Intronic
1103507553 12:121452332-121452354 AAGGAGATGGCTGAGGTGTCTGG + Intronic
1103911912 12:124356653-124356675 TAGGAGAAGGCTGAGGGGTCCGG + Exonic
1104098918 12:125587949-125587971 GAAGAAAAGGCTCAGGGGTGAGG + Intronic
1104707889 12:130961433-130961455 GAGAAAATGGAGGAGGGGTGGGG - Intronic
1104908281 12:132227163-132227185 GAGGAAATGGCTAGGGCATGAGG + Intronic
1105015142 12:132782071-132782093 GAGGAACAGGCTCAGGGGTCTGG - Intronic
1105215945 13:18285501-18285523 GAGGGAATGGGGTAGGGGTGAGG - Intergenic
1105359641 13:19696044-19696066 GAAGAAATGGGGGAGGGGTGTGG + Intronic
1105649452 13:22358848-22358870 GTGGAAATGGCAGCAGGGTGGGG - Intergenic
1105829239 13:24149669-24149691 CTGGAAATGGCTGATGGGGGCGG + Intronic
1106964022 13:35038129-35038151 GTGGCAGTGGCTAAGGGGTGAGG - Intronic
1107631071 13:42343470-42343492 GAAGAAATGGGTGAGGCGTTAGG - Intergenic
1107938008 13:45361341-45361363 GAGGGAAGGGGTGAGGGGAGGGG - Intergenic
1109343518 13:61090129-61090151 GAGGAAATTGCTGGTGGGGGAGG - Intergenic
1110285952 13:73750576-73750598 GAAGAAGAGGCTGATGGGTGGGG + Intronic
1110446278 13:75585061-75585083 GTGGGAGTGGGTGAGGGGTGGGG + Intronic
1110610859 13:77486008-77486030 GAGGAGATGGCTGGGGCGGGGGG + Intergenic
1110827700 13:79991797-79991819 GAGGGAATGGATTAGGGTTGTGG - Intergenic
1111249884 13:85589214-85589236 GAGGAAATGGGTCAGGGTTGGGG + Intergenic
1111424717 13:88065045-88065067 GAGTAACTGGATGAGGGTTGAGG + Intergenic
1112039646 13:95533951-95533973 GAGGAAATGGGCGGGGGCTGAGG - Intronic
1112556853 13:100476841-100476863 GAGTACCTGGTTGAGGGGTGGGG + Intronic
1112619130 13:101036717-101036739 GAGGGAATTGCAGAGGGGTGTGG + Intergenic
1112709501 13:102111161-102111183 GTGGTGATGGCTGAGGGGTGTGG - Intronic
1113222160 13:108117833-108117855 AAGGAAATGGCTGGGGGATTTGG - Intergenic
1115348317 14:32366113-32366135 GAGGAAATGGTAGTGGGGGGAGG - Intronic
1115848718 14:37569493-37569515 GTGGCAATGGGTGAGGGGTAGGG + Intergenic
1115961273 14:38837801-38837823 TGGGAAATGGCTCAGGGATGGGG - Intergenic
1117381806 14:55171953-55171975 GAGGGAATGGCTGAGGAATGGGG + Intronic
1117963688 14:61186600-61186622 AAGGAAATTGCAGTGGGGTGGGG - Intergenic
1117998014 14:61496418-61496440 GTGGAAAGGCCTGATGGGTGAGG - Intronic
1118004369 14:61552518-61552540 GAGCAAATGGGTGTGGGATGAGG - Intronic
1118438794 14:65794189-65794211 GAGGCCACGGCTGAGGAGTGTGG - Intergenic
1119201225 14:72754230-72754252 GGGGAAGAGGCTGAGGGGTGAGG + Intronic
1119477406 14:74939160-74939182 GGGGCAGTGGCTGAGTGGTGGGG - Intergenic
1119614910 14:76092524-76092546 GAGAAAGTTGCTGAGGGGTGGGG + Intergenic
1119775367 14:77244727-77244749 CAGGATATGGCTGGGGGCTGAGG - Intronic
1119918799 14:78427047-78427069 GAGGAAAAGACTGAGGGGGAAGG + Intronic
1120075639 14:80155063-80155085 GAAGAAATGGCTTAGATGTGTGG - Intergenic
1120228002 14:81812115-81812137 AAGAAAATAGCTGAGGGGTTTGG + Intergenic
1120940875 14:89948006-89948028 GAGAAGATGGCAGACGGGTGGGG - Intronic
1121321755 14:92995638-92995660 GAGAGGATGGCTAAGGGGTGAGG - Intronic
1121325069 14:93015063-93015085 GAGCAAATGGCTCAGGGGAGAGG + Intronic
1121447509 14:93988156-93988178 GAGGAGTTGGAGGAGGGGTGGGG + Intergenic
1121720995 14:96108558-96108580 GAGGAAAGGGCTGGGGGGCAGGG + Intergenic
1121916648 14:97841744-97841766 AAGGAAGAGGCTGAGGAGTGGGG - Intergenic
1121938685 14:98045621-98045643 GAGGAAGAGGGTGAAGGGTGAGG - Intergenic
1122047456 14:99034261-99034283 GAGGAAATGGCAGGAAGGTGAGG + Intergenic
1122357925 14:101135152-101135174 GAAACAACGGCTGAGGGGTGGGG - Intergenic
1122464066 14:101918492-101918514 GGGGAGAAGGCTGAGGGGTGGGG - Intronic
1122464097 14:101918560-101918582 GGGGAGAAGGCTGAGGGGTGGGG - Intronic
1122535938 14:102463031-102463053 GTGGAAAAGGTTCAGGGGTGCGG + Intronic
1122771990 14:104101643-104101665 GGGGATATGGCTGTGGGGTCAGG + Intronic
1123441403 15:20294774-20294796 GGGGAAATGGCCGAGAGGTCGGG + Intergenic
1125143774 15:36441372-36441394 AAGGTGATGGCTAAGGGGTGAGG + Intergenic
1125741841 15:41970723-41970745 GAGGAAATGCCTAGGGTGTGGGG + Intronic
1126055246 15:44724000-44724022 TAGGAAATGGCTGAGTGTGGTGG - Intergenic
1126201838 15:45995367-45995389 ACGGAAAGGGCTGAGGGGTGGGG + Intergenic
1126457702 15:48882242-48882264 GGGGAAATGGCTGGGGGATATGG - Intronic
1126522795 15:49615529-49615551 GAGGAAAAGGGTGAAGGGGGAGG - Intronic
1126613621 15:50554191-50554213 GGGGAAAAGGCTGAAGGTTGGGG - Intronic
1126664708 15:51065973-51065995 GAGGAAAGGCCCAAGGGGTGGGG + Intronic
1126709396 15:51440892-51440914 GTGGCAGTGGCTGTGGGGTGAGG - Intergenic
1128182205 15:65613835-65613857 GAAGAAAAGGCTGAGGGGTGGGG + Intronic
1129360445 15:75020884-75020906 GAGAAAATGGGAGAGGGGAGAGG - Exonic
1129536812 15:76319871-76319893 CAGCAAATGCCAGAGGGGTGAGG - Intergenic
1129601576 15:77001869-77001891 AAGGAGATGGATGAGGGATGAGG + Intronic
1129700201 15:77763394-77763416 GAGGGGATGGGTGAGGGCTGGGG - Intronic
1130100027 15:80886288-80886310 GAGGCAAGGGGTGAGAGGTGAGG + Intronic
1130508790 15:84571039-84571061 GAGGTGAGGGGTGAGGGGTGAGG - Intergenic
1130698905 15:86159186-86159208 GAGGAAATGACTCATGGGTGTGG - Intronic
1131806623 15:96128813-96128835 GAGAAAATGGGTGTGGGGAGGGG - Intergenic
1132451930 15:101973362-101973384 GAGGGCAGGGCCGAGGGGTGTGG + Intergenic
1132497234 16:269624-269646 GTGGAGCTGGCTGAGAGGTGAGG - Intronic
1132547370 16:539567-539589 GAGGCTATGGCTGAGGGCGGGGG - Intronic
1132792448 16:1699247-1699269 GAGGAACTGGAAGGGGGGTGAGG + Exonic
