ID: 1049368593

View in Genome Browser
Species Human (GRCh38)
Location 8:142252837-142252859
Sequence CAGAGGAAATGGCTGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 462}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368593_1049368608 28 Left 1049368593 8:142252837-142252859 CCACCCCTCAGCCATTTCCTCTG 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data
1049368593_1049368602 15 Left 1049368593 8:142252837-142252859 CCACCCCTCAGCCATTTCCTCTG 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368593_1049368606 21 Left 1049368593 8:142252837-142252859 CCACCCCTCAGCCATTTCCTCTG 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368593_1049368601 0 Left 1049368593 8:142252837-142252859 CCACCCCTCAGCCATTTCCTCTG 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368593_1049368604 17 Left 1049368593 8:142252837-142252859 CCACCCCTCAGCCATTTCCTCTG 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368593_1049368603 16 Left 1049368593 8:142252837-142252859 CCACCCCTCAGCCATTTCCTCTG 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368593 Original CRISPR CAGAGGAAATGGCTGAGGGG TGG (reversed) Intronic
900777596 1:4596255-4596277 CAGAGGACATGGCTAAGGAAGGG + Intergenic
901623054 1:10604673-10604695 CAGAGGAAATGGCTGGAGAAAGG + Intronic
901673792 1:10871107-10871129 CTGGGGAAATGGCTGGGGGCGGG + Intergenic
901718432 1:11175707-11175729 GAGAGGAAAGGGCTATGGGGAGG - Intronic
902238462 1:15073081-15073103 CAGAGCCACTGGCTGAGGGTAGG - Intronic
902767740 1:18628551-18628573 CAGAGGGAAGGGTTGAGGTGGGG - Intergenic
902824044 1:18960457-18960479 CAGGTGAAATGGCTGGGGAGTGG - Intergenic
903552318 1:24166510-24166532 CAGAAGAAAAGGCAGATGGGTGG - Intronic
904810054 1:33157693-33157715 CAGATGAAATGACTGAGGCCTGG - Intronic
905395115 1:37661728-37661750 CAGAGGGAGGGGCTGAGGGCCGG + Intergenic
905517914 1:38575815-38575837 CACTGGCAATGGCTGAGTGGTGG - Intergenic
905634796 1:39543104-39543126 CAGAGGAACCAGCTGAGGTGAGG + Intergenic
905808619 1:40895368-40895390 CAGAGGAAGGGCCTGATGGGAGG - Intergenic
906206217 1:43988129-43988151 CAGAGAAAATGGCACAGGCGTGG + Intronic
906224925 1:44113926-44113948 CAGGGAAAATGGCAGTGGGGTGG + Intergenic
907965216 1:59322438-59322460 CGGAGGAAAGCGCTGGGGGGTGG - Intronic
907972398 1:59396186-59396208 CAGAGAAAATGGCTGAGTCTTGG - Intronic
908663642 1:66465233-66465255 CAGAGAAAATGGCAGAGGAATGG + Intergenic
909159346 1:72126591-72126613 TGGAGGAAATGGCTCAGGGATGG - Intronic
909162222 1:72167226-72167248 CAAAGGAAATGGCTGGAAGGTGG - Intronic
909475023 1:76072988-76073010 CAGAGCAAAGGGGTGAGGGTGGG - Intergenic
910044758 1:82899148-82899170 TACAGGAAATGGCTGATGGGTGG - Intergenic
910330528 1:86068289-86068311 CAGGGGAGATGGGGGAGGGGTGG - Intronic
910422415 1:87080701-87080723 CAGGGGGAATGGAGGAGGGGTGG - Intronic
912382810 1:109256420-109256442 CTGAGGACATGGCTGAGATGGGG + Intronic
913222292 1:116668715-116668737 CAGAGGAAGAGACAGAGGGGAGG + Intergenic
913230468 1:116736778-116736800 CAGAGGAAATGGCAGAAGCCAGG - Intergenic
913438823 1:118875748-118875770 AAGAGGAAATGGCTCTGGGGTGG - Intergenic
914243939 1:145872294-145872316 CAGAGGAAGTGGCTGAGCTAAGG - Exonic
915270524 1:154750315-154750337 CCGAGGAAATGGGTGAGGAGGGG - Intronic
915282637 1:154833085-154833107 CAGAGGCAAGGGCTGGAGGGAGG - Intronic
915608601 1:156971844-156971866 GAGGGGAAAAGGCAGAGGGGTGG + Intronic
915979677 1:160411951-160411973 CAGAGGAAGTGTCTGAGGATTGG + Intronic
916056719 1:161073343-161073365 GAGGGGAAGAGGCTGAGGGGAGG - Intronic
917027358 1:170659029-170659051 GAGAGGAAATTGCTTAGGGTGGG + Intergenic
917591507 1:176480980-176481002 AAGAGGAAAGCGCTGTGGGGTGG - Intronic
917638123 1:176956657-176956679 GAGAGGGAATGGGTCAGGGGAGG - Intronic
917694652 1:177509602-177509624 AAGTTGAAATGGCTGATGGGTGG + Intergenic
918645233 1:186896639-186896661 CATAGGAAATGACAGAGGAGAGG - Intronic
919243650 1:194948802-194948824 CAGGGGAAAGGGTTGAAGGGGGG + Intergenic
919851528 1:201676238-201676260 CAGAGGGAGTGGCTGCTGGGAGG - Intronic
920095427 1:203483485-203483507 TAGAGGTAATGGATGCGGGGCGG - Exonic
920340190 1:205270823-205270845 CAGAGGAGAAGACTGAGGCGTGG - Intronic
920521323 1:206629304-206629326 CAGAGGAAAGGGCAGAGAGGAGG + Intergenic
920694567 1:208172438-208172460 CAGAGGAGATGGAAGAGGAGGGG - Intronic
921275885 1:213519639-213519661 GAGAGGATCTGGCTGTGGGGAGG - Intergenic
1064496111 10:15912040-15912062 CAGAGAGAATGGCTGAGAAGTGG - Intergenic
1064549273 10:16482357-16482379 CAGAGAAAGTGGCTGATGAGAGG - Intronic
1064995783 10:21295908-21295930 CAGAGGAGAAGGCAGAGGGCAGG - Intergenic
1065920258 10:30386946-30386968 CAGAGGGTAGGGCCGAGGGGCGG - Intergenic
