ID: 1049368592

View in Genome Browser
Species Human (GRCh38)
Location 8:142252836-142252858
Sequence AGAGGAAATGGCTGAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 568}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368592_1049368601 1 Left 1049368592 8:142252836-142252858 CCCACCCCTCAGCCATTTCCTCT 0: 1
1: 1
2: 5
3: 61
4: 568
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368592_1049368604 18 Left 1049368592 8:142252836-142252858 CCCACCCCTCAGCCATTTCCTCT 0: 1
1: 1
2: 5
3: 61
4: 568
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368592_1049368608 29 Left 1049368592 8:142252836-142252858 CCCACCCCTCAGCCATTTCCTCT 0: 1
1: 1
2: 5
3: 61
4: 568
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data
1049368592_1049368606 22 Left 1049368592 8:142252836-142252858 CCCACCCCTCAGCCATTTCCTCT 0: 1
1: 1
2: 5
3: 61
4: 568
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368592_1049368602 16 Left 1049368592 8:142252836-142252858 CCCACCCCTCAGCCATTTCCTCT 0: 1
1: 1
2: 5
3: 61
4: 568
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368592_1049368603 17 Left 1049368592 8:142252836-142252858 CCCACCCCTCAGCCATTTCCTCT 0: 1
1: 1
2: 5
3: 61
4: 568
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368592 Original CRISPR AGAGGAAATGGCTGAGGGGT GGG (reversed) Intronic
900242924 1:1625477-1625499 GGAGGAAGGGGCTGAGGGGGCGG - Intronic
900413413 1:2523993-2524015 AGAGAGAATGGCAGAGGGGATGG - Intronic
900694373 1:4000744-4000766 AGAGCAGGTGGCAGAGGGGTAGG + Intergenic
900833415 1:4981172-4981194 AAGGCAAATGGCTGAGGCGTGGG - Intergenic
900870174 1:5296749-5296771 AGAGGAAATGGCTTTTGGGGCGG - Intergenic
902435055 1:16393137-16393159 AGAGGAAAGTGATGAGAGGTGGG + Intronic
902476108 1:16688734-16688756 AGCAGAAATGTCTGAGGGATGGG - Intergenic
902522433 1:17027613-17027635 AGAGGAACTGGCACAAGGGTGGG - Intronic
902824043 1:18960456-18960478 AGGTGAAATGGCTGGGGAGTGGG - Intergenic
902845847 1:19110206-19110228 TGAGGAAAAGGCTGAGAGCTAGG + Exonic
903401270 1:23051649-23051671 AGAGTAAATGGATGAGGGAAAGG + Intronic
904311322 1:29631490-29631512 AGAGTAAATGTCAGAGGCGTGGG + Intergenic
904392940 1:30197691-30197713 AGAGTAAATGTCAGAGGCGTGGG + Intergenic
904490923 1:30858551-30858573 AGAGGAAATGGGGTGGGGGTGGG - Intergenic
905298562 1:36970594-36970616 AGAGAAAATGGCATAGTGGTAGG - Intronic
905923426 1:41733735-41733757 AGAGGAAAGGGATGTGGGGAAGG + Intronic
905974091 1:42162950-42162972 AGAGGAAATCGCTGAGGACCCGG - Exonic
906206218 1:43988130-43988152 AGAGAAAATGGCACAGGCGTGGG + Intronic
906224926 1:44113927-44113949 AGGGAAAATGGCAGTGGGGTGGG + Intergenic
906382665 1:45342645-45342667 TGAGGAAATGGTTGAGGGAAAGG + Intronic
908482715 1:64558090-64558112 AGAGAAAATGGCAGAGGGCCTGG - Intronic
910258698 1:85276015-85276037 TGAGGAGATGGGTGAGGAGTGGG + Intronic
911971883 1:104449401-104449423 ATAGAAAATGACTGAGGGGAAGG + Intergenic
912204672 1:107496626-107496648 AGAATGAATGTCTGAGGGGTAGG - Intergenic
912724726 1:112048840-112048862 AGAGGCTATGGCTGATGGGCTGG + Intergenic
912869653 1:113292334-113292356 AGAGGAAAGGGCGGAGGGGGAGG + Intergenic
913261419 1:117001418-117001440 AGAGGAAATGACTGAGAAATGGG - Intergenic
914953700 1:152142991-152143013 AGAATAAATGCCTGAGGGGATGG + Intergenic
915311722 1:155008644-155008666 AGAGGAAAAAGGTGAGGGGTAGG - Intronic
915883567 1:159700020-159700042 AGACAAAATGGCAGAGGGGCTGG + Intergenic
916012327 1:160717543-160717565 AGAGGAATTGTTTTAGGGGTTGG - Intergenic
916080252 1:161227757-161227779 AGAGGAAGTGCCTCAGGGGATGG - Intronic
916114517 1:161475650-161475672 AGCGGATATGGATGAGGGGGTGG - Intergenic
916805969 1:168261575-168261597 AGAGGAAATGATTAAGGGCTTGG - Intergenic
917281251 1:173379846-173379868 AGGGGACATGGATGAGGGGGTGG - Intergenic
917457895 1:175201265-175201287 GGAGGCAAGGGTTGAGGGGTTGG - Intergenic
917470872 1:175324795-175324817 GGAGGAAACAGCTGAGGGTTGGG - Intronic
917492830 1:175512957-175512979 TGAGGAAATGGCTGATGCCTTGG - Intronic
917538541 1:175892060-175892082 GGAGGAATTGCCCGAGGGGTGGG + Intergenic
918139637 1:181709543-181709565 AGAAGAAATGAATGAGGGGCTGG - Intronic
918248967 1:182684794-182684816 AGAGGGGATGGCAGAGGGGAAGG + Intergenic
918340835 1:183566886-183566908 AGAGGAAATGGGTCAGGCCTTGG + Intronic
918478116 1:184947703-184947725 AGAGGAAGTGGCAGAGGACTTGG + Intronic
918547530 1:185701516-185701538 AAAGGGAATGACTGAGGGCTGGG - Intergenic
919498186 1:198303140-198303162 TGAGGAAACGGCAGAAGGGTAGG + Intronic
920095426 1:203483484-203483506 AGAGGTAATGGATGCGGGGCGGG - Exonic
920500058 1:206480192-206480214 AGGGGAGATGGGTGGGGGGTGGG + Intronic
920819026 1:209363086-209363108 AGAGGAAAGGAATGAGGGCTTGG - Intergenic
920847741 1:209607798-209607820 AGAGGAGAGGGCTTTGGGGTGGG - Intronic
921275884 1:213519638-213519660 AGAGGATCTGGCTGTGGGGAGGG - Intergenic
922070160 1:222184248-222184270 AGACAAAATGGGTAAGGGGTGGG - Intergenic
922162404 1:223088323-223088345 AGAGGAAAAAGCTGAGGACTCGG - Intergenic
922885906 1:229020252-229020274 AGAGATCATGGCTGATGGGTAGG - Intergenic
923153676 1:231257216-231257238 AGTGGAAAGGGCTGACAGGTAGG - Intronic
923302679 1:232656396-232656418 AGAAGAAATGACATAGGGGTGGG - Intergenic
923727217 1:236517019-236517041 GGAGGAAGTGGGTGAGGTGTAGG + Intergenic
924754925 1:246931979-246932001 AGAGGAAAGGGCGGAGAGGGAGG + Intergenic
924793333 1:247272959-247272981 AGAGGAAAGGGAAGAGTGGTAGG - Intergenic
1062909721 10:1204920-1204942 TGAGGAAATGCCTGTTGGGTGGG - Intronic
1063705356 10:8424990-8425012 GGAGGAAATGGCTGTGGCGTAGG + Intergenic
1065392098 10:25193281-25193303 GCAGAGAATGGCTGAGGGGTAGG + Intronic
1065997239 10:31070306-31070328 AGGGAAACTGGCAGAGGGGTGGG + Intergenic
1066963691 10:42242626-42242648 TGGGGAAGTGGCTGAGGGGTCGG - Intergenic