1133177399 16:4025616-4025638 GAGGAAATGGCCCGGGGGTGTGG + Intronic
1133945681 16:10346204-10346226 AAAGAAATGGCTGAGTGGTATGG + Intronic
1134393344 16:13839960-13839982 GAGGAGATGGGTGAGGGCTTAGG + Intergenic
1134419458 16:14071821-14071843 GAGAAAAGGGCTGAGGGGAGTGG - Intronic
1134422394 16:14106360-14106382 TAGGTAAGGGCTGAGAGGTGAGG + Intronic
1134612222 16:15618531-15618553 GAGGAAATGCATGAGGTGTGGGG - Intronic
1134699759 16:16255407-16255429 GAGGAGATGGCACAGGGGTAAGG + Intronic
1134972066 16:18539258-18539280 GAGGAGATGGCACAGGGGTAAGG - Intronic
1135259521 16:20968782-20968804 GAGGAGTTGGGGGAGGGGTGGGG - Intronic
1135326772 16:21531065-21531087 GAGGACATGGCTGGGTGGGGAGG - Intergenic
1135347143 16:21698761-21698783 GAGTAAATGGCAGTGGGGTGCGG - Intronic
1135782297 16:25314247-25314269 GTGGGAATGGCTGAGTGCTGAGG + Intergenic
1136270589 16:29146111-29146133 CTGGTAATGGCTGAGGGCTGAGG + Intergenic
1136318576 16:29467969-29467991 GAGGAAATGGAGGTGGGGGGGGG - Intergenic
1136337027 16:29616479-29616501 GAGGACATGGCTGGGTGGGGAGG - Intergenic
1136416064 16:30104616-30104638 GAGGACATTGCTGAGGAGAGTGG + Intergenic
1136433148 16:30207315-30207337 GAGGAAATGGAGGTGGGGGGGGG - Intronic
1136599032 16:31271785-31271807 TGGGAGATGTCTGAGGGGTGGGG + Intronic
1136719807 16:32310748-32310770 GGGGAAGTGGCTGAGGGGTTGGG - Intergenic
1136724856 16:32349149-32349171 GGGGAAGTGGCCGAGGGGTCGGG - Intergenic
1136838182 16:33517028-33517050 GGGGAAGTGGCTGAGGGGTTGGG - Intergenic
1136843180 16:33555189-33555211 GGGGAAGTGGCCGAGGGGTCGGG - Intergenic
1137235808 16:46616563-46616585 GAGGAAATGGAGGAGGGGGGCGG + Intronic
1137409200 16:48213616-48213638 GAGGATGTGGCTCAGGGATGCGG - Intronic
1137516464 16:49148801-49148823 GAGCAAATGGCTCTGGGCTGAGG + Intergenic
1137540932 16:49361141-49361163 GAGGAAAAGGCTAAGGGGTTGGG - Intergenic
1137585633 16:49662674-49662696 CAGGAAAAGGGTGAAGGGTGGGG + Intronic
1138217161 16:55214489-55214511 GAGGAAGGGGAGGAGGGGTGAGG + Intergenic
1138249229 16:55489638-55489660 GTGGACATGGCTGTGGGGTTAGG - Exonic
1138446977 16:57070673-57070695 GTGGAAGTGGGTGAGTGGTGGGG + Intronic
1138446987 16:57070710-57070732 GTGGAAGTGGGTGAGTGGTGGGG + Intronic
1139361377 16:66402297-66402319 GTGGGAATCTCTGAGGGGTGTGG - Intronic
1139701711 16:68711723-68711745 GAAGTAAAAGCTGAGGGGTGAGG + Intronic
1140121429 16:72086164-72086186 GAGGAACCGGCAAAGGGGTGTGG + Exonic
1140812016 16:78587641-78587663 GAGGAATTGGGTGTGGGGAGTGG + Intronic
1141111109 16:81271521-81271543 GAGGTGATGGCTAAGGGGTGTGG - Intronic
1141579618 16:84988267-84988289 GAAGTGATGGCTAAGGGGTGTGG + Intronic
1141752797 16:85970367-85970389 AGAGAAATGGGTGAGGGGTGTGG - Intergenic
1142039823 16:87885815-87885837 GAGGACATGGCTGGGTGGGGAGG - Exonic
1142074178 16:88107922-88107944 CTGGTAATGGCTGAGGGCTGAGG + Intronic
1142112442 16:88339660-88339682 GGGGACATGGCAGAGGGATGGGG + Intergenic
1142126502 16:88413245-88413267 CAGGAAATGGCTGGGTGCTGAGG + Intergenic
1142142732 16:88479776-88479798 GGGGAGATGGGAGAGGGGTGGGG - Intronic
1142341433 16:89525518-89525540 GAGGACAGGGATGAGGGGTGGGG - Intronic
1203001575 16_KI270728v1_random:168606-168628 GGGGAAGTGGCGGAGGGGTCGGG + Intergenic
1203006624 16_KI270728v1_random:207021-207043 GGGGAAGTGGCTGAGGGGTTGGG + Intergenic
1203148352 16_KI270728v1_random:1817308-1817330 GGGGAAGTGGCTGAGGGGTTGGG - Intergenic
1203153345 16_KI270728v1_random:1855487-1855509 GGGGAAGTGGCCGAGGGGTCGGG - Intergenic
1142459645 17:81479-81501 GAGGTAGTGGCTAAGGGGTATGG + Intergenic
1142598182 17:1039717-1039739 GGGGAACTGGCACAGGGGTGGGG + Intronic
1143125929 17:4640861-4640883 GAGGAGAGGGCTGGGAGGTGGGG + Intronic
1143284701 17:5780474-5780496 CAGGAAATGGAGGTGGGGTGGGG + Intronic
1143402551 17:6655961-6655983 GAGGAGAGGGCTGGGAGGTGGGG - Intergenic
1143464831 17:7129634-7129656 GAGGAAAGAGGAGAGGGGTGTGG - Intergenic
1143684297 17:8501621-8501643 CAGGAAATGGCTTAAGGTTGGGG + Intronic
1144422284 17:15109740-15109762 GGGGATTAGGCTGAGGGGTGGGG - Intergenic
1144496048 17:15745583-15745605 CAGGAAAGGGCCCAGGGGTGTGG + Intronic
1144616858 17:16783944-16783966 GATGGAGTGCCTGAGGGGTGGGG - Intronic
1144797304 17:17900919-17900941 GAAGAGAGGACTGAGGGGTGTGG - Intronic
1144895833 17:18531730-18531752 GATGGAGTGCCTGAGGGGTGGGG + Intergenic
1145006480 17:19341499-19341521 GAGGACATGCCTCAGGTGTGTGG - Intronic
1145136384 17:20412502-20412524 GATGGAGTGCCTGAGGGGTGGGG - Intergenic
1145154405 17:20532878-20532900 GAAGAAAAGGGTGCGGGGTGAGG + Intergenic
1145988841 17:29065960-29065982 GAGGACAGGGCTGAGATGTGCGG - Intergenic
1146062614 17:29615025-29615047 GAGGCAACGGCAGAGGGTTGGGG + Exonic
1146095901 17:29930078-29930100 GGGGAAAGGGGTGCGGGGTGGGG + Exonic
1146408183 17:32557892-32557914 GTGGACATGGCTGTGGAGTGTGG - Intronic
1146805181 17:35859081-35859103 GACAAAATGGCTAAGGGGAGGGG + Intronic
1147054658 17:37825015-37825037 GAGGAAGAGGGAGAGGGGTGGGG + Intergenic
1147188792 17:38726868-38726890 GGGGAAATAGCTGGTGGGTGAGG - Exonic
1147918852 17:43904289-43904311 GAAGGAATGGCTGAGTGGTAGGG + Intronic
1148072393 17:44915842-44915864 AAGGAAAGGGCTGAGTGGGGTGG + Intronic
1148323159 17:46769619-46769641 GACGAAGTGGCTGTGGGGTGGGG + Intronic
1148644229 17:49210287-49210309 GAGGAAAGGGCAGAGGGTGGGGG - Exonic
1148645819 17:49219310-49219332 GAGGAAGTGGCTGTGGGCTTTGG + Intronic