1066444616 10:35470358-35470380 CAGAGCAGATGACTGAGGGCTGG + Intronic
1067272684 10:44805642-44805664 CAGAGGCCATGGAGGAGGGGAGG + Intergenic
1069723451 10:70563551-70563573 GAGAGGAAGTGGCTCAGGAGAGG - Intronic
1069920579 10:71813172-71813194 CAGAGGGAGTGGGCGAGGGGCGG + Intronic
1069945272 10:71981323-71981345 CAGAGGAGGAGGCTTAGGGGTGG - Intronic
1070130368 10:73651679-73651701 CCGAGGAAGTGGCAGAGGGAGGG - Intronic
1070526189 10:77297980-77298002 CAAAGTAAATGCCTGAGGGATGG - Intronic
1070546565 10:77457415-77457437 CAGAGGAAAGGACTCTGGGGAGG - Intronic
1072260522 10:93666055-93666077 TATATGAAATGGGTGAGGGGTGG + Intergenic
1072428534 10:95351130-95351152 CAGAGGACAATGCTGAGGGGAGG + Intronic
1072542005 10:96405773-96405795 GTGAGGTCATGGCTGAGGGGAGG - Intronic
1073093767 10:100967820-100967842 TTGATGAAATGGCTGGGGGGGGG - Intergenic
1073497916 10:103911216-103911238 CAGAGGAGAAAGCTGAGAGGGGG + Intronic
1074899105 10:117801518-117801540 CAGAGGAAAGGGCAGCAGGGGGG - Intergenic
1076165732 10:128281076-128281098 CAGAGGAAATGGGGCAGGGCAGG + Intergenic
1076250176 10:128979000-128979022 CACAGGCAATGGGTGGGGGGGGG - Intergenic
1076421286 10:130334344-130334366 CAGAGGAGTGGGTTGAGGGGTGG - Intergenic
1076801926 10:132834966-132834988 CAGAGGAGATGGGTGGGGGCTGG - Intronic
1077497333 11:2892565-2892587 GAGAGGAAATGGGGGAGGGGCGG - Intronic
1077994563 11:7442198-7442220 CAGTGAAAATGGCTGAGGGGAGG + Intronic
1078164903 11:8874156-8874178 CAGAGGAAATGGCTTGCGGGTGG - Intronic
1078585353 11:12581911-12581933 CAGAGCAAATGGCTGAGTCCAGG - Intergenic
1078937738 11:15966322-15966344 CAGAAGCAATGGCAGAGGGCAGG + Intergenic
1079246654 11:18757252-18757274 CAGTGGAAATGCCTCATGGGAGG + Intronic
1080524272 11:33098452-33098474 CAGAGGTAAGGGCAGAGGGAAGG + Intronic
1081202101 11:40229175-40229197 CAGAGGAAAAGGCTGTGTAGAGG - Intronic
1081661833 11:44893154-44893176 CAGAGGAAAGGGCTGGTGGCAGG + Intronic
1082775377 11:57240755-57240777 CAGTGGGAACAGCTGAGGGGAGG - Intergenic
1082834127 11:57639606-57639628 AGGAGGAAATGGGGGAGGGGAGG - Intergenic
1082897587 11:58208832-58208854 GAGAGGAAATGGGGGAGGGAAGG + Intergenic
1082897700 11:58210086-58210108 GAGAGGAAATGGGGGAGGGAAGG - Intergenic
1083721185 11:64604329-64604351 CTGAGTCAATGGCTGAGGGTAGG + Intergenic
1083883353 11:65558835-65558857 CTGAGGAAAGGGCTAAAGGGTGG + Intronic
1084269928 11:68023265-68023287 TCGAGGAACTGGCTGAGGGCCGG - Intronic
1084389176 11:68864013-68864035 GAAGGGAAATGGCTGAGGGCAGG - Intergenic
1085071156 11:73547150-73547172 CAGAGGAAAAGGCGGGGGGGAGG + Intronic
1085384568 11:76149724-76149746 CAGGGGATATGGCTGGGTGGGGG + Intergenic
1085561240 11:77474158-77474180 AAGGGGAAAGGGCAGAGGGGAGG - Intronic
1085850103 11:80109859-80109881 CAGAGCACCTGGCTCAGGGGAGG + Intergenic
1087237225 11:95733479-95733501 CTGAGGAAATGGAGGAGGGGTGG - Intergenic
1088835919 11:113577943-113577965 AACAGGTAGTGGCTGAGGGGTGG - Intergenic
1088851453 11:113706525-113706547 CAGAGGAAAAGGTTATGGGGAGG + Intergenic
1089518678 11:119049473-119049495 CAGAGGAAGGGGGTGAGGGTAGG - Intronic
1089624636 11:119743270-119743292 CACAGGAATTGGCTGGGGGCCGG + Intergenic
1090310529 11:125732739-125732761 AAGAGGAAATGGGTCAGAGGGGG + Intergenic
1091561685 12:1619137-1619159 GAGAAGAAATGTCTTAGGGGTGG - Intronic
1091952576 12:4607262-4607284 CAGATTCAAAGGCTGAGGGGTGG - Intronic
1092798733 12:12141183-12141205 AAGAGGAAAGGGCTGGGGGAGGG + Intronic
1092849362 12:12612626-12612648 CACAGGAAATAGCTCAGAGGGGG - Intronic
1093680972 12:22003119-22003141 CATATTAAATGGCTGAGGAGAGG - Intergenic
1095310956 12:40695902-40695924 TAAAGGAAATGGCTAATGGGAGG - Intronic
1095587328 12:43863694-43863716 CAAAAGCAATGGCTGAGAGGTGG + Intronic
1095692370 12:45104595-45104617 CAAAGACAATGGCTGTGGGGAGG + Intergenic
1096072334 12:48782351-48782373 TAGAGGACACTGCTGAGGGGAGG - Intronic
1096121889 12:49093903-49093925 GACGGGAAATGGCTGAGGCGTGG - Intronic
1096155888 12:49341416-49341438 CAGAGGCACTGGCTGATGAGTGG - Intergenic
1096526530 12:52213321-52213343 CAGAGGGAAGGACTGCGGGGAGG - Intergenic
1096638613 12:52976771-52976793 CAGAGACAAGGGCTGAGGGAGGG + Intergenic
1096647521 12:53046978-53047000 GACAGGAAGTGGCTGAGAGGGGG - Intronic
1096760759 12:53840189-53840211 TACAGGAAGTGGCTGTGGGGAGG + Intergenic
1096791611 12:54048388-54048410 GAGAGGAAAAGGCAGAGGAGAGG - Intronic
1097381440 12:58900018-58900040 CAGGGGTAATGATTGAGGGGGGG - Intronic
1097956915 12:65495689-65495711 AAGAGGAAGTGGGTGGGGGGAGG - Intergenic
1101414467 12:104497338-104497360 CAGAGGAAAGGCCTCATGGGAGG + Intronic
1101428529 12:104607410-104607432 CAGAGGAAAAGGGCGTGGGGAGG + Intronic
1102119407 12:110429111-110429133 AGGGGGAAATGGCTGAGTGGCGG + Intergenic