1067571674 10:47376354-47376376 TGAGGAAAAGACTGAGGGGCAGG + Intronic
1067847655 10:49736532-49736554 ACAGGACATGGCAGAGGCGTTGG + Intronic
1068316463 10:55350014-55350036 AGAGGAAGTGGCTTAGAGCTGGG - Intronic
1068500400 10:57835763-57835785 AGTGGACATGGATGAGGGGGAGG - Intergenic
1068792686 10:61044382-61044404 TGAGGGAATGGGTGTGGGGTGGG + Intergenic
1069200751 10:65612736-65612758 AGAGAAATTGATTGAGGGGTAGG - Intergenic
1069723450 10:70563550-70563572 AGAGGAAGTGGCTCAGGAGAGGG - Intronic
1069945271 10:71981322-71981344 AGAGGAGGAGGCTTAGGGGTGGG - Intronic
1070579599 10:77709966-77709988 GGAGCAAAAGGCTGAGGGGCTGG - Intergenic
1072219603 10:93316324-93316346 AGGAGAAATGGCGGGGGGGTTGG + Intronic
1072260523 10:93666056-93666078 ATATGAAATGGGTGAGGGGTGGG + Intergenic
1072473543 10:95736490-95736512 AGAGAAAATGGCTGGAGGGGTGG - Intronic
1072723580 10:97797019-97797041 TCAGGAAATGGCTGTTGGGTGGG + Intergenic
1073093766 10:100967819-100967841 TGATGAAATGGCTGGGGGGGGGG - Intergenic
1073362942 10:102914970-102914992 ACAGGAAATGTCTGTAGGGTTGG + Intergenic
1074141768 10:110679756-110679778 AGAGGGCTTGGCTGAGGGCTGGG + Intronic
1074320502 10:112397709-112397731 GGAGGAAATGGATTAGTGGTGGG - Intronic
1074559430 10:114521910-114521932 AGAGAAGATGGCCTAGGGGTTGG + Intronic
1074824204 10:117202768-117202790 GGAGGGAATGGCTGCTGGGTGGG + Intronic
1075061011 10:119256629-119256651 AGAGGCGACGGGTGAGGGGTGGG - Intronic
1076801925 10:132834965-132834987 AGAGGAGATGGGTGGGGGCTGGG - Intronic
1077069792 11:663671-663693 AGAGGCAGTCGCTGAGGAGTTGG - Intronic
1077862229 11:6192542-6192564 AGATGAAATAGCTGAGGCATAGG - Intergenic
1077892542 11:6429931-6429953 GGAGCAAATGGCTGACAGGTTGG + Intergenic
1077896967 11:6460336-6460358 TGAGGAGCTGGTTGAGGGGTTGG + Intronic
1079451610 11:20603789-20603811 GGAAGAAATGGCTGAGGAGGAGG + Intronic
1079820950 11:25127529-25127551 AGAGGAAATGGATGCTGGATGGG + Intergenic
1081633088 11:44702554-44702576 AGTGGAGATGGCTGAGGGGTAGG + Intergenic
1083275815 11:61596397-61596419 AGAGGGAGGGGCTGAGGGGCAGG - Intergenic
1083883354 11:65558836-65558858 TGAGGAAAGGGCTAAAGGGTGGG + Intronic
1084153043 11:67300021-67300043 AGGGGAGATGGCTGTGGGGTTGG - Exonic
1084269927 11:68023264-68023286 CGAGGAACTGGCTGAGGGCCGGG - Intronic
1084582133 11:70030597-70030619 AGAGGACATGGCAGAGAGCTGGG - Intergenic
1084955684 11:72690095-72690117 GGAGGAATCGGCTGAGGGGATGG + Intronic
1086741911 11:90379474-90379496 GGATGAAGTGCCTGAGGGGTGGG - Intergenic
1087237224 11:95733478-95733500 TGAGGAAATGGAGGAGGGGTGGG - Intergenic
1087968167 11:104445011-104445033 AGATGAAGTGGGTGAGGAGTGGG - Intergenic
1088314849 11:108497701-108497723 AGAGGAAATGTCAGAGCCGTAGG - Intronic
1088789740 11:113214060-113214082 AGAGGAAACGGCTTTGGGGCTGG - Intronic
1088920538 11:114257382-114257404 AGAGGAAAAAGATGAGGGGCAGG - Intergenic
1088994054 11:114980746-114980768 AGAGGCAGTGAGTGAGGGGTGGG - Intergenic
1089614292 11:119686594-119686616 AGAGGAAGTGGCTGGAGGTTGGG - Intronic
1090260204 11:125314040-125314062 AGAGGAAATAGCTGAGGTCCTGG + Intronic
1090526867 11:127546662-127546684 AGAGGAAATTGCTGAGCAGGTGG + Intergenic
1090529289 11:127574155-127574177 AGAAATAATGGCTGAGGGCTGGG + Intergenic
1091271030 11:134312084-134312106 AGAGGAAATGGATGGGGCGCAGG - Intronic
1091561684 12:1619136-1619158 AGAAGAAATGTCTTAGGGGTGGG - Intronic
1092685881 12:11045453-11045475 AGAGTAAATGTTTGAGGGGATGG + Intronic
1092691770 12:11119449-11119471 AGAGTAAATGTTTGAGGGGATGG + Intronic
1093758506 12:22879355-22879377 AGAGCTAAGGGGTGAGGGGTTGG - Intergenic
1093834411 12:23809227-23809249 AGAGGAACGGGCTGGTGGGTAGG + Intronic
1093996949 12:25653179-25653201 AGACAAAAAGGCTGAGGAGTTGG + Intergenic
1095310955 12:40695901-40695923 AAAGGAAATGGCTAATGGGAGGG - Intronic
1096072333 12:48782350-48782372 AGAGGACACTGCTGAGGGGAGGG - Intronic
1096155887 12:49341415-49341437 AGAGGCACTGGCTGATGAGTGGG - Intergenic
1096449927 12:51730670-51730692 AGAAGAAATGCTTGAGGGGATGG - Intronic
1098268713 12:68749820-68749842 AGAAGACAAGGCTGAGGAGTGGG + Intronic
1099822411 12:87729656-87729678 AGAGGAACTGACTGATGTGTAGG - Intergenic
1100244100 12:92739251-92739273 AGAGGATTTGGCTCACGGGTGGG - Intronic
1100534606 12:95496453-95496475 GGAGGAAATTGGGGAGGGGTGGG - Intronic
1100596512 12:96077085-96077107 AGAGGAAAAGGCTGGTGGGGCGG - Intergenic
1100965464 12:100008369-100008391 AGGAGAAATGGCTGCTGGGTAGG + Intergenic
1101239242 12:102821772-102821794 AAAGGAAAGGGCAGAAGGGTGGG + Intergenic
1102519702 12:113470788-113470810 GGAGGAAATGTTTAAGGGGTTGG + Intronic
1104062038 12:125276840-125276862 AGAGGAATTGATTGAGGGTTTGG + Intronic
1104297112 12:127526475-127526497 AGGGGATATGGATGCGGGGTTGG - Intergenic
1104661773 12:130616568-130616590 AGTAGACATGGCTGATGGGTTGG - Intronic
1104707890 12:130961434-130961456 AGAGAAAATGGAGGAGGGGTGGG - Intronic
1104750442 12:131234977-131234999 GGAGAAAGTGGCTGAGGGGGTGG + Intergenic
1104782278 12:131429485-131429507 GGAGAAAGTGGCTGAGGGGGTGG - Intergenic
1105239602 13:18598055-18598077 CCAGGAAATGGCTGAGCGGCCGG + Intergenic
1105408584 13:20151329-20151351 AGAGGAATGGGTTGTGGGGTTGG - Intronic
1105841903 13:24261026-24261048 AGAGGAGGAGGCTGAGAGGTGGG + Intronic
1105890698 13:24680627-24680649 AGTGGCAGTGGCTGAGGTGTTGG - Exonic
1106939678 13:34764100-34764122 AGAGGAAAAGGGAAAGGGGTAGG - Intergenic
1107026486 13:35806943-35806965 AGTGGTCATGTCTGAGGGGTTGG + Intronic
1107484199 13:40810771-40810793 TGAGGAAGGGGCTGAGTGGTAGG + Intergenic
1107938009 13:45361342-45361364 AGAGGGAAGGGGTGAGGGGAGGG - Intergenic
1108230060 13:48328547-48328569 GGGGGAAATGGCTGATGGGAAGG - Intronic
1108526744 13:51291995-51292017 AGAGTAAATGGCTGAGGTTAAGG - Intergenic
1109112242 13:58336040-58336062 AGAGCAAATGCTTGAGGGGATGG - Intergenic
1110324052 13:74193750-74193772 AGAGGAAGTTGCTGAGAGTTAGG - Intergenic