1148812385 17:50301882-50301904 GAGGACAAGGCTGGGAGGTGAGG - Intergenic
1148869699 17:50649608-50649630 GAGGAGAGAGATGAGGGGTGGGG + Intronic
1149023784 17:52000894-52000916 GATCAAGTGGCTGGGGGGTGGGG + Intronic
1149203771 17:54219215-54219237 GAGTGAATGACTGAGGGTTGAGG + Intergenic
1149771746 17:59327913-59327935 GAGGAAAGGGCTGAGGGGTGGGG + Intergenic
1149895008 17:60422414-60422436 GAGGAAATGGGAGCGGGGTGGGG + Intronic
1150375529 17:64678447-64678469 AAGGTAAGGCCTGAGGGGTGAGG - Intergenic
1150505103 17:65690871-65690893 CAGGAAGTTGCTGGGGGGTGGGG + Intronic
1150695611 17:67402503-67402525 CAGGAAATGGCGGAGGGGCGGGG - Intronic
1151324060 17:73368170-73368192 GAGGACAGGGATGAGGTGTGGGG + Intronic
1151326180 17:73380941-73380963 GAGTACATGGCTATGGGGTGGGG + Exonic
1151682260 17:75628390-75628412 GAGGGCTTGGCTGAGGGGCGTGG + Exonic
1151873260 17:76850892-76850914 GAGGAACAGGCAGAGGGGTTGGG + Intergenic
1152341503 17:79728379-79728401 CAGGAGCTGGCTGTGGGGTGGGG - Intergenic
1153643070 18:7172311-7172333 GAGGACAAGGCTGAGGATTGTGG - Intergenic
1154359008 18:13643427-13643449 GAGGTGATGGCTGCGGGGGGCGG + Intronic
1154473111 18:14723949-14723971 GAGGCAGTGGCTAAGGGGTGCGG - Intergenic
1155174562 18:23291095-23291117 GAGCCAATGGCTAAGGGCTGTGG + Intronic
1156091814 18:33480501-33480523 GAGGAAATGTTTGAGGTTTGAGG - Intergenic
1156268926 18:35513428-35513450 GAGGAAATGACTGAGTAGTCAGG - Intergenic
1158720327 18:59918771-59918793 GAAGTACTGGCTGAGGAGTGAGG + Intergenic
1158878065 18:61751973-61751995 GAGGGAAAGGCAGAGGGGTCAGG - Intergenic
1159882327 18:73870211-73870233 CAGGAGATGGCAGTGGGGTGAGG + Intergenic
1160555758 18:79723882-79723904 CAGGAACTGGCTGAGGGAGGAGG - Intronic
1160822575 19:1065370-1065392 GAGGAACTGGCTGACGCGTTTGG - Exonic
1160832886 19:1111749-1111771 GAGGAGGTGGCTGAGAGCTGGGG - Intronic
1160965757 19:1746265-1746287 AAGGAAATGGAGGAGGAGTGGGG + Intergenic
1161327069 19:3669108-3669130 GAGGAAGAGGCTGAGGGTTGGGG + Intronic
1161393785 19:4034285-4034307 GAGGCCATGCCTGAGGGCTGGGG - Intronic
1161398727 19:4058513-4058535 CAGGAGAGGGCGGAGGGGTGGGG - Intronic
1161659912 19:5539689-5539711 GAGGACAGGGCTGATGTGTGAGG + Intergenic
1162099778 19:8332961-8332983 CAGGAAATGGGTGGGGGGAGAGG - Intronic
1162145739 19:8611265-8611287 GAGGAAGGGGCTGAGTGGGGTGG + Intergenic
1162785534 19:13032415-13032437 GAGGAAAGGTCTGAGGTGTCTGG + Intronic
1163129864 19:15265557-15265579 GAGGATTCGGCTGAGGGGTCTGG + Exonic
1163289984 19:16372945-16372967 CAGGAAATGGCTGATGTGTGAGG - Intronic
1163490463 19:17614660-17614682 CAGGAAGTGACTGAGGGTTGGGG + Intronic
1163845562 19:19636577-19636599 GAGGAAATAGGTCAGGGGTGTGG + Intronic
1163895203 19:20052401-20052423 GAGGTAGGGGCTGAGAGGTGTGG + Intergenic
1164703825 19:30304700-30304722 GAGGAAAGCGGTGAGGGGAGAGG + Intronic
1165473692 19:36017531-36017553 GAGGAAAGGGCTGGGGGCTCGGG + Intronic
1165690924 19:37862550-37862572 GAGGAAGAGGAGGAGGGGTGGGG + Intergenic
1165793843 19:38507331-38507353 GAGGAAGAGGCTGAGAGGGGCGG + Intronic
1165805828 19:38580136-38580158 GAGGACCTGGCTGTGGGGCGTGG + Intronic
1166123382 19:40699374-40699396 GAGGCACAGGCAGAGGGGTGGGG - Intronic
1166205202 19:41264844-41264866 GAGGAAAGGGCTGTGGGACGCGG + Intronic
1166278428 19:41772816-41772838 GATGAAAGGGCAGATGGGTGAGG - Intergenic
1166527867 19:43524445-43524467 GGGGTGATGGCTAAGGGGTGTGG + Intronic
1166776749 19:45317786-45317808 GAGGGGAGGGCCGAGGGGTGAGG - Intronic
1166997149 19:46725093-46725115 GAGGAGATGGAGGTGGGGTGGGG - Intronic
1167412322 19:49352067-49352089 GAAGAAGAGGCTGAGGGGTTGGG + Intronic
1167601880 19:50459370-50459392 GAGGTAAGAGATGAGGGGTGGGG + Intronic
1167722271 19:51186706-51186728 CAGGAAATGGGCGCGGGGTGGGG + Intergenic
1167751131 19:51380746-51380768 GTGGAAATGGGTTGGGGGTGGGG + Intronic
1167761935 19:51455236-51455258 CAGGAAAGGGGTGCGGGGTGGGG - Intronic
1167777386 19:51568018-51568040 GGGAAAATGGCTGAGGGCTTTGG - Intergenic
1167867438 19:52339728-52339750 GAGGCAATGGTTGTGGTGTGTGG - Intronic
1168288947 19:55347725-55347747 GAGGAAGGGGCTGAGGGGGGCGG - Exonic
1168357739 19:55712903-55712925 GAGGAGATGGAGGAGGGGGGAGG + Intronic
1168547020 19:57261313-57261335 GAGGATATGTGGGAGGGGTGGGG + Intergenic
925057188 2:864536-864558 GAAGAGATGCCTCAGGGGTGAGG + Intergenic
925420232 2:3704560-3704582 GAGGGCATGGGGGAGGGGTGTGG + Intronic
925558050 2:5153822-5153844 GAGGAAGTGGCTGGGGAGTAGGG - Intergenic
925720496 2:6822077-6822099 GAGAAAATGGCAGAGGTGTGCGG + Intergenic
925778526 2:7357749-7357771 GAAGGAATGGCTGAGGGCTAAGG - Intergenic
925849493 2:8067221-8067243 GAAGAAATGGCTGAGTGCAGTGG + Intergenic
925913727 2:8589615-8589637 GAGGAAAAGGGAGAGGGGAGGGG + Intergenic
925913736 2:8589637-8589659 GAGGAAAAGGGAGAGGGGAGGGG + Intergenic
925913785 2:8589747-8589769 GAGGAAAGGGGAGAGGGGAGGGG + Intergenic
925913795 2:8589769-8589791 GAGGAAAGGGGAGAGGGGAGGGG + Intergenic
925913805 2:8589791-8589813 GAGGAAAGGGGAGAGGGGAGGGG + Intergenic
925913815 2:8589813-8589835 GAGGAAAGGGGAGAGGGGAGGGG + Intergenic
926208279 2:10849413-10849435 GAGGAAGAGGGTGGGGGGTGGGG + Intronic
926565177 2:14460895-14460917 GAGGATATTGCAGAGGAGTGAGG - Intergenic
926610551 2:14942417-14942439 GAAGAAAAGAGTGAGGGGTGAGG - Intergenic
926825088 2:16898390-16898412 GTAGAAATGGTTGAGGGGTGGGG + Intergenic
927225478 2:20760944-20760966 AAGGAAAGAGCTTAGGGGTGTGG - Intronic
927499791 2:23575061-23575083 GAGCAAATGGGAGAGGGGAGAGG - Intronic