1102549381 12:113680310-113680332 CAGATGAGATGGCTGAGGGCTGG + Intergenic
1103193111 12:119019451-119019473 GAGGGGAAATGCTTGAGGGGGGG - Intronic
1103270277 12:119667954-119667976 AAGCGGAAGTCGCTGAGGGGTGG + Exonic
1104616938 12:130278494-130278516 GAGAGGAAAAGGCGCAGGGGGGG + Intergenic
1104707891 12:130961435-130961457 GAGAGAAAATGGAGGAGGGGTGG - Intronic
1105384917 13:19920670-19920692 AAGAGGAAGGGGCTGAGGAGGGG + Intergenic
1105841902 13:24261025-24261047 CAGAGGAGGAGGCTGAGAGGTGG + Intronic
1106247737 13:27963232-27963254 CAGAGGACCTGGCTGAGGCTGGG + Exonic
1107938010 13:45361343-45361365 GAGAGGGAAGGGGTGAGGGGAGG - Intergenic
1108623396 13:52205333-52205355 CGGAGGAAATGAGTGAGGGATGG - Intergenic
1110610857 13:77486006-77486028 TAGAGGAGATGGCTGGGGCGGGG + Intergenic
1110791382 13:79590415-79590437 CAGAGGAAATGGGGCAGGGTGGG - Intergenic
1111455795 13:88482195-88482217 CAGAGGAAAGGAGTGAGAGGTGG + Intergenic
1112556851 13:100476839-100476861 CAGAGTACCTGGTTGAGGGGTGG + Intronic
1112934532 13:104781610-104781632 TGGAGGAAATGGCTGGGTGGAGG + Intergenic
1112934537 13:104781627-104781649 TGGAGGAAATGGCTGGGTGGAGG + Intergenic
1114450416 14:22821935-22821957 GGGAGGAAAAGGCCGAGGGGAGG + Intronic
1114454862 14:22847803-22847825 GAGAGGAGCTGGATGAGGGGCGG + Intronic
1117352491 14:54895201-54895223 CAGTGAAAATGGCTGAGGTGGGG + Intronic
1117488709 14:56225227-56225249 CAGAGGCACAGGCTGAGGTGGGG + Intronic
1119549137 14:75495665-75495687 AAGGGGAAAAGGGTGAGGGGAGG - Intergenic
1119614908 14:76092522-76092544 GAGAGAAAGTTGCTGAGGGGTGG + Intergenic
1121272320 14:92646231-92646253 CGGAGGAAAGGGCCGAGGGGCGG - Intronic
1121275864 14:92667085-92667107 CAGAGGAATTGGATGGGAGGGGG + Intronic
1121649966 14:95550629-95550651 CCAAGGAAAAGGCTGGGGGGTGG - Intergenic
1122218894 14:100222750-100222772 CAGAGGAAATGCCAAAGAGGAGG + Intergenic
1122464068 14:101918494-101918516 GAGGGGAGAAGGCTGAGGGGTGG - Intronic
1122464099 14:101918562-101918584 AAGGGGAGAAGGCTGAGGGGTGG - Intronic
1122581283 14:102773288-102773310 CAGAGGAAATGGGGGTGGGGAGG - Intergenic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1124087415 15:26563762-26563784 TACAGGAAATGGCTGGGTGGTGG + Intronic
1124255161 15:28135123-28135145 CAGAGGAAATAGCAGGGGTGAGG - Intronic
1124569147 15:30844484-30844506 CAGAGGAAATAGCAGGGGTGAGG + Intergenic
1124904691 15:33857651-33857673 GAGAGGAAATGGGGAAGGGGTGG - Intronic
1127755304 15:62086234-62086256 ATGAGGAAGAGGCTGAGGGGTGG - Intergenic
1128182203 15:65613833-65613855 GTGAAGAAAAGGCTGAGGGGTGG + Intronic
1128249469 15:66154337-66154359 CAGAAGAGATGGCTGAGAGCTGG - Intronic
1128518631 15:68360733-68360755 CAGAGGAAATGGCAGAGCCAGGG - Intronic
1129234461 15:74215595-74215617 CAGAGATAATGGGAGAGGGGAGG + Intergenic
1129479061 15:75808541-75808563 CAGAGGGCAGGACTGAGGGGTGG + Intergenic
1129688528 15:77700092-77700114 CAGAGGGGAGGGCTGAGGGCAGG + Intronic
1130004115 15:80078204-80078226 TAGAGGAAAGGGCTGGGGAGAGG - Intronic
1130018097 15:80202673-80202695 CAGAGGAATAGACTGAGGAGGGG + Intergenic
1130117022 15:81014280-81014302 CAAAAGACATGGCTGATGGGAGG - Intronic
1130634982 15:85609824-85609846 CAGAGAAAATGGAAGAGAGGAGG - Intronic
1131644532 15:94327810-94327832 CAGAGGAAATGGTTCAGTTGTGG - Intronic
1131762722 15:95641867-95641889 CAGAGGAGATGCCTGGGGAGAGG + Intergenic
1132113671 15:99120404-99120426 CAGAGGGAATGGCCAGGGGGAGG + Intronic
1132156351 15:99498355-99498377 CAGAGCACATGGCCCAGGGGTGG - Intergenic
1132197317 15:99925470-99925492 CAGAAGAAAAGGCTGAGGATGGG - Intergenic
1132198148 15:99929281-99929303 CAGAAGAAAAGGCTGAGGATGGG + Intergenic
1132719305 16:1308133-1308155 GAGAGGAAATGAGTGAGGGAGGG + Intergenic
1132755298 16:1481577-1481599 AAGAGGAATGGGCTGGGGGGTGG + Intergenic
1132890105 16:2199606-2199628 CAGAGGAAGGGGCTGCGGGCTGG - Intergenic
1134138721 16:11698034-11698056 CAGAGTAAATGACTGAGTGTGGG + Intronic
1135173615 16:20208834-20208856 CAGGGGATATGGCTGAGGGGTGG + Intergenic
1135721528 16:24822255-24822277 CAGAGGAAACAGCAGAGGAGTGG + Intronic
1135877506 16:26216837-26216859 CAGATTAAATAGCTGAGGGCTGG + Intergenic
1135944927 16:26857463-26857485 CAAAGGAAAGGGCAGATGGGAGG - Intergenic
1136401432 16:30021414-30021436 GAGTGGAAATGGCTGTTGGGAGG + Intronic
1137800743 16:51259901-51259923 CAGAGGAAATGGGCAGGGGGAGG - Intergenic
1137832522 16:51557651-51557673 CAGAAGATGTGGCTGAGTGGAGG + Intergenic
1138376176 16:56565369-56565391 CTCAGGGAATGGCTGAGAGGGGG + Intronic
1138533353 16:57646877-57646899 CAGAGGGAGTGGCTGAGCAGGGG - Intronic
1139218020 16:65148497-65148519 CAGAAGAAATGATTTAGGGGTGG + Intergenic
1139482493 16:67238172-67238194 CAGAGGTCATGGGAGAGGGGCGG + Intronic