1110610858 13:77486007-77486029 AGAGGAGATGGCTGGGGCGGGGG + Intergenic
1110780387 13:79458931-79458953 AGAAGAAATGGCTCAGGGATAGG - Intergenic
1111249883 13:85589213-85589235 CGAGGAAATGGGTCAGGGTTGGG + Intergenic
1112556852 13:100476840-100476862 AGAGTACCTGGTTGAGGGGTGGG + Intronic
1112934476 13:104781419-104781441 GGAGGAAATGGCTGGGTGGCTGG + Intergenic
1112934515 13:104781560-104781582 GGAGGAAATGGCTGGGTGGCTGG + Intergenic
1112934542 13:104781645-104781667 GGAGGAAATGGCTGGGTGGCTGG + Intergenic
1113551404 13:111195712-111195734 AGCGGACATGGATGAGGGGGTGG + Intronic
1114454863 14:22847804-22847826 AGAGGAGCTGGATGAGGGGCGGG + Intronic
1115114317 14:29861521-29861543 AGAGTAAATGCTTGAGGGGATGG - Intronic
1115309145 14:31961953-31961975 AGAGCCACTGGGTGAGGGGTGGG + Intergenic
1115848717 14:37569492-37569514 TGTGGCAATGGGTGAGGGGTAGG + Intergenic
1115990905 14:39148490-39148512 GAACGAAATGGCTGATGGGTAGG + Exonic
1116726423 14:48566334-48566356 AGAGGAACTGGATGCTGGGTGGG + Intergenic
1117234325 14:53755135-53755157 AGAATAAATGCCTGAGGGGTTGG + Intergenic
1117381805 14:55171952-55171974 GGAGGGAATGGCTGAGGAATGGG + Intronic
1117558599 14:56911872-56911894 AGAGGAAATCGAGGAGGGTTAGG - Intergenic
1118054947 14:62070004-62070026 AGAGGGAATGGATCAGGAGTGGG + Intronic
1119191617 14:72686523-72686545 TGAGGGAATGGCTGTGGAGTTGG - Intronic
1119429063 14:74553999-74554021 AGGGGAAAGGGCTGAGAGGGTGG + Intronic
1119614909 14:76092523-76092545 AGAGAAAGTTGCTGAGGGGTGGG + Intergenic
1120776116 14:88439885-88439907 AGAGGTGAGGGCTGAGGGGAAGG - Intronic
1120940876 14:89948007-89948029 AGAGAAGATGGCAGACGGGTGGG - Intronic
1120948613 14:90020737-90020759 AGATGATTTAGCTGAGGGGTTGG + Intronic
1121219793 14:92276908-92276930 TGAGTCGATGGCTGAGGGGTGGG + Intergenic
1121272319 14:92646230-92646252 GGAGGAAAGGGCCGAGGGGCGGG - Intronic
1121447630 14:93988533-93988555 AGAGGAGATGGGAGAGGGGATGG + Intergenic
1121595251 14:95157324-95157346 CGAGGAAATGGCGGCGGGGGCGG - Intronic
1121720994 14:96108557-96108579 GGAGGAAAGGGCTGGGGGGCAGG + Intergenic
1121956598 14:98219008-98219030 AGAGGCAATGGCTCAGGGCATGG - Intergenic
1122242135 14:100376076-100376098 AGAGGAAAGGGGCGAGGGGTCGG + Intronic
1122464067 14:101918493-101918515 AGGGGAGAAGGCTGAGGGGTGGG - Intronic
1122464098 14:101918561-101918583 AGGGGAGAAGGCTGAGGGGTGGG - Intronic
1122566227 14:102658581-102658603 ACAGGAAAAGGATGGGGGGTAGG - Intronic
1122574762 14:102734868-102734890 AGAGGAATTAGCTGAGGCTTAGG + Intergenic
1122738020 14:103855041-103855063 AGAGGAAGTGGATGTGGGGAAGG + Intergenic
1123441402 15:20294773-20294795 TGGGGAAATGGCCGAGAGGTCGG + Intergenic
1123491643 15:20786029-20786051 CCAGGAAATGGCTGAGCGGCCGG - Intergenic
1123548146 15:21355123-21355145 CCAGGAAATGGCTGAGCGGCCGG - Intergenic
1124254054 15:28126786-28126808 AGAGGTGATGTCTGAGAGGTGGG - Intronic
1124380749 15:29162772-29162794 AGAGGGACTGGCTGTGGGCTGGG - Intronic
1125738023 15:41942140-41942162 AGAGGAAATGCCTGATCGGGAGG - Intronic
1126201837 15:45995366-45995388 GACGGAAAGGGCTGAGGGGTGGG + Intergenic
1126613622 15:50554192-50554214 AGGGGAAAAGGCTGAAGGTTGGG - Intronic
1126776752 15:52106940-52106962 AGAGGACATGGCTTTGGGGAAGG + Intergenic
1127755303 15:62086233-62086255 TGAGGAAGAGGCTGAGGGGTGGG - Intergenic
1127853198 15:62933481-62933503 AGAGGAAAAGGCTGAAGGGACGG + Intergenic
1128182204 15:65613834-65613856 TGAAGAAAAGGCTGAGGGGTGGG + Intronic
1128249468 15:66154336-66154358 AGAAGAGATGGCTGAGAGCTGGG - Intronic
1128877052 15:71210456-71210478 ATAGGAAGTTGGTGAGGGGTGGG + Intronic
1129500123 15:76028386-76028408 AGAGGAAATAGATGAGGTCTTGG + Intronic
1129700202 15:77763395-77763417 AGAGGGGATGGGTGAGGGCTGGG - Intronic
1131000531 15:88936436-88936458 AGAGGAACTGTCTGAGGCATGGG + Intergenic
1131053081 15:89360680-89360702 ATAGGAAATGGGGGAGGGGGTGG + Intergenic
1131143353 15:89995995-89996017 AGCGGAAATGGCATGGGGGTTGG - Intergenic
1131417232 15:92271049-92271071 AGAGCAATTGGGAGAGGGGTAGG + Intergenic
1131458645 15:92603023-92603045 AGGGGAAAGGGCAGAGGGGAAGG - Intergenic
1131644531 15:94327809-94327831 AGAGGAAATGGTTCAGTTGTGGG - Intronic
1132173053 15:99683351-99683373 AGAGGAATTGGGTGAGGGTAAGG + Intronic
1202956477 15_KI270727v1_random:82353-82375 CCAGGAAATGGCTGAGCGGCCGG - Intergenic
1132755299 16:1481578-1481600 AGAGGAATGGGCTGGGGGGTGGG + Intergenic
1133005663 16:2880241-2880263 AGAGGAAATAGCAGTGGGCTGGG + Intergenic
1134194832 16:12151645-12151667 AGGGGAAATGACTGAGGTGGAGG - Intronic
1134301303 16:12993889-12993911 AGAGGGAATGGCTGGGGGACAGG + Intronic
1134612223 16:15618532-15618554 TGAGGAAATGCATGAGGTGTGGG - Intronic
1135173616 16:20208835-20208857 AGGGGATATGGCTGAGGGGTGGG + Intergenic
1135177804 16:20246391-20246413 AAAGGAAATGGATGATGGGCAGG + Intergenic
1135259522 16:20968783-20968805 AGAGGAGTTGGGGGAGGGGTGGG - Intronic
1135339572 16:21634402-21634424 AGTGGACATGGATGAGGGGGCGG + Intronic
1136719808 16:32310749-32310771 TGGGGAAGTGGCTGAGGGGTTGG - Intergenic
1136724857 16:32349150-32349172 TGGGGAAGTGGCCGAGGGGTCGG - Intergenic
1136838183 16:33517029-33517051 TGGGGAAGTGGCTGAGGGGTTGG - Intergenic
1136843181 16:33555190-33555212 TGGGGAAGTGGCCGAGGGGTCGG - Intergenic
1137291155 16:47052864-47052886 AGAGGAAAAGGCTGAAGAGATGG + Intergenic
1137540933 16:49361142-49361164 AGAGGAAAAGGCTAAGGGGTTGG - Intergenic
1139218021 16:65148498-65148520 AGAAGAAATGATTTAGGGGTGGG + Intergenic
1139371684 16:66473124-66473146 AGCTGAGAGGGCTGAGGGGTTGG + Intronic
1139440936 16:66966463-66966485 AGGGGAAGGGGCTGAGGGCTTGG + Intronic
1140357511 16:74319120-74319142 AGAGGCAATGGCTTTGGGTTAGG - Intergenic
1140742761 16:77956100-77956122 AGAGATAATGCCTGAGGGGATGG + Intronic
1142161597 16:88560610-88560632 AGAGAAAAGGGCTGATGGGCGGG + Intergenic