927503063 2:23595202-23595224 TGGGAAGTGGCTGTGGGGTGTGG + Intronic
927653195 2:24924564-24924586 GCAGGAATGGATGAGGGGTGTGG - Intergenic
927827485 2:26318844-26318866 GGGGAAAGGGCTGAGGGGAGAGG - Intronic
927887860 2:26729532-26729554 GAGCAAAAGGCAAAGGGGTGGGG + Exonic
927928974 2:27032157-27032179 GAGGAAAGGGCAGAGTGTTGGGG - Intergenic
928581427 2:32711650-32711672 GAGGAAAAGGCTGGGGGCGGTGG + Intronic
929545921 2:42855197-42855219 GGGGAAATGGCTGAGGCCTGGGG + Intergenic
929924966 2:46200475-46200497 GAGCAGAGGGCTGAGGGCTGGGG - Intergenic
931073430 2:58682134-58682156 AAGGAAACTGCTGAGGAGTGGGG - Intergenic
931533849 2:63249701-63249723 AAGGAAGAGGCTGAGGGGAGAGG + Intronic
931544144 2:63362306-63362328 AAGGAAGTGGGTGAGGGGAGGGG + Intronic
932412661 2:71556374-71556396 GAGGAGCTGGCTGGGGGGTGGGG + Intronic
932583758 2:73009355-73009377 GAGGCAGTGGCCCAGGGGTGGGG + Intronic
933697511 2:85230856-85230878 GAGGAAAAGCCTGAGGGGATGGG + Intronic
934124529 2:88874097-88874119 GAGTAATTGGATGAGGGGGGAGG + Intergenic
934298383 2:91761225-91761247 GAGGGAATGGGGTAGGGGTGAGG + Intergenic
934566379 2:95343894-95343916 GAGGAAATTGCTTTGGGGTCGGG - Intronic
934776501 2:96941176-96941198 GAGGAAGTGGTTGTGGGGAGTGG + Intronic
935051810 2:99530769-99530791 CAGGAAAAGGCTGAGGGATGAGG - Intergenic
937048379 2:118865533-118865555 GGGGAAATGGCTGTGGACTGAGG + Intergenic
937249394 2:120514052-120514074 CAGGAAAAGGGTTAGGGGTGGGG - Intergenic
937356120 2:121199210-121199232 CAGGGTATGGCGGAGGGGTGTGG - Intergenic
938583557 2:132669209-132669231 GAAGAAAGGGCTGCGGGGTCGGG - Intronic
940487187 2:154310688-154310710 GAGGATATTTCTGAGGGATGTGG + Intronic
940911862 2:159216423-159216445 CAGGAAAAGGCTGAGTGGCGAGG - Intronic
941052706 2:160752621-160752643 TAGGAGATGGGTGAGGGATGGGG + Intergenic
941508466 2:166376288-166376310 GAGGAAAGGGATGATGGGGGCGG - Intergenic
941672752 2:168312200-168312222 GGGGGAATGGCTGATGGGTTAGG - Intergenic
942099854 2:172569445-172569467 AAGAAAATGGGTGAGGAGTGAGG + Intronic
942370230 2:175276093-175276115 GGGGAAATGGAGGAGGGGTGAGG - Intergenic
942633099 2:177973059-177973081 AAGAAAATGGCTGAGGGAGGAGG + Intronic
945125609 2:206506286-206506308 GAGGAAAAGGCTTATGGGTGGGG + Intronic
945277222 2:208000184-208000206 AAGGAAATGGCTGGGGAGGGTGG - Intronic
945318313 2:208393829-208393851 CAGGAAATGCCTGATGGGAGTGG - Intronic
945672468 2:212818824-212818846 AAGGAAATGGCAGAGAGGAGAGG + Intergenic
946369200 2:219270338-219270360 GAGGAAAGGACTGAGGGCTGGGG + Intronic
946703056 2:222431758-222431780 CAGGAAGAGGTTGAGGGGTGGGG + Intronic
947735874 2:232455163-232455185 GAGGCAATGGGTTAGGGTTGGGG - Intergenic
947943523 2:234079753-234079775 CAGGAAAGGGTTGTGGGGTGGGG - Intergenic
948150928 2:235744224-235744246 GTGGGAAGGACTGAGGGGTGGGG + Intronic
948974622 2:241456852-241456874 GAGGACAGGGCTCAGGAGTGGGG - Exonic
1168995897 20:2133080-2133102 GAGGCAATTGCTAAGGGGTTTGG - Intronic
1169189249 20:3646923-3646945 GGGGAAATGGCTGTGCGGTGCGG + Exonic
1170381462 20:15764498-15764520 GAGTAAATGGGTGAATGGTGAGG - Intronic
1170760107 20:19241388-19241410 GAGGAGATGCCTGGGGAGTGAGG - Intronic
1171226125 20:23443546-23443568 GAGGAAATGGCAGAAGGGACTGG + Intronic
1171895879 20:30760536-30760558 GAGGTAGTGGCTAAGAGGTGAGG + Intergenic
1172602548 20:36194082-36194104 TGGGCAATGGGTGAGGGGTGTGG + Intronic
1173201962 20:40960981-40961003 GAAGAAAAGGGGGAGGGGTGGGG + Intergenic
1173513708 20:43650040-43650062 GAGGAAAGGGGGGAGGGGGGAGG + Intergenic
1174101333 20:48128349-48128371 TAGGAAAAGACTGGGGGGTGGGG + Intergenic
1174302500 20:49592688-49592710 GAGCAAAAGGCGGTGGGGTGAGG + Intergenic
1174438059 20:50526047-50526069 GTGAAAATGCCTGAGGGGTGCGG + Intronic
1174520043 20:51122298-51122320 GATGGATTGGCTCAGGGGTGAGG - Intergenic
1174662134 20:52222549-52222571 GAGGAAGTGGGCAAGGGGTGGGG - Intergenic
1175908733 20:62394594-62394616 GAGGAAACAGCTATGGGGTGGGG - Intronic
1175985050 20:62760468-62760490 GAGGAGATGGGGGAGGGGTGGGG - Exonic
1176179120 20:63741344-63741366 GAGGAGATGGGGGCGGGGTGCGG - Intronic
1176344449 21:5729185-5729207 GGGAAAATGGCTGAGGGCTGAGG - Intergenic
1176351263 21:5849769-5849791 GGGAAAATGGCTGAGGGCTGAGG - Intergenic
1176372396 21:6069999-6070021 AAGGAAACGTGTGAGGGGTGTGG + Intergenic
1176500378 21:7595271-7595293 GGGAAAATGGCTGAGGGCTGAGG + Intergenic
1176538770 21:8127254-8127276 GGGAAAATGGCTGAGGGCTGAGG - Intergenic
1176801371 21:13433900-13433922 GAGGCAGTGGCTAAGGGGTGCGG + Intergenic
1178631377 21:34264300-34264322 GAGAAAAGGGCTGAGTGGAGAGG + Intergenic
1179278184 21:39910767-39910789 GGGGAAATGGCTAAAGGGCGAGG - Intronic
1179751122 21:43468540-43468562 AAGGAAACGTGTGAGGGGTGTGG - Intergenic
1179987827 21:44931248-44931270 GAGGAAGAGGCTGGGGGCTGAGG - Intronic
1180235268 21:46455430-46455452 GAGTAAAAGGTTCAGGGGTGTGG - Intergenic
1180309566 22:11158494-11158516 GGGGAAGTGGCCGAGGGGTCGGG + Intergenic
1180348269 22:11722735-11722757 GAGGTAACGGCTAAGAGGTGAGG - Intergenic
1180356041 22:11840833-11840855 GAGGTAGTGGCTAAGAGGTGAGG - Intergenic
1180382215 22:12151493-12151515 GAGGTAGTGGCTAAGAGGTGAGG + Intergenic
1180548043 22:16520304-16520326 GGGGAAGTGGCCGAGGGGTCGGG + Intergenic
1180755119 22:18155763-18155785 GAGCCCATGGCTGCGGGGTGGGG - Intronic
1181527071 22:23496110-23496132 CAGGAAAGGGCTGAATGGTGGGG - Intergenic
1181646014 22:24232199-24232221 GAAGAGCTGGCTGGGGGGTGGGG + Exonic