1139654306 16:68378014-68378036 CAGAGGAAAGGGCAGTGGAGGGG - Intronic
1141690764 16:85594972-85594994 CAGGGGAACAGGCAGAGGGGCGG + Intergenic
1142067743 16:88072496-88072518 CACAGGAAAGGGCTGTGTGGAGG - Intronic
1142161596 16:88560609-88560631 CAGAGAAAAGGGCTGATGGGCGG + Intergenic
1142169647 16:88614997-88615019 CAGAGGGAATGGAGGAGGTGGGG - Intronic
1142169693 16:88615146-88615168 CAGAGGGAATGGAGGAGGTGGGG - Intronic
1142341435 16:89525520-89525542 CAGAGGACAGGGATGAGGGGTGG - Intronic
1143139784 17:4735137-4735159 CATAGGAAAGGGCTGCGGTGAGG + Exonic
1143335071 17:6166004-6166026 CAGGGGAAATGGCAAAGGCGAGG - Intergenic
1143387448 17:6540101-6540123 CAGAGGGAAAGGCTGCAGGGAGG + Intronic
1143764621 17:9129333-9129355 CAGAGGGAACAGCTGAGGGGAGG + Intronic
1144701400 17:17343301-17343323 CAGAGGAAATGGCACATGTGAGG + Intronic
1144783125 17:17817646-17817668 CAGAGGATATGGCTGGGAGTGGG + Intronic
1144968097 17:19090271-19090293 CAGCGGAAATTGCTGTGGGATGG + Intergenic
1144979820 17:19161792-19161814 CAGCGGAAATTGCTGTGGGATGG - Intergenic
1144988402 17:19216440-19216462 CAGCGGAAATTGCTGTGGGATGG + Intronic
1145057636 17:19713989-19714011 CAGTGGAAACGGCTGACGCGGGG - Intronic
1145075765 17:19853498-19853520 CATAGAAACTGCCTGAGGGGTGG - Intronic
1146805179 17:35859079-35859101 GAGACAAAATGGCTAAGGGGAGG + Intronic
1147215084 17:38894194-38894216 CAGAGGCAGTGGCTTTGGGGTGG + Intronic
1148071407 17:44910928-44910950 CAGAAGAGATGGGTGAGGTGAGG + Intronic
1148323157 17:46769617-46769639 CAGACGAAGTGGCTGTGGGGTGG + Intronic
1148459653 17:47831825-47831847 CAGAGAAAATTGCTGGGGTGAGG - Exonic
1148645855 17:49219453-49219475 AAGAGGAAATGGAGGAGGGGCGG - Intronic
1148693125 17:49544489-49544511 AAGAGGAGATGGCAGAGGGGTGG + Intergenic
1149429532 17:56586619-56586641 CAGAACAAATGGGTGAGGAGAGG - Intergenic
1149771744 17:59327911-59327933 GAGAGGAAAGGGCTGAGGGGTGG + Intergenic
1150454335 17:65294652-65294674 GGGAGGAAAAGGCTGAGGGCAGG + Intergenic
1150695613 17:67402505-67402527 GTCAGGAAATGGCGGAGGGGCGG - Intronic
1150876584 17:68977270-68977292 CAGAGGTAATAGATGAGGGGGGG + Intronic
1151766560 17:76136147-76136169 GGGAGGAAGGGGCTGAGGGGTGG - Intergenic
1152076121 17:78161050-78161072 CAGAGGGAATAGGTGATGGGCGG - Exonic
1152250232 17:79208656-79208678 CAGAGGCAGAGGCAGAGGGGAGG + Intronic
1152770227 17:82163042-82163064 CTGAGGAAGGGGCTGTGGGGAGG - Intronic
1153633025 18:7089782-7089804 CATAGGAAAGGTGTGAGGGGTGG + Intronic
1153743608 18:8154102-8154124 CAGAGGTGATGGCTGATGAGTGG + Intronic
1153950545 18:10054383-10054405 CAGAGGGAATGGCTGCAGAGAGG + Intergenic
1155549575 18:26950716-26950738 CAGAGGGAAGGGTTGAGGGAGGG + Intronic
1157600325 18:48889521-48889543 CAGAGGCAGTGGGAGAGGGGAGG + Intergenic
1157976868 18:52338077-52338099 CAGAGGGAGGGGCTGAGGGGAGG + Intergenic
1158452302 18:57578181-57578203 CAGTGCATATGGCTGAGGTGGGG + Intronic
1159947205 18:74453228-74453250 CAGAGGTCATGTCTGAGGGCCGG + Intronic
1160175736 18:76592566-76592588 CAGAGGAAACGGCCCAGAGGGGG - Intergenic
1160793460 19:933370-933392 CAGAGGAAGTGGCCGGGCGGGGG + Intronic
1161327067 19:3669106-3669128 TAGAGGAAGAGGCTGAGGGTTGG + Intronic
1161378286 19:3951075-3951097 CAGGGAAGATGGCTGTGGGGAGG - Intergenic
1161993837 19:7700449-7700471 CAGAGGAGAAGGCTGAGGCCTGG - Intronic
1162346462 19:10120918-10120940 AAGAGGGAGTGGCTGAGGGGAGG - Intergenic
1162375083 19:10300074-10300096 CAGAGGAGGAGGCTGTGGGGAGG - Intergenic
1162490089 19:10986626-10986648 CAGAGCGAATGGCTGGGGCGTGG + Intronic
1162733092 19:12730669-12730691 CAGAAGTGATGGCTAAGGGGAGG + Exonic
1163216535 19:15882305-15882327 CAGAGGCCAGGGCTGAGGGAGGG + Intronic
1163545211 19:17937309-17937331 CACTGGAGATGGCAGAGGGGAGG + Intronic
1163548697 19:17953212-17953234 CAAAGGAAATCCCTGGGGGGAGG + Intronic
1163873103 19:19841602-19841624 CAGAAGAAAATGCTGAGTGGAGG - Intergenic
1163954097 19:20618465-20618487 CAGAAGAAAATGCTGAGTGGAGG + Intronic
1163961614 19:20701107-20701129 CAGAAGAAAATGCTGAGTGGAGG - Intronic
1164600607 19:29560872-29560894 CAGGGGAAATGGCTAACAGGAGG - Intronic
1164636342 19:29794182-29794204 CAGGGGGAAAGGGTGAGGGGGGG + Intergenic
1164867445 19:31616573-31616595 CAGAGAAAATGGCTGACATGTGG - Intergenic
1165891262 19:39113617-39113639 CTGAGCAAAGGCCTGAGGGGGGG - Intergenic
1166732721 19:45067975-45067997 CAGAGGACATGGTTGGGAGGGGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167679169 19:50909088-50909110 CAGAGGGAAGGGCTGGGAGGCGG - Intronic
1167719214 19:51167343-51167365 CAGAGAAGAGGGCTGTGGGGAGG - Intergenic
925071940 2:976721-976743 CAGAGGACAGGGCTGGGGAGTGG - Intronic
925662060 2:6213149-6213171 CAGGAGACCTGGCTGAGGGGAGG + Intergenic
925854525 2:8116894-8116916 CAGAGGACAGGACTGAGGTGTGG - Intergenic