1142341434 16:89525519-89525541 AGAGGACAGGGATGAGGGGTGGG - Intronic
1203001574 16_KI270728v1_random:168605-168627 TGGGGAAGTGGCGGAGGGGTCGG + Intergenic
1203006623 16_KI270728v1_random:207020-207042 TGGGGAAGTGGCTGAGGGGTTGG + Intergenic
1203148353 16_KI270728v1_random:1817309-1817331 TGGGGAAGTGGCTGAGGGGTTGG - Intergenic
1203153346 16_KI270728v1_random:1855488-1855510 TGGGGAAGTGGCCGAGGGGTCGG - Intergenic
1142741010 17:1932079-1932101 AGGGGAATTTGCTGAGGGCTCGG + Intergenic
1143015195 17:3887858-3887880 AGGGGAAGGGGCGGAGGGGTGGG - Intronic
1143333455 17:6155293-6155315 AGAGGAAAGGGCTAAGGCCTTGG + Intergenic
1143384059 17:6516152-6516174 AGAGAAAATGGGTGAGCTGTTGG + Intronic
1143547396 17:7605936-7605958 AGAGGAAAGGGCTGAGAATTTGG - Intronic
1143768195 17:9151145-9151167 AGAGGGTCTGGCTGCGGGGTGGG + Intronic
1144141224 17:12350369-12350391 AGAGGAAATGGTTGAAGGCATGG - Intergenic
1144543117 17:16165481-16165503 CAAGGAAATGGCTGAGAAGTTGG - Intronic
1144772501 17:17767697-17767719 AGAGGCAAAGGCTGAGGCTTAGG - Intronic
1145301343 17:21640837-21640859 CAAGGAAATGGCTGAGAAGTTGG + Intergenic
1145348958 17:22062465-22062487 CAAGGAAATGGCTGAGAAGTTGG - Intergenic
1145747982 17:27334063-27334085 AGAGGAAATGGAGGAAGGGAAGG - Intergenic
1146062613 17:29615024-29615046 AGAGGCAACGGCAGAGGGTTGGG + Exonic
1146640826 17:34540141-34540163 AGATCATATGGGTGAGGGGTTGG - Intergenic
1146805180 17:35859080-35859102 AGACAAAATGGCTAAGGGGAGGG + Intronic
1147138985 17:38451124-38451146 AGAGGAAATGGGGGAGGGAGCGG + Intronic
1147215085 17:38894195-38894217 AGAGGCAGTGGCTTTGGGGTGGG + Intronic
1147215431 17:38896404-38896426 AGAGGGTAGGGGTGAGGGGTAGG - Intronic
1147918851 17:43904288-43904310 AGAAGGAATGGCTGAGTGGTAGG + Intronic
1148103071 17:45104520-45104542 AGAGGAATGGGCTCAGGGTTTGG + Intronic
1148103459 17:45106706-45106728 ACAAGAAATGGCTAATGGGTTGG - Exonic
1148323158 17:46769618-46769640 AGACGAAGTGGCTGTGGGGTGGG + Intronic
1148693126 17:49544490-49544512 AGAGGAGATGGCAGAGGGGTGGG + Intergenic
1148869698 17:50649607-50649629 AGAGGAGAGAGATGAGGGGTGGG + Intronic
1149771745 17:59327912-59327934 AGAGGAAAGGGCTGAGGGGTGGG + Intergenic
1149895007 17:60422413-60422435 TGAGGAAATGGGAGCGGGGTGGG + Intronic
1150505102 17:65690870-65690892 ACAGGAAGTTGCTGGGGGGTGGG + Intronic
1150695612 17:67402504-67402526 TCAGGAAATGGCGGAGGGGCGGG - Intronic
1150808959 17:68341513-68341535 AGAGGAAGTGGCACAGAGGTTGG - Intronic
1151873259 17:76850891-76850913 AGAGGAACAGGCAGAGGGGTTGG + Intergenic
1152346774 17:79757414-79757436 AGAAGGAATGGGTGAGGGGGAGG - Intergenic
1153662090 18:7333924-7333946 AGAGGAGAGGGCGGAGGGGCAGG + Intergenic
1154449226 18:14460719-14460741 CCAGGAAATGGCTGAGCGGCCGG - Intergenic
1155173759 18:23285829-23285851 AGAGGAAATTGCTGGGCGGGTGG - Intronic
1157976869 18:52338078-52338100 AGAGGGAGGGGCTGAGGGGAGGG + Intergenic
1160381676 18:78461786-78461808 AGAGGAAATATCTGTGTGGTAGG - Intergenic
1160426004 18:78779782-78779804 AGAGGAAATGTCTGGGGAGAAGG + Intergenic
1161327068 19:3669107-3669129 AGAGGAAGAGGCTGAGGGTTGGG + Intronic
1161850943 19:6737682-6737704 AGAGGCAATTGCTGATTGGTTGG - Intergenic
1161993836 19:7700448-7700470 AGAGGAGAAGGCTGAGGCCTGGG - Intronic
1162105541 19:8367505-8367527 AGGGGAGATGCCTGAGGGGCCGG + Intronic
1162136311 19:8557596-8557618 AAAGGAGAGGGCTGAGGGGCTGG - Intronic
1162237345 19:9319638-9319660 AGTGGACATGGGTGAGGGGGCGG + Intergenic
1162490090 19:10986627-10986649 AGAGCGAATGGCTGGGGCGTGGG + Intronic
1163402669 19:17103604-17103626 AGAGGAGGTGGCTGGGGTGTAGG + Intronic
1163490462 19:17614659-17614681 ACAGGAAGTGACTGAGGGTTGGG + Intronic
1163561859 19:18023894-18023916 TGAGGCAGTGGGTGAGGGGTAGG + Intergenic
1163997390 19:21063979-21064001 AGAGAAAATGACTGAGGAGTTGG - Intergenic
1164272515 19:23685837-23685859 GGAGGAATGGGATGAGGGGTAGG + Intronic
1164619575 19:29686580-29686602 AGAGGAGATGGCGGAGGGCCTGG + Intergenic
1164868664 19:31625726-31625748 AGAGGAAAAGGAGGAGGGGGAGG - Intergenic
1165352514 19:35283701-35283723 TGGGGATAAGGCTGAGGGGTGGG + Intronic
1165473691 19:36017530-36017552 TGAGGAAAGGGCTGGGGGCTCGG + Intronic
1165825558 19:38703779-38703801 AGAGGAACTGGGTGGCGGGTTGG + Intronic
1166044133 19:40219556-40219578 AGAGGCACAGGCAGAGGGGTCGG + Intergenic
1167412321 19:49352066-49352088 GGAAGAAGAGGCTGAGGGGTTGG + Intronic
1168212175 19:54898828-54898850 AGAGGAAATTGCTGGGCAGTTGG + Intergenic
1168544861 19:57241740-57241762 AAAGGTGAAGGCTGAGGGGTAGG - Intronic
1202710127 1_KI270714v1_random:14587-14609 AGCAGAAATGTCTGAGGGATGGG - Intergenic
925253672 2:2464142-2464164 AGAGGTACTGGATGAAGGGTAGG + Intergenic
925558051 2:5153823-5153845 GGAGGAAGTGGCTGGGGAGTAGG - Intergenic
926568032 2:14499300-14499322 TGAGTAAATGGCTGAGGGTTTGG - Intergenic
926825087 2:16898389-16898411 TGTAGAAATGGTTGAGGGGTGGG + Intergenic
927887859 2:26729531-26729553 AGAGCAAAAGGCAAAGGGGTGGG + Exonic
928279189 2:29929315-29929337 AGGGAAAATGGATGAGAGGTAGG - Intergenic
928342841 2:30460409-30460431 ATAGAAAAAGGCTGAGGGGGAGG - Intronic
929167393 2:38896823-38896845 AGAGGAATGGGGTTAGGGGTAGG - Intronic
929531675 2:42756610-42756632 AGAGGAAACGGCTTTGGGGAGGG + Exonic
929536612 2:42788042-42788064 GGAGCTAGTGGCTGAGGGGTAGG - Intronic
929545920 2:42855196-42855218 TGGGGAAATGGCTGAGGCCTGGG + Intergenic
929924967 2:46200476-46200498 AGAGCAGAGGGCTGAGGGCTGGG - Intergenic
929985491 2:46727797-46727819 AAAGGAAATTGCTGAGAGGGAGG - Intronic
930221897 2:48754326-48754348 AAAGGAAATGGCAGAGGGGGTGG + Intronic
930741049 2:54832751-54832773 TGAGGGAAGGGATGAGGGGTTGG - Intronic
931252744 2:60548958-60548980 GGGGTAAATGGCTGAGGGTTAGG - Intronic
931544143 2:63362305-63362327 AAAGGAAGTGGGTGAGGGGAGGG + Intronic