1181672732 22:24433272-24433294 GAGGAAGGGGCTCAGGGGTCTGG + Exonic
1182211412 22:28680058-28680080 GGGGAAATGGCCGAGGGGTCGGG - Intergenic
1182484992 22:30634242-30634264 CAGGAAATGGCAAGGGGGTGCGG + Intergenic
1183273217 22:36874872-36874894 GAGGAAGAGGATGAGGGGTGAGG - Intronic
1183359807 22:37377563-37377585 AGGGAAATGGGTGAGGGGTCGGG + Intronic
1183992475 22:41607101-41607123 GAGGAACTGGCTGGGGTGTCTGG + Intronic
1184071388 22:42149724-42149746 GAGGTGAGGGGTGAGGGGTGAGG + Intergenic
1184614966 22:45631782-45631804 GAGTGAATGGTTGAGGGGTCTGG - Intergenic
1185150238 22:49160034-49160056 GGGGAAAGGGCTGGAGGGTGGGG + Intergenic
1185382523 22:50516662-50516684 GAGGAATTGGCTGAGACCTGAGG - Intronic
1203243717 22_KI270733v1_random:43609-43631 GGGAAAATGGCTGAGGGCTGAGG - Intergenic
949736132 3:7173711-7173733 GAGTAAATGAATGTGGGGTGGGG - Intronic
949797750 3:7869267-7869289 GAGGAAGTGTTTGGGGGGTGGGG + Intergenic
950153437 3:10706215-10706237 GAGGAGATGGCAGAGGGGTGAGG - Intronic
950668724 3:14512643-14512665 GAGGAAAAGGCTTGGGGGTGTGG - Intronic
951723640 3:25730000-25730022 GAGGAAATGGTTGAGGACTCAGG - Intronic
952730347 3:36631733-36631755 GAGCAGCTGGCTGAGGGGCGAGG - Intergenic
953334598 3:42083585-42083607 GAGGAACTGGCTGGGTGCTGTGG + Intronic
953654872 3:44842315-44842337 GTGCACATGGCTCAGGGGTGGGG + Intronic
953718206 3:45333780-45333802 GAGGAAATGCCTGGGGTCTGTGG - Intergenic
954449352 3:50563337-50563359 GGGGCAAGGGCTGAGAGGTGGGG - Intronic
954617541 3:51977088-51977110 GAGGAAAATGCTGAGGAGTGAGG - Intronic
954923772 3:54214592-54214614 GAGGAACTGACAGAGAGGTGTGG + Intronic
955321088 3:57974836-57974858 GTGGAAATGGCTGAGGGCTGAGG - Intergenic
955353019 3:58207996-58208018 GGGGAAATAGATGAGGGGTCTGG - Intronic
956398277 3:68848770-68848792 GAGGACATGGCAGAGGGGCTAGG - Intronic
956413665 3:69004732-69004754 GATGATATGGCAGAGGGGTTGGG - Intronic
956823373 3:72973699-72973721 GATGAATTGGATGAGGGTTGTGG + Intronic
957150020 3:76475008-76475030 AAGGAAAAGGCTGAGGAATGGGG + Intronic
957151807 3:76496178-76496200 GATGAAATGGGTGAGGAGTTGGG - Intronic
957499502 3:81035400-81035422 GAAGGGATGGATGAGGGGTGAGG - Intergenic
957899996 3:86476958-86476980 GGGGAAATGGGTGAGAGGTGGGG - Intergenic
958620533 3:96552505-96552527 AAGGAAGGGGCTGAGGGTTGAGG - Intergenic
958650518 3:96931157-96931179 GACAAAATGGCTGGGAGGTGGGG - Intronic
959000115 3:100954505-100954527 GAGGAAATGGATAAGGAATGAGG - Intronic
961256572 3:125559623-125559645 CAGGAGATGGCTGAGGTGGGCGG - Intronic
961314429 3:126024896-126024918 GTGGAAATGCCTGTCGGGTGTGG + Intronic
961348210 3:126278599-126278621 TGGGAAAGGCCTGAGGGGTGGGG + Intergenic
961371265 3:126433395-126433417 GAAGCAATGGATGAGGCGTGGGG - Intronic
961393668 3:126571302-126571324 GAGGAGCTGCCTGAGGGCTGCGG + Intergenic
961677891 3:128578610-128578632 GAGGGCTTGGCTGAGTGGTGGGG - Intergenic
963137538 3:141920943-141920965 CAGCATATGGCTGTGGGGTGGGG - Intronic
964437344 3:156668250-156668272 GAGGAGGTGGCTTACGGGTGTGG - Intergenic
965611143 3:170545297-170545319 GAGTAGATGGCAGAGGGGTTGGG - Intronic
966818774 3:183909147-183909169 GAGGACCTGCGTGAGGGGTGGGG - Intergenic
967220811 3:187246478-187246500 GATTAAATGGCTGTGCGGTGAGG - Intronic
967221728 3:187253094-187253116 GAGGCAGTGGCTGAGGGAGGAGG - Intronic
968136680 3:196224748-196224770 GAGGGAATGGGAGAGGGGAGGGG + Intronic
968368486 3:198206144-198206166 GAGGTAGTGGCTAAGGGGTATGG - Intergenic
968734084 4:2286220-2286242 GAGGGAGAAGCTGAGGGGTGGGG - Intronic
968874374 4:3257602-3257624 GGGGAGATGGCTGAGGAGGGTGG - Intronic
969308890 4:6340690-6340712 GGGGAATAAGCTGAGGGGTGAGG - Intronic
969546444 4:7832518-7832540 GAGAAAAGGGCTCAGGAGTGGGG - Intronic
969689625 4:8697177-8697199 GAGGTGATAGCTCAGGGGTGGGG - Intergenic
969846293 4:9922868-9922890 GAGGCAGGGGCTGAAGGGTGTGG - Intronic
969939065 4:10712296-10712318 GAGTATATGGATCAGGGGTGGGG + Intergenic
971266858 4:25103340-25103362 AAGGAAGTGAGTGAGGGGTGAGG + Intergenic
971931667 4:33091630-33091652 GAGGCATGGGCTGTGGGGTGAGG - Intergenic
972610332 4:40650335-40650357 CAGGAAACCGCAGAGGGGTGTGG - Intergenic
972951716 4:44333599-44333621 GAGGAAATGGATGAGTGGTAAGG - Intronic
973372132 4:49259852-49259874 GAGGTAGTGGCTAAGAGGTGAGG + Intergenic
974586301 4:63883082-63883104 GAGGAAGGGGATGGGGGGTGGGG - Intergenic
974911552 4:68127948-68127970 AAGTAAATGAATGAGGGGTGAGG - Intronic
975174098 4:71267549-71267571 GAGGAAATGGCCAAGGTGGGTGG + Intronic
975668192 4:76754552-76754574 GAGGGAATGGCTGAAGGCAGAGG - Exonic
975859700 4:78663665-78663687 GAGAGAATTGCTGAGGGGTGAGG - Intergenic
976220545 4:82753719-82753741 GGGAAGATGGCTGAGGGGGGAGG - Intronic
976239344 4:82937708-82937730 GAGGAAATGGAAGTGGGATGTGG + Intronic
978277491 4:106969256-106969278 GAGGAAAAGGGAGAGGGGAGGGG - Intronic
978827955 4:113047544-113047566 GAGGGAATGAGTGAGGGGTTGGG + Intronic
979256910 4:118615867-118615889 GAGGTAGTGGCTGAGGGGTATGG - Intergenic
979331440 4:119424678-119424700 GAGGTAGTGGCTGAGGGGTATGG + Intergenic
979605963 4:122639322-122639344 GAGGAAGTGGCGGCGGGGGGAGG - Intergenic
980349916 4:131670888-131670910 GAGGTATTTGGTGAGGGGTGTGG + Intergenic
980798745 4:137719961-137719983 GAGGAAAAGAGAGAGGGGTGAGG - Intergenic
982908642 4:161112014-161112036 GTGGTAATTGCTAAGGGGTGTGG - Intergenic
985171816 4:187158148-187158170 AAGGCATTGGCTGAGGGCTGAGG - Intergenic