926151447 2:10427857-10427879 GAGAGGGAAGGGCTGGGGGGAGG - Intergenic
926786261 2:16521430-16521452 AGAAGGAAATGGCTGAGTGGGGG - Intergenic
927627087 2:24733116-24733138 GAGAGTAAATGGCTGCGGGTTGG + Intronic
928284754 2:29980114-29980136 GAGAGGAGATAGCTGAGAGGAGG + Intergenic
929099226 2:38293329-38293351 CACATGAAAGGGCTTAGGGGAGG - Intergenic
929531674 2:42756609-42756631 GAGAGGAAACGGCTTTGGGGAGG + Exonic
929640942 2:43579261-43579283 CAGAGGCATTGGTGGAGGGGAGG - Intronic
930223301 2:48767455-48767477 CAGAGCAACTGGGGGAGGGGTGG - Intronic
931544142 2:63362304-63362326 GAAAGGAAGTGGGTGAGGGGAGG + Intronic
933765472 2:85705659-85705681 GACTGGAAATGGCTGGGGGGAGG + Intergenic
934614219 2:95761345-95761367 CAGAGGCAATGGGTGGTGGGTGG + Intergenic
934765061 2:96876008-96876030 AAGAGGAGATGGCTGGGAGGAGG + Exonic
935089903 2:99885127-99885149 CAGATGAGAAGGCTGAGGGCAGG - Intronic
935809296 2:106781419-106781441 CAAAGCAAATGGCTGAGATGGGG + Intergenic
937310432 2:120899450-120899472 CTGAGGAACAGGCTGTGGGGTGG - Intronic
937312218 2:120909344-120909366 CAGAGATAGTGGCTGAGGGAAGG - Intronic
938292482 2:130157474-130157496 CAGAGCAACTGGCTCAGGGCGGG - Intronic
938647025 2:133342233-133342255 GAAAGGAAATGGGGGAGGGGAGG + Intronic
938723071 2:134083643-134083665 AAGAGAAAAAGGCTGGGGGGAGG - Intergenic
939243722 2:139595488-139595510 AAGAGGAAGAGGGTGAGGGGAGG - Intergenic
939914363 2:148021133-148021155 GAGAGGCAGTGGCAGAGGGGGGG + Intronic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
942186631 2:173430252-173430274 AAGAGAAAATGGCTAAGGAGAGG - Intergenic
942332810 2:174845768-174845790 CAGAGCATATGGGTGGGGGGGGG + Intronic
943240219 2:185374966-185374988 CAGAGGAAAAGGCTGAGAGGAGG + Intergenic
943789178 2:191912432-191912454 CAGAGGAGTTGGCGGGGGGGCGG - Intergenic
943795921 2:191993637-191993659 CAGAGGAAATAGCTATGAGGAGG - Intronic
944037479 2:195312849-195312871 AAGAGGAAAGGGAGGAGGGGAGG + Intergenic
945125607 2:206506284-206506306 CAGAGGAAAAGGCTTATGGGTGG + Intronic
945900866 2:215535961-215535983 ATGAGGAAGTGGCTGAAGGGTGG + Intergenic
946132810 2:217620689-217620711 CAGAAAAAATGACTGGGGGGGGG - Intronic
947223602 2:227819067-227819089 CAGAGGAAAGGGAGGTGGGGTGG + Intergenic
947535092 2:230935065-230935087 CAGAGGAAACGCCTGGGGTGGGG + Intronic
947943525 2:234079755-234079777 CACAGGAAAGGGTTGTGGGGTGG - Intergenic
948012563 2:234661688-234661710 CAAAGGAAATTGCCCAGGGGTGG + Intergenic
948093589 2:235315917-235315939 GAGAGGAAATAGCCTAGGGGTGG + Intergenic
948192913 2:236073900-236073922 CAGCGGAAATGCTTGGGGGGAGG - Intronic
948403013 2:237697783-237697805 GAGAGGAAACGGCACAGGGGAGG + Intronic
948920680 2:241064608-241064630 CAGCCGGACTGGCTGAGGGGAGG - Intronic
949053173 2:241908674-241908696 TAGGGGAGAAGGCTGAGGGGAGG + Intergenic
1170800372 20:19585318-19585340 TACAGGAAACAGCTGAGGGGTGG - Intronic
1172808696 20:37631922-37631944 CAGAAAAAATGGCCCAGGGGAGG - Intergenic
1173019860 20:39258059-39258081 CATAGGAAAGGGGAGAGGGGAGG - Intergenic
1173375477 20:42478593-42478615 CAGAGGAAATAGCTGGGCAGAGG - Intronic
1173809486 20:45947494-45947516 CAAAGGCAATGGCTCAGGGTGGG - Intronic
1174057903 20:47811103-47811125 GAGCAGAAAGGGCTGAGGGGAGG + Intergenic
1174533453 20:51232973-51232995 CAGAGGAGAGAGCGGAGGGGTGG - Intergenic
1175622966 20:60466288-60466310 CAGAGGACATTGCTGAGTGGAGG + Intergenic
1175985052 20:62760470-62760492 AAGAGGAGATGGGGGAGGGGTGG - Exonic
1175993298 20:62800471-62800493 CAGACCAAATGGATGAGAGGCGG + Exonic
1176058414 20:63161018-63161040 CAGAGGAGGTGACTGAGTGGGGG - Intergenic
1176387632 21:6146802-6146824 CAGAACAAAAGGCTGAGGGAGGG - Intergenic
1177210949 21:18070027-18070049 CAAAGGAAATGGGTGGGGGGGGG - Intronic
1178038130 21:28608417-28608439 CAGAAAAAATGGCTGATAGGAGG + Intergenic
1178824609 21:36004917-36004939 CAGGGGAAAGGGGGGAGGGGAGG + Intergenic
1179437255 21:41370289-41370311 CAGAGGAAATGGGACAGGAGAGG + Intronic
1179554129 21:42161983-42162005 CAGAGGAAGTGGCAGAGCGGGGG + Intergenic
1179603606 21:42497165-42497187 CAGAGGAAATGGGAGATGTGAGG - Intronic
1179735840 21:43391446-43391468 CAGAACAAAAGGCTGAGGGAGGG + Intergenic
1180059989 21:45379815-45379837 CAGAGGAAATGGAAGAGGAAGGG - Intergenic
1181620062 22:24084974-24084996 GAGAGGAAAAGTATGAGGGGAGG - Intronic
1181620796 22:24089944-24089966 CTCAGGAAATGGCTGATGGCAGG - Intronic
1181965542 22:26654173-26654195 CAGAGATAAGGGCTGATGGGAGG - Intergenic
1182014372 22:27026651-27026673 CACAGGAACTGGCCCAGGGGAGG + Intergenic
1182643942 22:31792154-31792176 GAAAGGAAATGGCTGGGGTGGGG - Intronic
1183090455 22:35518774-35518796 CAGAGGAAAAGGGGGAGGGGAGG - Intergenic