931553243 2:63470439-63470461 AGAGGAAATTTCTGAGGAATTGG - Intronic
931829867 2:66039641-66039663 AGAGGAAATGTGTGAGACGTAGG - Intergenic
931984899 2:67731971-67731993 AGATGAAATGGCTCAGGTCTTGG + Intergenic
932412660 2:71556373-71556395 GGAGGAGCTGGCTGGGGGGTGGG + Intronic
933697510 2:85230855-85230877 AGAGGAAAAGCCTGAGGGGATGG + Intronic
934104155 2:88680789-88680811 AGAGGAATTGTTTGTGGGGTTGG - Intergenic
934566380 2:95343895-95343917 AGAGGAAATTGCTTTGGGGTCGG - Intronic
934693083 2:96376936-96376958 AGAGTAAATGCCTGAGGGGATGG + Intergenic
934765062 2:96876009-96876031 AGAGGAGATGGCTGGGAGGAGGG + Exonic
934867218 2:97824158-97824180 AGTGGACATGGGTGAGGGGGTGG - Intronic
936023717 2:109015302-109015324 GGAGGAAGAGGATGAGGGGTTGG - Intergenic
937149391 2:119675265-119675287 AGAGGATCTGGCTGAGAGCTGGG + Intergenic
937533394 2:122857149-122857171 AGGGTAAATGGCTGTGGGGAAGG - Intergenic
938255817 2:129858958-129858980 AGAGCCAATGGGTGTGGGGTTGG + Intergenic
938257777 2:129873397-129873419 AGATGAAATCTCTGAGGTGTAGG - Intergenic
938583558 2:132669210-132669232 GGAAGAAAGGGCTGCGGGGTCGG - Intronic
938647026 2:133342234-133342256 AAAGGAAATGGGGGAGGGGAGGG + Intronic
940267045 2:151849718-151849740 AGCAGAAATGGCTGAAGGCTGGG - Intronic
940421307 2:153482241-153482263 GGAGGAAATGGCTAGGGGGTAGG + Intergenic
941802491 2:169675710-169675732 AGAGGAGATTGCAGATGGGTTGG - Intronic
941809238 2:169738998-169739020 AGAGGAGATGGGGGAGGGGAAGG - Intronic
943240220 2:185374967-185374989 AGAGGAAAAGGCTGAGAGGAGGG + Intergenic
944202439 2:197121935-197121957 AGAGGAAGTGGCTGCGGAGATGG + Intronic
944849885 2:203707686-203707708 AGATGAAGAGACTGAGGGGTAGG + Intronic
944901765 2:204223173-204223195 AGAGGAAGAGGCTCTGGGGTGGG + Intergenic
945125608 2:206506285-206506307 AGAGGAAAAGGCTTATGGGTGGG + Intronic
945185533 2:207135959-207135981 AGAGGAAGTGGCAGAGGGAGAGG - Intronic
945988792 2:216375854-216375876 AGAGGAAATGTCAGAAAGGTAGG + Intergenic
946275959 2:218632027-218632049 AGAGGAAGTGAGTGAGTGGTCGG - Intronic
946362166 2:219225562-219225584 AGAGGAACTGCCTGGGGAGTTGG + Exonic
946369199 2:219270337-219270359 TGAGGAAAGGACTGAGGGCTGGG + Intronic
946543053 2:220706957-220706979 GGAGGAAAGGGCAGAGGGGCTGG - Intergenic
947845318 2:233239144-233239166 GCAGGAAATGGCTGCTGGGTAGG - Intronic
947943524 2:234079754-234079776 ACAGGAAAGGGTTGTGGGGTGGG - Intergenic
948012564 2:234661689-234661711 AAAGGAAATTGCCCAGGGGTGGG + Intergenic
948150927 2:235744223-235744245 AGTGGGAAGGACTGAGGGGTGGG + Intronic
1170031410 20:11947964-11947986 AGGAGAAATGGCAGAGGGGAAGG + Intergenic
1170584051 20:17721096-17721118 AGAGGAAATGAATGCTGGGTAGG - Intronic
1170773986 20:19359439-19359461 AGATGACATGGGTGACGGGTTGG - Intronic
1171093226 20:22305989-22306011 TTAGGGAATGGCTGAGGGGCTGG + Intergenic
1171100595 20:22380060-22380082 CGAGGAAATTGCAGAGGTGTGGG - Intergenic
1171459533 20:25291016-25291038 AGAAGACACGGCTGAGGGGCAGG - Intronic
1171558923 20:26103991-26104013 CAAGGAAATGGCTGAGAAGTTGG - Intergenic
1173366926 20:42394449-42394471 ACAGGAAATGTCTGAGGGCATGG + Intronic
1174064670 20:47855943-47855965 AGAGAAATGGGCTGTGGGGTTGG - Intergenic
1174174627 20:48636980-48637002 AGGAGAAATGGCTGAGGGTGAGG - Intronic
1174662135 20:52222550-52222572 AGAGGAAGTGGGCAAGGGGTGGG - Intergenic
1174804455 20:53593764-53593786 CGAGGAAATGGCCGAGGAGCCGG - Exonic
1175985051 20:62760469-62760491 AGAGGAGATGGGGGAGGGGTGGG - Exonic
1176209841 20:63913977-63913999 AGAGACACTGCCTGAGGGGTGGG - Intronic
1176376276 21:6088301-6088323 AGAGGGGCTGGCTGAGGGGCTGG - Intergenic
1176652097 21:9558635-9558657 CAAGGAAATGGCTGAGAAGTTGG + Intergenic
1177210948 21:18070026-18070048 AAAGGAAATGGGTGGGGGGGGGG - Intronic
1178584716 21:33862460-33862482 AGAAGAAAAGGATGTGGGGTTGG + Intronic
1178915335 21:36702696-36702718 GGAGGATATGGCTGCGGGGTTGG + Intronic
1179572438 21:42285750-42285772 AGAGGAAGTGGCTGATCGCTGGG + Intronic
1179747199 21:43449943-43449965 AGAGGGGCTGGCTGAGGGGCTGG + Intergenic
1180309565 22:11158493-11158515 TGGGGAAGTGGCCGAGGGGTCGG + Intergenic
1180548042 22:16520303-16520325 TGGGGAAGTGGCCGAGGGGTCGG + Intergenic
1181646013 22:24232198-24232220 AGAAGAGCTGGCTGGGGGGTGGG + Exonic
1182211413 22:28680059-28680081 TGGGGAAATGGCCGAGGGGTCGG - Intergenic
1182262260 22:29082350-29082372 AAAGGAAATGGATGGGGGCTGGG - Intronic
1183359806 22:37377562-37377584 AAGGGAAATGGGTGAGGGGTCGG + Intronic
1183430964 22:37765578-37765600 AGAGGAGAAGGCTCAGGGGCAGG - Intronic
1183535479 22:38398446-38398468 CGAGGAAATGGCCGAGGGGCCGG - Intronic
1183716471 22:39536101-39536123 AGAGGAAATGGGCTAGGGGAGGG - Intergenic
1183924888 22:41198574-41198596 AGAGGAAATCACTGAATGGTTGG + Intergenic
1184015425 22:41782467-41782489 AGAGGGAGGGGCTGAGGGGAAGG - Intronic
1184595901 22:45514148-45514170 AAAGGATATGTCTGAGGGGTGGG + Intronic
1184875301 22:47270510-47270532 AGGGTAATTGGCTGGGGGGTAGG + Intergenic
1185013762 22:48331786-48331808 AGAGGAGGTGGCTGAGGGCAAGG + Intergenic
949685833 3:6568978-6569000 ATATGATATGGCTAAGGGGTAGG + Intergenic
949797749 3:7869266-7869288 AGAGGAAGTGTTTGGGGGGTGGG + Intergenic
950001513 3:9660162-9660184 AGAGAAACTGGGTGAGGGGAAGG + Intronic
950228545 3:11256076-11256098 GGAGGTGATGGCTGAGGGGTAGG + Intronic
950644895 3:14371316-14371338 TGAGGAAGAGGCTGAGAGGTGGG - Intergenic
950840005 3:15959064-15959086 AGAGGAAATGGATGCTGGGTAGG - Intergenic
950883525 3:16343288-16343310 AGAGGAAGTGGCTGGGGCCTAGG - Intronic
951390634 3:22099309-22099331 TGAGGAAAGGGCTGAAGGTTTGG + Intronic
951473076 3:23077338-23077360 AGATTAAGTGGCTGACGGGTCGG - Intergenic
951800281 3:26588211-26588233 GGAGGAAAGGGCTGAGGGAATGG - Intergenic
953781438 3:45874575-45874597 ATAGAGAATGGCTGAGTGGTGGG - Intronic
954334100 3:49906116-49906138 AGAGGAAATGGAAGTGGGGGCGG + Intronic