985312789 4:188620007-188620029 CAGGAAATGTCTGCGGGGGGTGG + Intergenic
985435732 4:189928158-189928180 GAGGACATGGCTTAGGGCTGTGG - Intergenic
985667882 5:1191573-1191595 GGGGGAAAGGCTGAGGAGTGGGG + Intergenic
985668197 5:1192731-1192753 GGGGGAAAGGCTGAGGAGTGGGG + Intergenic
985668206 5:1192768-1192790 GGAGAAAAGGCTGAGGAGTGGGG + Intergenic
985668223 5:1192837-1192859 GGGGGAAAGGCTGAGGAGTGGGG + Intergenic
985956186 5:3267956-3267978 GAGGCCAGGGCTGTGGGGTGCGG - Intergenic
986215494 5:5715559-5715581 GGGGAAATGACAGAGGGGTGGGG + Intergenic
986384175 5:7215639-7215661 GAGGAAATTGTTGAGGGGAAGGG - Intergenic
986703477 5:10434490-10434512 GAGGATGTGGGTGTGGGGTGGGG - Exonic
987095659 5:14546887-14546909 TAAGAAATGGCAGTGGGGTGGGG + Intergenic
987112830 5:14702688-14702710 AAGGAAATGGCTGAGGAGAGCGG - Intergenic
987160218 5:15133810-15133832 GAGGAACAGGCTGGGGTGTGCGG + Intergenic
988914294 5:35876773-35876795 AAGGAAATGATTGAGGAGTGAGG + Exonic
989171283 5:38472174-38472196 GAGGAGATGGCAGAGGGTGGAGG + Intergenic
991205301 5:64042656-64042678 GTGGCAATGGCTATGGGGTGAGG + Intergenic
992828872 5:80574643-80574665 GAGGGTATGGGAGAGGGGTGAGG + Intergenic
993475712 5:88361708-88361730 GAGTAAATGGACTAGGGGTGAGG - Intergenic
993962952 5:94323279-94323301 GAACAAATTGCTGAGGGATGAGG + Intronic
994009623 5:94885603-94885625 GAGGAAAGGCCAGCGGGGTGGGG - Intronic
995656822 5:114435116-114435138 GGGGTAAGGGGTGAGGGGTGAGG - Intronic
995734516 5:115285756-115285778 GAGGAAATTGATGGGAGGTGTGG + Intronic
996229133 5:121039762-121039784 GAGCAAATGGCGGCTGGGTGTGG + Intergenic
996449442 5:123602745-123602767 GAGGATATGGGTGAGTGGTTAGG + Intronic
996817262 5:127587925-127587947 GATAATCTGGCTGAGGGGTGTGG + Intergenic
996828433 5:127712051-127712073 AAGGAAATGCTTGAGGGGTGTGG - Intergenic
996904574 5:128583503-128583525 GAGGAACTGGGTGAGGGTTGGGG + Intronic
997037831 5:130214004-130214026 GAGGTGATGGTGGAGGGGTGGGG + Intergenic
997439698 5:133900500-133900522 GAGTACATGGCTGTGGGGAGGGG + Intergenic
997484654 5:134220070-134220092 CAGTAAATGGCTGAGAGGTGGGG - Intronic
998816918 5:146023727-146023749 GAGGTGATGGCTAAGAGGTGTGG - Intronic
999135496 5:149316123-149316145 GGGGAAATGGGTCAGGGGAGTGG - Intronic
999482487 5:151961601-151961623 TAGGAAATGGTTGAGGTTTGGGG - Intergenic
999511868 5:152260622-152260644 GAGGATTTGGCTTAGGGATGAGG + Intergenic
999700960 5:154228020-154228042 GAGAAAATGGCTGGGAGGGGAGG - Intronic
1000232672 5:159330694-159330716 GAGGAAATGACTTTTGGGTGGGG + Exonic
1001475642 5:172048832-172048854 GAGGTAAAGTCAGAGGGGTGGGG - Intronic
1002165087 5:177338927-177338949 GAGGAAATGGCTGGTGGGTTTGG - Intronic
1002419710 5:179139272-179139294 GAGAAAGTGGCTGCGGGCTGAGG + Intronic
1002727707 5:181311371-181311393 GAGGTAGTGGCTAAGGGGTATGG - Intergenic
1002949919 6:1799638-1799660 GAGAAATTGGCTGAGGGGCTGGG + Intronic
1003502118 6:6711565-6711587 GAGAAGATGGCTGAGGGGAGAGG - Intergenic
1004023055 6:11791590-11791612 GAGGAACTGGGTCAGGGTTGGGG - Intronic
1004178940 6:13364668-13364690 GAGGGAAGGGCCGAGGGGAGAGG - Exonic
1005082534 6:21971235-21971257 AAGGAAATGACTGATGGGTTTGG - Intergenic
1006052415 6:31355083-31355105 TAGGGAAGGGGTGAGGGGTGGGG - Intronic
1006272684 6:32976360-32976382 GAGGAAATGACTGATGGGTGGGG - Exonic
1006984316 6:38167100-38167122 GAGTAAAGCCCTGAGGGGTGGGG - Intergenic
1007403584 6:41618925-41618947 GAGGAAATGTTTGATGGGTGAGG - Intergenic
1007626721 6:43250828-43250850 GAGGAAAGGGCAAAGGGGAGGGG - Intronic
1007758376 6:44116042-44116064 CAGGAAATGCCTGTGGGATGAGG + Intronic
1007813823 6:44505966-44505988 GAGGCTAGGGGTGAGGGGTGGGG + Intergenic
1008267303 6:49444283-49444305 GTTAAAATGGCTGTGGGGTGGGG - Intronic
1008674144 6:53801613-53801635 GAGGTATGGGGTGAGGGGTGGGG - Intronic
1009738282 6:67707758-67707780 GAGTAAATGCCTGAGGGGATGGG - Intergenic
1010739068 6:79478651-79478673 GACGGAGTGGGTGAGGGGTGGGG - Intergenic
1013383965 6:109605738-109605760 GAGGAAAGGTTTGAGGGATGAGG + Intronic
1013582143 6:111545946-111545968 GAGGAAAAGAGTGAAGGGTGAGG - Intergenic
1013958274 6:115866452-115866474 GTGGAAATGGCTAGAGGGTGGGG - Intergenic
1014211146 6:118709480-118709502 GAGGAAATGGGGGAGGGGAGAGG - Intronic
1014512655 6:122343422-122343444 GAGGACTTGGGTAAGGGGTGGGG + Intergenic
1015299135 6:131632949-131632971 GAGAAAAGGGATGAGGGATGAGG + Intronic
1015519650 6:134117586-134117608 GTGGAAGTGGCTGAGGAGTGAGG + Intergenic
1016323508 6:142874016-142874038 TAGCAAATGGCTGAGTGGAGGGG - Intronic
1016800846 6:148167599-148167621 CAGGGAAGGGCAGAGGGGTGGGG - Intergenic
1017200546 6:151749557-151749579 GAGGAAATGGCTATGGGGAGAGG - Intronic
1018414538 6:163590087-163590109 GGGGAAATAGCTGAGGGGAAGGG - Intergenic
1018459654 6:163985811-163985833 GAGGAAATGGCTGGCTGGTATGG + Intergenic
1018753720 6:166830336-166830358 GGGGAAGTGGCTGAGGGAAGTGG + Intronic
1019157999 6:170051815-170051837 GAGGAAATAGCTCAGGGTTGAGG - Intergenic
1019516637 7:1443054-1443076 GAGGCACTGGCTCGGGGGTGGGG - Intronic
1019572546 7:1719751-1719773 GAGCAAATGGCTAGGAGGTGGGG + Intronic
1019775366 7:2909382-2909404 GAGTGAGAGGCTGAGGGGTGAGG - Intronic
1019775424 7:2909558-2909580 GAGTGAGAGGCTGAGGGGTGAGG - Intronic
1019789825 7:3004014-3004036 GAAGAAATGACTGGGGGGAGCGG - Intronic
1019942674 7:4303459-4303481 GTGGAAACGGGTGAGGGGTGAGG + Intergenic
1020079276 7:5278075-5278097 GAGGCAGAGGCTGAGGTGTGAGG + Intronic