1183716472 22:39536102-39536124 AAGAGGAAATGGGCTAGGGGAGG - Intergenic
1184109052 22:42384521-42384543 CCCAGGACATGGCTGAGAGGTGG - Exonic
1184266323 22:43348627-43348649 AAGAGGAAAGGCCTGACGGGAGG + Intergenic
1184568840 22:45309792-45309814 CAGAGGATCTGGCGGCGGGGCGG + Intronic
1184595900 22:45514147-45514169 GAAAGGATATGTCTGAGGGGTGG + Intronic
1184608578 22:45588258-45588280 CAGAGGGAATGGCAGAGTGCTGG + Intronic
1184643717 22:45885292-45885314 CAGACAAATTCGCTGAGGGGAGG - Intergenic
1184754651 22:46509012-46509034 CAGAGAAAATGGCTGAGCGCTGG - Intronic
1184908504 22:47509164-47509186 CAGAGGAAAGGGCTCCTGGGGGG + Intergenic
1184914884 22:47562604-47562626 CAAAGAAAGTGGCTGATGGGAGG + Intergenic
1184985742 22:48132214-48132236 CATAGAGAATGGCTGAGGGGAGG - Intergenic
949932364 3:9088917-9088939 CGGAGGACATGGCTGGGTGGAGG - Intronic
950484119 3:13262872-13262894 CACAGGAAGTGGCTGGGGGAGGG + Intergenic
950529363 3:13544350-13544372 CAGAGGTAAGGGCTGAGAGGAGG - Intergenic
950583178 3:13876319-13876341 AAGAGGAGATGGCTGAGGGCTGG + Intronic
950644896 3:14371317-14371339 CTGAGGAAGAGGCTGAGAGGTGG - Intergenic
951530034 3:23690082-23690104 GAGAGGAAAAGGCTGAAGAGAGG - Intergenic
952648063 3:35686183-35686205 CAGAAGACGTGGCTGAGGTGGGG - Intronic
954271931 3:49516754-49516776 TTGAAGAAATGGCTGAGGGAGGG - Intronic
954602157 3:51878235-51878257 CAGAAGAAATGCCTGAGGCAGGG - Intergenic
954608064 3:51929085-51929107 CAGAAGAAATGCCTGAGGCAGGG - Intergenic
954905856 3:54062267-54062289 CAGGGGAAATGGCATGGGGGGGG - Intergenic
955029419 3:55201904-55201926 CAGAGCAGATGGCTGATGGCCGG + Intergenic
955065569 3:55531100-55531122 GAGAGGCACAGGCTGAGGGGAGG + Intronic
955493815 3:59510394-59510416 AAGAGCAAATGGCTGACAGGTGG + Intergenic
955581467 3:60427569-60427591 CAGAGGAAAAGACAGAGGGAAGG - Intronic
957899998 3:86476960-86476982 CTGGGGAAATGGGTGAGAGGTGG - Intergenic
960048822 3:113221844-113221866 CAGAGGGAAGGGGTGAGGTGAGG - Intronic
960773104 3:121216786-121216808 CAGAGCACCTGGCGGAGGGGTGG - Intronic
962431086 3:135320661-135320683 CTGAGGCAATGGCTCAGGTGAGG + Intergenic
965648255 3:170908045-170908067 CAGAGGAGCTCGCTGAGGGTGGG + Intronic
966397590 3:179518641-179518663 AAGAGGAAATTGCTTGGGGGAGG - Intergenic
968464381 4:743162-743184 CACAGGCAGTGGCTGAGGTGGGG + Intronic
969317035 4:6388579-6388601 CAGAGGCAGAGGCTGAAGGGAGG + Intronic
969543179 4:7806690-7806712 CAGGGGAAAGGGGAGAGGGGAGG - Intronic
970446266 4:16125697-16125719 CACAGGAAAAGGCAGTGGGGCGG - Intergenic
972664317 4:41149456-41149478 CAGGGGAAAGGGCTGAGGAAAGG + Intronic
973277661 4:48327031-48327053 CAGTGGATATGGGTGAGGGGTGG - Intergenic
974415393 4:61600017-61600039 AAGAGGAAATGGGCGAGGCGTGG + Intronic
974416275 4:61611218-61611240 CAGAGGAAATAGATGAGATGCGG + Intronic
977615988 4:99088375-99088397 CAGTGGAAATGGCTTAGGAGCGG - Intronic
978277493 4:106969258-106969280 GAGAGGAAAAGGGAGAGGGGAGG - Intronic
980954761 4:139417036-139417058 CAGAGGAAATGGATGAATGGAGG - Intronic
981114198 4:140970795-140970817 CAGTGCAAATGGCAGTGGGGAGG + Intronic
985696931 5:1345957-1345979 CAGAGGACTTGGCTGACGGGCGG + Intergenic
985940122 5:3128707-3128729 CAGAGTGAAGGGATGAGGGGAGG + Intergenic
986441392 5:7785482-7785504 CAGAGAAAATGCAAGAGGGGTGG - Intronic
987563502 5:19555133-19555155 CAGGGAAAATGGCGGAGAGGAGG + Intronic
987872223 5:23635448-23635470 CACAGGAAATGGGTCGGGGGAGG - Intergenic
988615465 5:32770753-32770775 CAGAGGAAATGGCTGCATGTAGG + Intronic
988833254 5:35007405-35007427 CAGAGGAATTCTCTGAAGGGTGG + Intronic
989098781 5:37805714-37805736 CAGAGAAAATGGCTGGGGCAAGG + Intergenic
990982845 5:61617142-61617164 CTGAGAAAGAGGCTGAGGGGAGG + Intergenic
991927554 5:71719731-71719753 CACAGGGAATGGTCGAGGGGTGG - Intronic
991957713 5:72012444-72012466 CAGAGGACATGGGTTAGAGGAGG - Intergenic
992027122 5:72681362-72681384 CAGAGTGCTTGGCTGAGGGGTGG + Intergenic
992076458 5:73196941-73196963 CAGAGCAAAGGGCTGAGAGAAGG - Intergenic
992406397 5:76461597-76461619 CAGAGGAGATGGATGAGAGGAGG + Exonic
994103244 5:95916802-95916824 CAGAGGAAGTGGGAGAGAGGGGG + Intronic
994121668 5:96120842-96120864 CAGTGAAAATGGCTTAGGGCAGG - Intergenic
994454443 5:99986072-99986094 GAGAGGAAAGGGGTGGGGGGGGG + Intergenic
994920741 5:106039795-106039817 CAGAAGAAAAGGCTGAGTGTAGG - Intergenic
995640621 5:114252676-114252698 CAGAGAAAATGGCAGAGGTTGGG - Intergenic
996450522 5:123617786-123617808 CATAGTAATTGGCTCAGGGGTGG - Intergenic
997439696 5:133900498-133900520 GAGAGTACATGGCTGTGGGGAGG + Intergenic
997512002 5:134460509-134460531 CAGAGGTGATGGCTCAGGGAGGG - Intergenic
997951154 5:138243571-138243593 AAGAGGAAATGGCTGGCTGGGGG - Intergenic
998071596 5:139202092-139202114 AAGAGGAAGGGGCCGAGGGGAGG - Intronic