954718186 3:52537475-52537497 AGCAGAAAGGGCCGAGGGGTTGG - Intronic
955065570 3:55531101-55531123 AGAGGCACAGGCTGAGGGGAGGG + Intronic
955972013 3:64445517-64445539 AGAGGGAAGGGAGGAGGGGTAGG - Intergenic
956128837 3:66036644-66036666 AGATGAAATGGAGGAGGGGGCGG - Intronic
956171348 3:66436071-66436093 TTAGGAAAGGGCTGAGGGCTGGG + Intronic
956413666 3:69004733-69004755 TGATGATATGGCAGAGGGGTTGG - Intronic
956796145 3:72720415-72720437 AGAGGAGATAGCAGAGAGGTCGG + Intergenic
957151808 3:76496179-76496201 AGATGAAATGGGTGAGGAGTTGG - Intronic
957473263 3:80689268-80689290 AGATGAATTAGCTGAGGAGTTGG + Intergenic
957899997 3:86476959-86476981 TGGGGAAATGGGTGAGAGGTGGG - Intergenic
958132156 3:89441250-89441272 GGAGGAACTGGCTGAAGGTTTGG + Intronic
958650519 3:96931158-96931180 AGACAAAATGGCTGGGAGGTGGG - Intronic
958734189 3:97990004-97990026 AGAAGAAATGTCTGTGGGTTTGG - Intronic
959207533 3:103329772-103329794 GGAGGAAATGGCTATGGGATAGG - Intergenic
959446127 3:106441941-106441963 AGAAGAAAGGGGTGAGGGGGAGG - Intergenic
959717995 3:109454592-109454614 AGAATAAATGCCTGAGGGGCTGG + Intergenic
960293731 3:115917403-115917425 AGAGGAAATCACTGAGAGATGGG - Intronic
960348536 3:116565098-116565120 AGAGCAAATGGCCGAAGGCTAGG - Intronic
960527865 3:118730910-118730932 AGGGGAAATGGGTGGTGGGTAGG - Intergenic
960823159 3:121755908-121755930 AGGGGAAACTGCTGAGAGGTGGG + Intergenic
962599776 3:136982964-136982986 AGAGGCAAGGGCTGATGGGCAGG + Intronic
963168701 3:142230227-142230249 AGTGGACAGGGGTGAGGGGTAGG - Intergenic
963251145 3:143104612-143104634 AGAGCAATTGGCTGGGGCGTTGG - Intergenic
963803721 3:149701886-149701908 AGAGGCAAAGGCTGGGGGGAAGG - Intronic
964060152 3:152512322-152512344 GGAGGAAACGTCTGACGGGTGGG - Intergenic
964451850 3:156820960-156820982 AATGGAAATGGCTGAGGGCATGG - Intergenic
965611144 3:170545298-170545320 AGAGTAGATGGCAGAGGGGTTGG - Intronic
966201252 3:177361417-177361439 AGGGGAAATGGGGGTGGGGTGGG - Intergenic
966397589 3:179518640-179518662 AGAGGAAATTGCTTGGGGGAGGG - Intergenic
967094587 3:186166681-186166703 AGAGGAAAAGGGTGAGGAGGAGG + Intronic
967583736 3:191188828-191188850 AGTGGACATGGATGAGGGGGCGG - Intergenic
968177524 3:196564105-196564127 AGAGGAAATGACTCAGAGGGAGG + Intronic
969112611 4:4853125-4853147 AGAGAAAACGACTGAGCGGTAGG + Intergenic
969213176 4:5703560-5703582 TGAGGCAGTGGCTGAGGGATTGG - Intronic
969810054 4:9640682-9640704 AGAGGAAATGGCTGGGCAGGTGG - Intergenic
969879500 4:10161421-10161443 TGATGAAATGGCTGACAGGTTGG + Intergenic
970726628 4:19053536-19053558 AGTAGAAATGGGAGAGGGGTTGG + Intergenic
970882503 4:20948409-20948431 AGAGGCAATGGCTGAGCTCTAGG - Intronic
971034940 4:22682959-22682981 AGGGGAGAAGGCTGAGGGGAAGG - Intergenic
972752593 4:42006765-42006787 AGAGGATTTGGCGGTGGGGTTGG + Intronic
973216255 4:47672787-47672809 ATGGGAAATGGAGGAGGGGTGGG + Intronic
973827500 4:54723342-54723364 AGAGGAGATGGCTGAGGCAGAGG - Intronic
975654731 4:76630282-76630304 AGAGGAAAGAGCTGAAAGGTAGG - Intronic
975867307 4:78737283-78737305 AGAGGAAATGGGTGTTGGGTAGG - Intergenic
975913860 4:79299302-79299324 AGAGGAAAGGACTCAGGGTTGGG - Intronic
976219297 4:82743037-82743059 AGTGGAAAGGGCTGGGGGCTAGG - Intronic
977236860 4:94518279-94518301 AGAGGTAATAGCTAAGGGGAAGG + Intronic
978277492 4:106969257-106969279 AGAGGAAAAGGGAGAGGGGAGGG - Intronic
978827954 4:113047543-113047565 TGAGGGAATGAGTGAGGGGTTGG + Intronic
979431370 4:120636247-120636269 GAAGGAAATGGCAGAGTGGTTGG - Intergenic
980542943 4:134218325-134218347 AGAGGCCATGGATGAGGTGTAGG + Intergenic
981085151 4:140676001-140676023 AAAGGAAGTGGTTGAGGTGTGGG - Intronic
981563936 4:146078038-146078060 AGAAGAAATGCCTTAGGGGCTGG - Intergenic
981706149 4:147661047-147661069 AGAGAAAATAGGGGAGGGGTAGG + Intronic
982115582 4:152096037-152096059 AAGGGAGATGGCTGTGGGGTAGG + Intergenic
982701199 4:158661054-158661076 AGTGGATATGGAGGAGGGGTTGG - Intergenic
984278722 4:177641052-177641074 GTAGGGATTGGCTGAGGGGTTGG - Intergenic
984567984 4:181354287-181354309 AGAGGAAATGAGGGAAGGGTTGG + Intergenic
985667881 5:1191572-1191594 AGGGGGAAAGGCTGAGGAGTGGG + Intergenic
986215493 5:5715558-5715580 TGGGGAAATGACAGAGGGGTGGG + Intergenic
986384176 5:7215640-7215662 TGAGGAAATTGTTGAGGGGAAGG - Intergenic
986703478 5:10434491-10434513 AGAGGATGTGGGTGTGGGGTGGG - Exonic
987368128 5:17168296-17168318 AGAGGAAGAGGCAGAGGGGATGG + Intronic
987929960 5:24390231-24390253 AGCGGACATGGATGAGGGGGTGG - Intergenic
988581297 5:32471180-32471202 AGAAGAAGTGGGTGAGGGTTTGG + Intergenic
991444519 5:66684930-66684952 AGAACAAATGGCTATGGGGTTGG + Intronic
993439734 5:87940801-87940823 AGAAGAAAAGGAAGAGGGGTTGG + Intergenic
996086350 5:119309580-119309602 AGAGGAAATGGCAGAAGAGCAGG + Intronic
996450521 5:123617785-123617807 ATAGTAATTGGCTCAGGGGTGGG - Intergenic
996904573 5:128583502-128583524 GGAGGAACTGGGTGAGGGTTGGG + Intronic
997439697 5:133900499-133900521 AGAGTACATGGCTGTGGGGAGGG + Intergenic
997484655 5:134220071-134220093 TCAGTAAATGGCTGAGAGGTGGG - Intronic
997645830 5:135481295-135481317 AGAGGAATGGGCGGAGGGGAAGG + Intergenic
997668509 5:135651297-135651319 AGAGGACATGGTTGAGAGGGAGG - Intergenic
998111528 5:139506400-139506422 AGTGGACATGGATGAGGGGGTGG - Intergenic
998227205 5:140336237-140336259 AGAGGAAATGGAAAAGGGGAGGG - Intronic
1000085301 5:157883095-157883117 AGTGGACATGGATGAGGGGGCGG - Intergenic
1000232671 5:159330693-159330715 AGAGGAAATGACTTTTGGGTGGG + Exonic
1000674852 5:164108127-164108149 AGAGGAATTGGCACAGGGGCAGG + Intergenic
1000763151 5:165251880-165251902 AGAGAGAATGGCTGAGGGGAAGG + Intergenic
1001037748 5:168309812-168309834 AGAGGAGGTGGTTGAGGGCTTGG - Intronic
1001051929 5:168420655-168420677 AGAGGAAAAGGCTGAGGCAGAGG - Intronic
1001569540 5:172721113-172721135 AGAAGGAATGGCTGCTGGGTAGG + Intergenic