1020535834 7:9397222-9397244 GAGAAAATAGCTGTGGGGGGTGG - Intergenic
1020708554 7:11576195-11576217 GAATAAATGGATGAGGAGTGTGG - Intronic
1020788424 7:12595575-12595597 GGGGCAATGGTTGAGGGGAGAGG + Intronic
1021055764 7:16044114-16044136 GAGAAACTGGCTGAGAGATGTGG - Intergenic
1021452659 7:20797502-20797524 AAGGCAATGGCCGAGGGGTAAGG + Intergenic
1021634096 7:22674197-22674219 GAGGAAAGGGATCGGGGGTGGGG + Intergenic
1021887582 7:25155059-25155081 GAGGAAAGGGCTGCTGGGTGCGG + Exonic
1021900296 7:25278589-25278611 GAAGATATGGCTGATGGCTGTGG + Intergenic
1022103307 7:27181964-27181986 CAGGAAATGGCTGTGGAGTGTGG - Exonic
1022256152 7:28660700-28660722 GAGGAAAAGGTGAAGGGGTGGGG - Intronic
1023338356 7:39193318-39193340 GGGGAAATGGCAGAGAAGTGGGG - Intronic
1023363696 7:39442016-39442038 GAGGCAATGGCTGAGGTATCTGG - Intronic
1023398892 7:39777172-39777194 GAGGTAGTGGCTAAGGGGTATGG - Intergenic
1023482215 7:40646090-40646112 GAGCAAATGGCTGGCTGGTGGGG - Intronic
1023560776 7:41471172-41471194 GATGAAATTGCTGAGGGTTCAGG + Intergenic
1023838796 7:44084009-44084031 GAGCACAGGGCTGAGGGGAGTGG + Intergenic
1023938656 7:44756625-44756647 GACGAAGAGGCTGAGAGGTGAGG + Intronic
1023965396 7:44961234-44961256 GGGGTAAGGGCTGAGGGCTGAGG + Intergenic
1023990699 7:45126539-45126561 GGGGAAATGGCTGAGAGGTCTGG + Intergenic
1024271077 7:47641916-47641938 TAGTAAATGGCTGAGGTGTTTGG - Intergenic
1024651547 7:51407514-51407536 GAGGTAGTGGCTAAGGGGTATGG + Intergenic
1025028249 7:55535519-55535541 ATGGAAATGGCTGCGGGGCGGGG - Intronic
1025133752 7:56393320-56393342 GAGGTAGTGGCTAAGGGGTATGG + Intergenic
1025185354 7:56853556-56853578 GAGGTAGTGGCTAAGGGGTGCGG + Intergenic
1025199615 7:56954115-56954137 GAGGCAGAGGCTGAGGTGTGAGG - Intergenic
1025672331 7:63622818-63622840 GAGGGAGAGGCTGAGGTGTGAGG + Intergenic
1025686577 7:63723403-63723425 GAGGTAGTGGCTAAGGGGTGCGG - Intergenic
1025910263 7:65823004-65823026 GAGGTAGTGGCTAAGAGGTGCGG - Intergenic
1026112423 7:67469114-67469136 GGGGAAAGGGCGGAGGGGGGAGG - Intergenic
1026371701 7:69706075-69706097 GAGGAAAAGGCAGAGGGGATGGG - Intronic
1026874427 7:73871273-73871295 CAGGAGGAGGCTGAGGGGTGGGG + Intergenic
1027785358 7:82573493-82573515 GAACAAATGGCTGGGGGCTGTGG - Intergenic
1028828955 7:95305786-95305808 GAGGTAAAGGCAGAGAGGTGAGG + Intronic
1028830848 7:95325032-95325054 GAGGAAATGAATGAGCTGTGTGG - Intergenic
1029264706 7:99328970-99328992 GAGAAAAGGGATGAGGGGGGAGG + Intronic
1030185044 7:106753441-106753463 TAGGTAATTGCTGAGGGCTGGGG - Intergenic
1031872345 7:127101327-127101349 GAGGAAACTGCTGAGGAGAGGGG - Intronic
1031976587 7:128097616-128097638 GAGGAAATTGCTGGGTGATGGGG - Intergenic
1032049222 7:128636653-128636675 GAGGTAGTGGCTAAGGGGTATGG - Intergenic
1032478152 7:132226267-132226289 GGAGAGATGGCTGAGGGGTCAGG + Intronic
1032677082 7:134141032-134141054 TAGGAAATCGCGGAGTGGTGGGG + Intronic
1033133344 7:138764229-138764251 AAGGAGATGGAGGAGGGGTGAGG + Intronic
1033278689 7:139990814-139990836 GAGGGAAGTCCTGAGGGGTGGGG - Intronic
1033991052 7:147287496-147287518 GAGGAAATGGATGAGAGGCCAGG - Intronic
1034138702 7:148796634-148796656 GAGGACAGGGCTGACAGGTGTGG + Intronic
1034529240 7:151685105-151685127 GAAGAAATGGCTGAAGGCTCAGG - Intronic
1035182338 7:157098443-157098465 TTGGCAAGGGCTGAGGGGTGAGG - Intergenic
1035605786 8:929124-929146 GGGGGAATGGCAGCGGGGTGTGG - Intergenic
1035605808 8:929189-929211 GGGGGAATGGCAGGGGGGTGTGG - Intergenic
1035605838 8:929286-929308 GGGGGAATGGCAGCGGGGTGTGG - Intergenic
1035605859 8:929351-929373 GGGGGAATGGCAGGGGGGTGTGG - Intergenic
1035690653 8:1557415-1557437 GAGATGGTGGCTGAGGGGTGAGG + Intronic
1035742961 8:1943126-1943148 GAAGCAATGGCTGCGGGGAGCGG + Intronic
1036577784 8:10044754-10044776 AAGGAAAAGGCTGATGGCTGGGG + Intergenic
1037580078 8:20239878-20239900 GAGGGATTTGCTGGGGGGTGTGG - Intergenic
1037702135 8:21284879-21284901 GAGGAAATGACTACTGGGTGGGG - Intergenic
1037881094 8:22573877-22573899 GAGGAACCAGCTGGGGGGTGTGG + Intronic
1039153667 8:34531328-34531350 GCTGAAATAGCAGAGGGGTGGGG + Intergenic
1040016159 8:42701920-42701942 AAGGAAATGGGTGATGGCTGAGG - Intronic
1040417530 8:47208423-47208445 GAGGAAGCAGCTGAGGGTTGGGG - Intergenic
1040935965 8:52782595-52782617 GTGGTGAGGGCTGAGGGGTGTGG - Intergenic
1041649543 8:60288255-60288277 GGGGAAATGGGTGAGGGGAGGGG - Intergenic
1042317140 8:67436121-67436143 GGGGAAATAGCTGGTGGGTGAGG - Intronic
1042489561 8:69381694-69381716 GATGGAATGCCTGAGGGGAGAGG + Intergenic
1042795841 8:72662480-72662502 GAGGATATGGATGATGGCTGGGG + Intronic
1044605530 8:94044109-94044131 GAGGATAGGGTTGAGGTGTGGGG + Intergenic
1045204638 8:100025451-100025473 ATGGACATGGGTGAGGGGTGAGG - Intronic
1046871034 8:119206177-119206199 GAGGAAGAGGCAGAGGAGTGGGG + Intronic
1049069791 8:140347482-140347504 GAGGACAGGGCTGAAGGATGAGG - Intronic
1049368591 8:142252835-142252857 GAGGAAATGGCTGAGGGGTGGGG - Intronic
1049544545 8:143223837-143223859 GCAGAAAAGGCTGGGGGGTGAGG - Intergenic
1049784193 8:144442821-144442843 GAGGAAGTGGCTGAGTGTTTGGG - Intronic
1049846772 8:144806311-144806333 AAGAACATGGCTGTGGGGTGAGG + Intronic
1049884387 9:17687-17709 GAGGGCAGGGCCGAGGGGTGTGG - Intergenic
1049963228 9:756130-756152 GAGGAACTGACTGAGAGGAGAGG + Intergenic
1050025707 9:1332603-1332625 GAGGAAAGGGGAAAGGGGTGGGG + Intergenic
1051337195 9:16076596-16076618 GAGGGAAGGGCTGAGTGGGGCGG - Intergenic