998227206 5:140336238-140336260 CAGAGGAAATGGAAAAGGGGAGG - Intronic
998457898 5:142287825-142287847 CACAGGAAAAGGCTGGCGGGTGG + Intergenic
999142283 5:149370527-149370549 CACAGGAATTGGTTCAGGGGTGG - Intergenic
999481927 5:151956543-151956565 CAGATGACATGGACGAGGGGAGG + Intergenic
999654905 5:153801937-153801959 CAGAGGAAATTGGGGCGGGGGGG + Intronic
999737521 5:154523789-154523811 CAGATGAGAGGGCTGGGGGGCGG - Intergenic
1000193357 5:158935181-158935203 CAGGGGAATAGGATGAGGGGCGG - Intronic
1000686248 5:164253573-164253595 CAGAGGAAATGAATGAGGTCTGG - Intergenic
1002107379 5:176886905-176886927 CAGGGGAAAAGGCTGGGCGGTGG - Intronic
1002254902 5:177951531-177951553 CCGAGGAAAACACTGAGGGGAGG - Intergenic
1002302446 5:178265008-178265030 CAGAAGGAATGGCTGGGGTGGGG + Intronic
1002350838 5:178582657-178582679 AAGAGGAAAATGCTGAGGGCTGG - Intronic
1003324556 6:5082789-5082811 CAGAGGAACTGGCGGAGCTGAGG - Intergenic
1003834870 6:10059976-10059998 AACAGGAAATTGATGAGGGGGGG - Intronic
1004373111 6:15069473-15069495 CAGCGGTAGTGGCTGTGGGGTGG + Intergenic
1005496858 6:26395358-26395380 CAGAGAAAATAGATGAGGAGGGG - Intergenic
1005801697 6:29432035-29432057 AAGAGAAAATGGCTCAGGAGTGG - Intronic
1006272686 6:32976362-32976384 GAGAGGAAATGACTGATGGGTGG - Exonic
1006392933 6:33769491-33769513 CAGAGGCAAGGGATGAGGGCAGG - Intergenic
1006400184 6:33813171-33813193 CAAAGCCAGTGGCTGAGGGGAGG - Intergenic
1006474513 6:34245712-34245734 AGGGGGAAATGGCTGAGTGGCGG - Exonic
1006506337 6:34491135-34491157 GAGAGGAAAAAGCTGAGGAGCGG - Intronic
1006718756 6:36136611-36136633 AAAAGGAACTTGCTGAGGGGAGG - Intronic
1006849737 6:37089644-37089666 CAAAGGAAAGGGGGGAGGGGAGG + Intergenic
1007245250 6:40457051-40457073 CAGAGGAAAGGGTGGTGGGGAGG - Intronic
1007258534 6:40545590-40545612 CAGAGGAAGAGGAAGAGGGGAGG + Intronic
1007358229 6:41335955-41335977 CAGAGGAGATGGGTGTGGTGGGG + Intronic
1007406849 6:41640272-41640294 CAGAGAAAATGGATAAGGGGAGG - Intronic
1007626723 6:43250830-43250852 CAGAGGAAAGGGCAAAGGGGAGG - Intronic
1007685465 6:43664915-43664937 CAGAGCCAGGGGCTGAGGGGTGG + Intronic
1007955743 6:45916348-45916370 CAAAGGCAATGGCAGAGGGTGGG + Intronic
1008267305 6:49444285-49444307 CAGTTAAAATGGCTGTGGGGTGG - Intronic
1008349334 6:50471382-50471404 AAGAGGAAAGGGGTGAGGGTGGG + Intergenic
1009313808 6:62191626-62191648 CAGAGGGACAGGCTGATGGGTGG - Intronic
1009919207 6:70036168-70036190 TAGAGGAAATTGCTCAGGGTAGG - Intronic
1011187449 6:84694325-84694347 CAGTGGGAAAGGGTGAGGGGTGG + Intronic
1011788639 6:90874051-90874073 CAAAGAAGATGGATGAGGGGAGG - Intergenic
1013584571 6:111566746-111566768 CAGAGCAAATGGCTCAGAGAGGG + Intronic
1014512500 6:122341507-122341529 GAGCAGAAATGGCTGAGAGGAGG + Intergenic
1016308599 6:142709956-142709978 CAAAGGAAATGGCAGAGGCCAGG - Intergenic
1016323510 6:142874018-142874040 AATAGCAAATGGCTGAGTGGAGG - Intronic
1017182744 6:151569502-151569524 CAGAGGAAATCACAGAGGGCAGG - Intronic
1018085846 6:160300518-160300540 CAGAGGAAGTGGGTGGGAGGAGG + Intergenic
1018708209 6:166478170-166478192 CAGAGGGAGTGGCAGAGGTGGGG + Intronic
1019575930 7:1737650-1737672 CAGAGGACAGGGCTGCGGGGAGG - Intronic
1020213461 7:6171840-6171862 CAGAGGGGATGCCTGAGGGTGGG - Intronic
1021381313 7:19969978-19970000 CAGAGGAATTGGATGTCGGGGGG - Intergenic
1024024096 7:45396788-45396810 CAGATGAAGTGGCAGAGGAGAGG - Intergenic
1024177944 7:46860568-46860590 CAGTGGAAATGGGTCAGAGGTGG - Intergenic
1025948863 7:66127471-66127493 GAGAGGACATGGCTGTGGGATGG + Intronic
1027509211 7:79058083-79058105 CAGAGGAAGTGGTGGAGAGGGGG + Intronic
1027719791 7:81725828-81725850 CAGGGGAAATGCCTAAAGGGAGG - Intronic
1029049069 7:97664587-97664609 GAGAGGAAATCACTGTGGGGAGG - Intergenic
1030097049 7:105909813-105909835 AAGAGGAGATGGCTGATGGCGGG + Intronic
1032086429 7:128886371-128886393 GAGAAGAGCTGGCTGAGGGGAGG + Intronic
1032530129 7:132613353-132613375 CAGAGGAGATGTCGGGGGGGAGG - Intronic
1032531982 7:132629470-132629492 CAGAGGTAATGGTTCAGGAGAGG - Intronic
1032558625 7:132864304-132864326 ATGGGGAAATGGCTGATGGGTGG + Intronic
1032740443 7:134733240-134733262 AAGAGCAAACGGCAGAGGGGAGG + Intergenic
1032939066 7:136767888-136767910 CCTAGGAAATGGCTAAGGGAGGG + Intergenic
1033351728 7:140567658-140567680 CGAGGGAAATGGGTGAGGGGAGG - Intronic
1033590742 7:142806173-142806195 ATGAGGAAATGGCTCAGGGACGG - Intergenic
1034345830 7:150384622-150384644 CAGAGGACAGGAATGAGGGGAGG - Intronic
1034860071 7:154587339-154587361 CAGTGGGAATGGTTGGGGGGAGG - Intronic
1035192634 7:157184900-157184922 CAGGGCTCATGGCTGAGGGGTGG + Intronic
1035630655 8:1104463-1104485 CAGAGCAGATGCCTTAGGGGTGG + Intergenic