1001761642 5:174212605-174212627 AGAGGAGATGGCTAAGTGGCAGG - Intronic
1002254928 5:177951632-177951654 AGAGGAAAACACTGAGGGGATGG - Intergenic
1002436440 5:179234646-179234668 AGCAGCAATGGCTGATGGGTTGG - Intronic
1002949918 6:1799637-1799659 AGAGAAATTGGCTGAGGGGCTGG + Intronic
1003094497 6:3131802-3131824 AGAGGATGTGGCTGAGGGGAAGG - Intronic
1004790208 6:19017201-19017223 GGAGGAAATGGATCAGAGGTGGG + Intergenic
1005331542 6:24755577-24755599 AAAAAAAATGGCTGGGGGGTGGG - Intergenic
1005619080 6:27603437-27603459 AGAGGAAAGGGCTGTATGGTGGG - Intergenic
1006272685 6:32976361-32976383 AGAGGAAATGACTGATGGGTGGG - Exonic
1006506336 6:34491134-34491156 AGAGGAAAAAGCTGAGGAGCGGG - Intronic
1007406848 6:41640271-41640293 AGAGAAAATGGATAAGGGGAGGG - Intronic
1007626722 6:43250829-43250851 AGAGGAAAGGGCAAAGGGGAGGG - Intronic
1007685466 6:43664916-43664938 AGAGCCAGGGGCTGAGGGGTGGG + Intronic
1008055944 6:46946174-46946196 TGAGGAAATGGCAGAGGGAAAGG + Intronic
1008267304 6:49444284-49444306 AGTTAAAATGGCTGTGGGGTGGG - Intronic
1008489303 6:52068890-52068912 TGAAGAAATGTCTGTGGGGTTGG - Intronic
1008674145 6:53801614-53801636 AGAGGTATGGGGTGAGGGGTGGG - Intronic
1008970100 6:57357300-57357322 ATAGGAAATTGCTGAAGAGTTGG - Intronic
1009159066 6:60259115-60259137 ATAGGAAATTGCTGAAGAGTTGG - Intergenic
1009313807 6:62191625-62191647 AGAGGGACAGGCTGATGGGTGGG - Intronic
1009738283 6:67707759-67707781 TGAGTAAATGCCTGAGGGGATGG - Intergenic
1010220123 6:73441651-73441673 AGTGGAGATGGCTGCTGGGTGGG + Intronic
1010314303 6:74428124-74428146 AGAATAAATGCTTGAGGGGTTGG + Intergenic
1012526462 6:100183739-100183761 AGAGGGAAAGGCAGAGGGGGAGG - Intergenic
1013042649 6:106451128-106451150 AAAGGGAATGGCTTTGGGGTAGG + Intergenic
1013455917 6:110329675-110329697 ACAGGAGAAGGCTGAGGGGAAGG - Intronic
1013770406 6:113622070-113622092 AGTGCAAATGGCTAAGGGATGGG - Intergenic
1013821131 6:114154658-114154680 AGATGAAGTGGGTGAGGGGAAGG - Intronic
1013958275 6:115866453-115866475 AGTGGAAATGGCTAGAGGGTGGG - Intergenic
1014413832 6:121159041-121159063 AGAGGAAAAAGCAGAGGGGCTGG - Intronic
1015158578 6:130125940-130125962 AGAAGAAATGGGTGGGGGGGAGG - Intronic
1015896386 6:138020950-138020972 ATATGAAATGGCTGTGTGGTAGG - Intergenic
1016312008 6:142744239-142744261 AGAGAGAATAGATGAGGGGTTGG - Intergenic
1016323509 6:142874017-142874039 ATAGCAAATGGCTGAGTGGAGGG - Intronic
1016800847 6:148167600-148167622 ACAGGGAAGGGCAGAGGGGTGGG - Intergenic
1017029695 6:150210346-150210368 AGATGAACTGGATGAGGGATCGG - Intronic
1017041839 6:150314324-150314346 AGAGGAAAAGGAGGAGGGGGAGG + Intergenic
1017246526 6:152233291-152233313 AGAGGAAATGCCTTTGGGGCAGG + Intronic
1017809046 6:157970881-157970903 AGAGCAAATGGCTGGGGTGAAGG + Intergenic
1018269749 6:162064433-162064455 AGAGGAAATCACTGAAGGATGGG - Intronic
1018414539 6:163590088-163590110 GGGGGAAATAGCTGAGGGGAAGG - Intergenic
1019803267 7:3104357-3104379 AGAGGAGAAGGGTGAGGGATTGG - Intergenic
1020051439 7:5084590-5084612 AGAGGAAAAGGCTCTGGGATTGG + Intergenic
1021634095 7:22674196-22674218 AGAGGAAAGGGATCGGGGGTGGG + Intergenic
1023338357 7:39193319-39193341 AGGGGAAATGGCAGAGAAGTGGG - Intronic
1024177943 7:46860567-46860589 AGTGGAAATGGGTCAGAGGTGGG - Intergenic
1024203217 7:47126961-47126983 GGAGAAAATGCCTGAGGAGTTGG + Intergenic
1025935470 7:66032403-66032425 AGAGGACATGGCTGTTGGATGGG - Intergenic
1025948864 7:66127472-66127494 AGAGGACATGGCTGTGGGATGGG + Intronic
1026371702 7:69706076-69706098 AGAGGAAAAGGCAGAGGGGATGG - Intronic
1029128574 7:98312751-98312773 AGAGGGACTGGGTGAGTGGTGGG + Intronic
1030097050 7:105909814-105909836 AGAGGAGATGGCTGATGGCGGGG + Intronic
1030348724 7:108459746-108459768 AGAGGATAAGGCTTAGGGATGGG - Intergenic
1031395248 7:121265708-121265730 AGAGGAAATGGCACTGGGATAGG + Intronic
1032086430 7:128886372-128886394 AGAAGAGCTGGCTGAGGGGAGGG + Intronic
1032414040 7:131722575-131722597 AGAGGAAATGCCAGAAGGCTTGG + Intergenic
1032885497 7:136133822-136133844 AGAGGAAATAGCTTTGCGGTTGG + Intergenic
1032989026 7:137370434-137370456 AGAGGAAAAGGGTGAGGGGAAGG - Intergenic
1033910908 7:146262094-146262116 AAATGAAATGGCTGAGTGGCAGG - Intronic
1033974515 7:147083256-147083278 AGAGGAAATGGATGTTAGGTCGG + Intronic
1034579919 7:152033204-152033226 AGCGGACATGGATGAGGGGGTGG + Intronic
1035119161 7:156550308-156550330 GGAGGAAAAGGCTGAGGTGCTGG + Intergenic
1035192635 7:157184901-157184923 AGGGCTCATGGCTGAGGGGTGGG + Intronic
1035630656 8:1104464-1104486 AGAGCAGATGCCTTAGGGGTGGG + Intergenic
1036561276 8:9902294-9902316 GGAGGAAATGGAGGAGGGGCAGG - Intergenic
1037702136 8:21284880-21284902 AGAGGAAATGACTACTGGGTGGG - Intergenic
1038049944 8:23799080-23799102 AGATGAGATGGCTGAGAGGCTGG - Intergenic
1038200067 8:25403643-25403665 AGAGGAAGTGACTGAGGTGATGG - Exonic
1038331611 8:26613673-26613695 AGAGGAAATGACAGAGGAGAGGG + Intronic
1038491541 8:27975457-27975479 AAAGGAAGTGGGTGCGGGGTGGG + Intronic
1038835583 8:31117663-31117685 AGAAGAAATGGATGACCGGTGGG - Intronic
1038846879 8:31238185-31238207 AGAGGAAGAGGAAGAGGGGTTGG - Intergenic
1039655823 8:39404563-39404585 AGAAGCCATGGCTGTGGGGTTGG + Intergenic
1039993824 8:42513891-42513913 ACAGGCAAAGGCTCAGGGGTAGG + Intronic
1039999622 8:42565080-42565102 AGCGGACATGGATGAGGGGGTGG + Intergenic
1040649014 8:49429403-49429425 AGTGGACATGGATGAGGGGGTGG - Intergenic
1040971403 8:53140502-53140524 AGAGGACATGGATGAGGGGGTGG + Intergenic
1041649544 8:60288256-60288278 AGGGGAAATGGGTGAGGGGAGGG - Intergenic
1041794146 8:61728709-61728731 AGCTGAAATGGCTGTGGGGAGGG + Intergenic
1042771969 8:72391024-72391046 AGTGGACATGGGTGAGGGGGTGG - Intergenic
1043527843 8:81115588-81115610 AGAAGAAATAGGTGATGGGTAGG + Intergenic
1044700031 8:94957386-94957408 AGAGGAAAGGGCTGAAAGCTGGG + Intronic