1051390538 9:16558526-16558548 GAGAAAATGGCAGAGGGGACAGG - Intronic
1051605834 9:18917121-18917143 GGGGAAATGGAGGAGAGGTGAGG - Intergenic
1053084333 9:35205110-35205132 GAGGAAAAGAGTGAGGGGTGAGG - Intronic
1053321011 9:37098799-37098821 GAGGAAAGGAGTGAGGGTTGAGG - Intergenic
1053434307 9:38065425-38065447 GGGGAAATGGCTGAGGGTCCTGG - Intronic
1054967981 9:71051584-71051606 GTGAAAATGGCGGCGGGGTGGGG + Intronic
1056275826 9:84993198-84993220 GAGGAAATGGCTTTGGGAAGAGG - Intronic
1056461412 9:86812914-86812936 GAGGACATTGCTGAGGGCTATGG + Intergenic
1056975008 9:91245077-91245099 GAGGGAAGGGATGAGAGGTGGGG + Intronic
1057576092 9:96244068-96244090 GAGGAAATAGGAGAGGGGAGTGG - Intronic
1058108503 9:101003404-101003426 GAGAAAGTTGTTGAGGGGTGGGG + Intergenic
1058541369 9:106015787-106015809 GAGGAAAAGGCAGAGGGGGTGGG - Intergenic
1058628331 9:106959168-106959190 GGGGAGATGGCTGAGTGGGGAGG - Intronic
1059145656 9:111897073-111897095 GAGGAAAGGGCGGAGGGGGGTGG - Exonic
1059385610 9:113961945-113961967 GAGGAAATGGCTGTGGACTTGGG + Intronic
1059408802 9:114119023-114119045 GAGAAGATGGCTGAGGTTTGTGG - Intergenic
1059844898 9:118264226-118264248 GAGGAAATGGCCAATGGTTGTGG + Intergenic
1060690020 9:125649512-125649534 GAGGAAGTGACTGATGGGAGAGG + Intronic
1060850327 9:126869520-126869542 GAGGGGGAGGCTGAGGGGTGTGG + Intronic
1060971682 9:127741994-127742016 GGGGACAGGGGTGAGGGGTGCGG + Intronic
1061259621 9:129472714-129472736 CAGGAAATGGCTGCAGGGAGGGG + Intergenic
1061283999 9:129612137-129612159 CAGGATGAGGCTGAGGGGTGGGG - Intronic
1061974026 9:134059390-134059412 GAGGAAGTGGGGCAGGGGTGGGG + Intronic
1062034242 9:134375708-134375730 GAGGAGAAGCCTGAGGGCTGGGG + Intronic
1062094564 9:134696096-134696118 TAGGAAATGAATGCGGGGTGTGG - Intronic
1062194365 9:135264785-135264807 GAGGAATTGGCTCAGGGCTAGGG - Intergenic
1062317169 9:135973487-135973509 GAGGAAATGCATGTGGGGTGTGG + Intergenic
1062403465 9:136382554-136382576 GAGGAACTGGCTGGGGGGCATGG - Intronic
1062488391 9:136792220-136792242 CAGGAAATGGAAGAGGGCTGGGG - Intronic
1062675381 9:137740177-137740199 GTGGAAATGGGCGTGGGGTGGGG - Intronic
1062752827 9:138268849-138268871 GAGGTAGTGGCTAAGGGGTATGG - Intergenic
1203741104 Un_GL000218v1:1339-1361 GAGGTAGTGGCTAAGAGGTGAGG - Intergenic
1203460051 Un_GL000220v1:26687-26709 GGGAAAATGGCTGAGGGCTGAGG - Intergenic
1203553367 Un_KI270743v1:183148-183170 GAGGTAGTGGCTAAGAGGTGAGG - Intergenic
1185546308 X:948280-948302 AAGAAAATGGCAGATGGGTGAGG + Intergenic
1185666817 X:1772120-1772142 GTGGAAGTGGGTGATGGGTGAGG + Intergenic
1186199605 X:7143863-7143885 AAGGAGATGGCTGAGGGTGGAGG - Intronic
1186417236 X:9394316-9394338 GAGGAAATAGCTGTGGGTCGGGG + Intergenic
1186523578 X:10227642-10227664 GAGGTAACAGCTAAGGGGTGTGG - Intronic
1187266276 X:17737209-17737231 GAGGAGATGGCTGTGGGGCGGGG - Intergenic
1187266289 X:17737251-17737273 GAGGAGATAGCTGTGGGGCGGGG - Intergenic
1187266301 X:17737293-17737315 AAGGAGATGGCTGTGGGGCGGGG - Intergenic
1187901036 X:24026573-24026595 GAGAAAATGGCGGCGGGGGGTGG - Intronic
1188168536 X:26892615-26892637 GAGGCTCTGGCTGAGGTGTGTGG - Intergenic
1189333779 X:40158047-40158069 GAAGAAATGGCTTGGGTGTGGGG + Intronic
1189581675 X:42413725-42413747 GATGGAGTGCCTGAGGGGTGGGG - Intergenic
1189586197 X:42464428-42464450 GAGGAAAGGGGTGGGGGGTAGGG + Intergenic
1190032065 X:46983484-46983506 GAGAATGTGGCTGAGAGGTGGGG - Intronic
1190310916 X:49116500-49116522 GCTGAAATGGTTGAGAGGTGGGG - Intronic
1190407667 X:50103755-50103777 GTGGAAATGGGTGGGGGTTGAGG + Intergenic
1190569992 X:51770926-51770948 GAGGAACTGGCTGGGAGCTGCGG - Intergenic
1190833210 X:54077837-54077859 GTGGATATGGCTAAGGGGTGGGG - Intronic
1190916102 X:54812258-54812280 TGGGAAAGGGCTGAGGTGTGGGG + Intronic
1191851430 X:65588776-65588798 AAGCAAATGGTTGGGGGGTGGGG - Intronic
1192718589 X:73668975-73668997 GATGGAATGCCTGAGGGGCGAGG - Intronic
1192833288 X:74772876-74772898 GGGGAAATAACTGGGGGGTGGGG + Intronic
1194457627 X:94124152-94124174 GAGGAAATGGAAGAGTGGGGAGG - Intergenic
1194976674 X:100403280-100403302 GAGGAACTGGCAAGGGGGTGGGG - Intronic
1194984283 X:100473355-100473377 CAAGCAATGGATGAGGGGTGGGG + Intergenic
1195077386 X:101339973-101339995 CAGAAAATGGCTGAGGTGGGAGG + Intergenic
1195366387 X:104130666-104130688 GAGGAGATGGCTGATGCATGAGG - Intronic
1195470071 X:105220474-105220496 GAGAAGATGGATGAGGGGAGGGG - Intronic
1196859756 X:120015819-120015841 CAGGAAAAGGCTGAGCGGTCTGG + Intergenic
1197033112 X:121842590-121842612 GAGAACAGGGCTGAGGAGTGGGG - Intergenic
1197722606 X:129755429-129755451 GAGGAACAGGGTGAGGGGAGGGG + Intronic
1198425511 X:136515983-136516005 AAGGAAATGAATGTGGGGTGGGG - Intergenic
1198809888 X:140524571-140524593 GAAGAAATGGGAGAGGGGAGGGG + Intergenic
1198869583 X:141161671-141161693 GAGGTAGGGGGTGAGGGGTGGGG + Intergenic
1199599881 X:149535562-149535584 GAGGAGAGGGATGAGGGGGGAGG - Intergenic
1199650759 X:149944689-149944711 GAGGAGAGGGATGAGGGGGGAGG + Intergenic
1199770004 X:150969229-150969251 GAGGACCTGGCTGAGGGGAGGGG - Intergenic
1199840065 X:151636910-151636932 GTTGAAATGGGTTAGGGGTGAGG - Intronic
1200072603 X:153536565-153536587 AGGGAAATGGCTGAGAGGAGGGG - Intronic
1200610113 Y:5317584-5317606 GAGGAAGAGAGTGAGGGGTGGGG - Intronic
1201154633 Y:11118808-11118830 GAGGTAGTGGCTAAGAGGTGAGG - Intergenic
1201574768 Y:15451157-15451179 AAGGAGATGGCTGAGGGTGGAGG - Intergenic