1037320332 8:17635284-17635306 CAGGGGAAAGGGTTGGGGGGAGG - Intronic
1037702137 8:21284881-21284903 CAGAGGAAATGACTACTGGGTGG - Intergenic
1038331610 8:26613672-26613694 GAGAGGAAATGACAGAGGAGAGG + Intronic
1038491540 8:27975456-27975478 CAAAGGAAGTGGGTGCGGGGTGG + Intronic
1039204704 8:35139312-35139334 GAGAGTAAATGACTGAGGTGGGG - Intergenic
1041649545 8:60288257-60288279 TAGGGGAAATGGGTGAGGGGAGG - Intergenic
1041794145 8:61728708-61728730 GAGCTGAAATGGCTGTGGGGAGG + Intergenic
1042003069 8:64147857-64147879 CAGAGGAGAAGGCTTGGGGGAGG - Intergenic
1043545768 8:81313805-81313827 CAGAAGAAATGGCGGGGGGCGGG + Intergenic
1043548771 8:81344852-81344874 AAGAGGAAAGGGAAGAGGGGAGG - Intergenic
1044347371 8:91120772-91120794 CAGAGGAACTGACTGAGGAGTGG - Intronic
1044700030 8:94957385-94957407 CAGAGGAAAGGGCTGAAAGCTGG + Intronic
1044838404 8:96317204-96317226 CAGGGGAAAGGGCTGAGTTGAGG - Intronic
1044854409 8:96459624-96459646 CCAAGGATATGGGTGAGGGGAGG - Intergenic
1044890232 8:96827309-96827331 CAGAGGAAGTGATGGAGGGGTGG - Intronic
1049044124 8:140136197-140136219 CAGAGGAGAGGGCTGTGGGAAGG + Intronic
1049368593 8:142252837-142252859 CAGAGGAAATGGCTGAGGGGTGG - Intronic
1050025705 9:1332601-1332623 CAGAGGAAAGGGGAAAGGGGTGG + Intergenic
1052058841 9:23935622-23935644 CAGGGGAAATGTCTGATGTGAGG + Intergenic
1052812383 9:33073055-33073077 CAAAGGAAATGGCTCAGGATAGG + Intronic
1053147872 9:35724164-35724186 CAGAGGACTTGGCTGGGGTGGGG - Intronic
1054821160 9:69521645-69521667 CATAGAAAATGACTGAGGAGAGG + Intronic
1055155355 9:73056501-73056523 CAGATGAACTGCCTGAGGGGTGG - Intronic
1056637626 9:88344728-88344750 CAGGGGAAAAGGGTGAAGGGAGG - Intergenic
1056676594 9:88681541-88681563 CAGAGGACAGGGCTGACAGGAGG - Intergenic
1056696231 9:88856353-88856375 GAGAGAAAATGGCAGAGAGGAGG + Intergenic
1056762218 9:89423869-89423891 CTGAGGGAATAGCTGAGGGAGGG - Intronic
1057443750 9:95099565-95099587 TGGAGGGAATGGCCGAGGGGTGG + Exonic
1058409434 9:104714997-104715019 GAGAAGAAATGGCTGAAGTGGGG + Intergenic
1059202277 9:112429426-112429448 TAGAGGAAAGGGCAGAGGGGAGG - Intronic
1059236390 9:112763994-112764016 TGGAGGAAATGGAAGAGGGGTGG - Intronic
1060160028 9:121353697-121353719 GAGAGGAAGTGGCTGAAGAGGGG - Intronic
1061302711 9:129714849-129714871 AAGAGGAACTGCCTGAAGGGGGG + Intronic
1061588598 9:131584002-131584024 CAGAAGAACGGGCTGAGGGCGGG + Intronic
1061713198 9:132501772-132501794 CAGAGCCAATGGCTGAGGCCAGG + Intronic
1061828162 9:133274736-133274758 CCGAGGGAAGGGCTGGGGGGCGG + Intronic
1062287044 9:135777947-135777969 CAGAGGAACTGGGAGTGGGGAGG - Intronic
1062512902 9:136917278-136917300 CAGAGGAGATAGCTGAGGGGAGG - Intronic
1062597011 9:137304044-137304066 CAGAGGGCATGACTGGGGGGTGG + Intergenic
1185640650 X:1588143-1588165 CAGAGGAAAGGGGAGGGGGGAGG - Intergenic
1185726485 X:2426032-2426054 TAAAGGAGATGGCTGGGGGGTGG + Intronic
1186417234 X:9394314-9394336 CTGAGGAAATAGCTGTGGGTCGG + Intergenic
1187058906 X:15767109-15767131 CAGAGTAAATGGATGAGGGTTGG - Intronic
1187266278 X:17737211-17737233 CTGAGGAGATGGCTGTGGGGCGG - Intergenic
1187266291 X:17737253-17737275 CTGAGGAGATAGCTGTGGGGCGG - Intergenic
1187266303 X:17737295-17737317 CTAAGGAGATGGCTGTGGGGCGG - Intergenic
1187279913 X:17850345-17850367 CAGTGGGCATGGCTGAGGAGAGG + Intronic
1188890040 X:35599011-35599033 CAGGGGAAAAGGTGGAGGGGTGG + Intergenic
1190259674 X:48790021-48790043 AAGAGGAAGTGGAGGAGGGGAGG + Intronic
1190323127 X:49190102-49190124 AGGAGGAAAAGGCTAAGGGGTGG - Intronic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1193234568 X:79091117-79091139 CAAAGGAAACAGCTGAGGGCAGG + Intergenic
1195063702 X:101220196-101220218 GAGGGGAAATGACTGAGGGAGGG + Intronic
1196368726 X:114951915-114951937 CAGAGGTGATGGGGGAGGGGTGG - Intergenic
1196735435 X:118977334-118977356 CAGAGGAGAAGGGTGAGGGCAGG - Intronic
1197252929 X:124233720-124233742 CAGGGGCCATGGCTGAGTGGTGG + Intronic
1197722604 X:129755427-129755449 TAGAGGAACAGGGTGAGGGGAGG + Intronic
1197922730 X:131612525-131612547 AAGAGGAGATGACTGAGAGGAGG - Intergenic
1198651879 X:138872155-138872177 CAGAAGTAATGGCTGATGGCAGG + Intronic
1198869581 X:141161669-141161691 CAGAGGTAGGGGGTGAGGGGTGG + Intergenic
1199297985 X:146180901-146180923 CAGGGGACATGTCTGAGGGTGGG - Intergenic
1199770006 X:150969231-150969253 AAGAGGACCTGGCTGAGGGGAGG - Intergenic
1199895902 X:152127708-152127730 AAGAGGTACTGGCTGAGGTGGGG - Intergenic
1200072605 X:153536567-153536589 CAAGGGAAATGGCTGAGAGGAGG - Intronic
1200756529 Y:6995318-6995340 CAGGGGAATTGGCAGAAGGGTGG - Intronic
1201241570 Y:11961895-11961917 CAGCAGAAATTGCTGAGTGGTGG - Intergenic
1201247756 Y:12022961-12022983 CAGAGGAAAGGGAAGAGGAGAGG + Intergenic