1045081936 8:98635038-98635060 AGAGGAAATAAGTGATGGGTAGG + Intronic
1046078494 8:109340925-109340947 AGGGGCAATGACTCAGGGGTTGG - Intronic
1047732694 8:127739239-127739261 AAATGAAATTCCTGAGGGGTGGG - Intronic
1048845816 8:138602815-138602837 AGAGGAGATGGCAGAGGAGCTGG - Intronic
1049368592 8:142252836-142252858 AGAGGAAATGGCTGAGGGGTGGG - Intronic
1049407862 8:142459794-142459816 AGAGCAAATGGGGGAGGGGCTGG - Intronic
1049623152 8:143608135-143608157 AAAGGAAAAGGAAGAGGGGTTGG + Intronic
1049762887 8:144338842-144338864 AGAGGAAGGGGCTGAGAGGGTGG - Intergenic
1049784194 8:144442822-144442844 GGAGGAAGTGGCTGAGTGTTTGG - Intronic
1049826195 8:144670393-144670415 AGGGGAGATGGCAGAGGTGTGGG - Intergenic
1050025706 9:1332602-1332624 AGAGGAAAGGGGAAAGGGGTGGG + Intergenic
1050228793 9:3493778-3493800 AAAGGAAATGGCTTAGGATTTGG - Intronic
1050579692 9:7039799-7039821 AAAGGAAGAGGATGAGGGGTTGG + Intronic
1051361287 9:16283773-16283795 ACAGGAGATGACTGAGGGGATGG - Intergenic
1052291417 9:26845948-26845970 ATATAAAATGGATGAGGGGTAGG + Intronic
1052555628 9:30012714-30012736 AGTGGAAAGTGCTGAGAGGTTGG - Intergenic
1054967980 9:71051583-71051605 AGTGAAAATGGCGGCGGGGTGGG + Intronic
1055862617 9:80771114-80771136 AAAGGAAATTGGTGAGGGCTGGG - Intergenic
1056577764 9:87869101-87869123 AGAGAAGATGGCTGAGGGACAGG + Intergenic
1056692814 9:88822573-88822595 AGAGAAACTGGCTGAGGGAGCGG + Intergenic
1056762243 9:89423972-89423994 TGAGGAAGTAGCTGAGGGGGTGG - Intronic
1056975007 9:91245076-91245098 AGAGGGAAGGGATGAGAGGTGGG + Intronic
1057159502 9:92877889-92877911 AGAGGACGTGGGTGAGGGGCAGG - Exonic
1057874378 9:98742832-98742854 AGAGGGAATGGGTGGGGGGGAGG + Intronic
1058108502 9:101003403-101003425 AGAGAAAGTTGTTGAGGGGTGGG + Intergenic
1058541370 9:106015788-106015810 TGAGGAAAAGGCAGAGGGGGTGG - Intergenic
1058880102 9:109278315-109278337 AGAGGAAGTGGCTGAGGTTGAGG + Intronic
1059067485 9:111100708-111100730 ACAGAAAATGCCTGTGGGGTTGG + Intergenic
1059236389 9:112763993-112764015 GGAGGAAATGGAAGAGGGGTGGG - Intronic
1059239173 9:112788450-112788472 AGAGGAATTGGGCGAAGGGTAGG + Intronic
1059385609 9:113961944-113961966 AGAGGAAATGGCTGTGGACTTGG + Intronic
1059458038 9:114412103-114412125 GGAGCAAATGGCAGACGGGTCGG + Intronic
1060240126 9:121896351-121896373 AAAGTGAAGGGCTGAGGGGTGGG - Intronic
1060492664 9:124096417-124096439 GGAGGAAATGGCAGAGGTTTTGG - Intergenic
1060745748 9:126129759-126129781 AGAGGGAAGGACGGAGGGGTAGG + Intergenic
1061592593 9:131607546-131607568 GGATGCACTGGCTGAGGGGTGGG + Intronic
1062194366 9:135264786-135264808 TGAGGAATTGGCTCAGGGCTAGG - Intergenic
1062512901 9:136917277-136917299 AGAGGAGATAGCTGAGGGGAGGG - Intronic
1062597012 9:137304045-137304067 AGAGGGCATGACTGGGGGGTGGG + Intergenic
1062675382 9:137740178-137740200 AGTGGAAATGGGCGTGGGGTGGG - Intronic
1203629825 Un_KI270750v1:62180-62202 CAAGGAAATGGCTGAGAAGTTGG + Intergenic
1185816267 X:3159165-3159187 AGGGGAAAGGGCTGAGGGAAAGG - Intergenic
1187266277 X:17737210-17737232 TGAGGAGATGGCTGTGGGGCGGG - Intergenic
1188800080 X:34518593-34518615 ACAGGAAATGGCGAAGGGGCTGG + Intergenic
1189020109 X:37326890-37326912 AGAATAAATGCTTGAGGGGTTGG + Intergenic
1189586196 X:42464427-42464449 GGAGGAAAGGGGTGGGGGGTAGG + Intergenic
1190196705 X:48325962-48325984 AGGATAAATGGCTGAGGGGATGG + Intergenic
1190210233 X:48440897-48440919 AGGATAAATGGCTGAGGGGATGG + Intergenic
1190310917 X:49116501-49116523 AGCTGAAATGGTTGAGAGGTGGG - Intronic
1190558284 X:51660463-51660485 AGGGTAAATGCTTGAGGGGTTGG - Intergenic
1190833211 X:54077838-54077860 TGTGGATATGGCTAAGGGGTGGG - Intronic
1191851431 X:65588777-65588799 AAAGCAAATGGTTGGGGGGTGGG - Intronic
1191862418 X:65676799-65676821 AAAGGAAATGGATCATGGGTTGG - Intronic
1192432982 X:71125199-71125221 AAAGGAATTTGCTGAGGGGTTGG + Intronic
1194984282 X:100473354-100473376 ACAAGCAATGGATGAGGGGTGGG + Intergenic
1195063703 X:101220197-101220219 AGGGGAAATGACTGAGGGAGGGG + Intronic
1196525542 X:116724896-116724918 AGAGGAAATTGCTGGGGAGGTGG + Intergenic
1197033113 X:121842591-121842613 AGAGAACAGGGCTGAGGAGTGGG - Intergenic
1197135880 X:123059253-123059275 AGAGGGGAAGGCTGAGTGGTTGG - Intergenic
1197712773 X:129683812-129683834 AGAGGAAATGGGGGTGGGGGCGG + Intergenic
1197722605 X:129755428-129755450 AGAGGAACAGGGTGAGGGGAGGG + Intronic
1198254776 X:134915145-134915167 AGAGGAAGTGGGTGACGGGACGG + Intronic
1198425512 X:136515984-136516006 AAAGGAAATGAATGTGGGGTGGG - Intergenic
1198575613 X:138007240-138007262 AGAGGAAAGGCCTGGGGGATTGG + Intergenic
1198599455 X:138268211-138268233 AGAGGAAATTGCTGAGCAGGTGG + Intergenic
1198869582 X:141161670-141161692 AGAGGTAGGGGGTGAGGGGTGGG + Intergenic
1199186269 X:144919302-144919324 AATGGGAATGTCTGAGGGGTTGG - Intergenic
1199599803 X:149535215-149535237 AGAGGAAAAGGAGGAGGGGGTGG - Intergenic
1199618056 X:149674293-149674315 AGAGTAAATGCTTGAGGGGATGG + Intergenic
1199624586 X:149728956-149728978 AGAGTAAATGCTTGAGGGGATGG - Intergenic
1199770005 X:150969230-150969252 AGAGGACCTGGCTGAGGGGAGGG - Intergenic
1199895901 X:152127707-152127729 AGAGGTACTGGCTGAGGTGGGGG - Intergenic
1200072604 X:153536566-153536588 AAGGGAAATGGCTGAGAGGAGGG - Intronic
1200171021 X:154074834-154074856 AGAAGAAATGGATATGGGGTAGG + Intronic
1200909065 Y:8515065-8515087 ATAGGAAATGTCTCAGGGGCAGG + Intergenic
1200958023 Y:8971054-8971076 ATAGGAAATGTCTCAGGGGCAGG + Intergenic
1201241569 Y:11961894-11961916 AGCAGAAATTGCTGAGTGGTGGG - Intergenic
1201377812 Y:13341373-13341395 AGAGGACATGGCTGTGGTGGAGG + Intronic
1202232334 Y:22670114-22670136 ATAGGAAATGTCTCAGGGGCCGG + Intergenic
1202310822 Y:23526044-23526066 ATAGGAAATGTCTCAGGGGCCGG - Intergenic
1202559980 Y:26144550-26144572 ATAGGAAATGTCTCAGGGGCCGG + Intergenic