ID: 1049368594

View in Genome Browser
Species Human (GRCh38)
Location 8:142252840-142252862
Sequence GTGCAGAGGAAATGGCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 373}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368594_1049368601 -3 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368594_1049368611 30 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368611 8:142252893-142252915 AGTGGGGCAGGTATGAGGCTTGG No data
1049368594_1049368608 25 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data
1049368594_1049368604 14 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368594_1049368602 12 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368594_1049368603 13 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368594_1049368606 18 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368594 Original CRISPR GTGCAGAGGAAATGGCTGAG GGG (reversed) Intronic
901010147 1:6196238-6196260 GGGCTGAGGGAATGGCTCAGAGG + Intronic
901157738 1:7151669-7151691 CTCCAGAGGAAATGGCTTTGGGG + Intronic
901409342 1:9071809-9071831 AGGCAGAGGGACTGGCTGAGCGG - Intronic
902565007 1:17305620-17305642 TTGCAGAGGGACTGGATGAGGGG - Intergenic
904380103 1:30104882-30104904 GGGCAGTGAAAATGGCAGAGGGG + Intergenic
904981080 1:34502354-34502376 GTGCAGATGAAAGTGCTGAGAGG + Intergenic
905143594 1:35869116-35869138 TTGCAGAGGGAAGGGCAGAGGGG + Intergenic
905922265 1:41727571-41727593 GTCCAGAGGAAGTGGCTGAGGGG + Intronic
906420599 1:45663587-45663609 GTGCAGAGTATGTGGTTGAGAGG + Intronic
906660569 1:47578545-47578567 CTGCAGAGGAAGTGACTGGGAGG - Intergenic
906816879 1:48888405-48888427 GCGCAGAGGAAGTGGGTGAAAGG - Intronic
907989883 1:59569897-59569919 TTGCAGTGGACATGGCTCAGGGG - Intronic
908108637 1:60873061-60873083 CTGCGGAGGAAATGCCTTAGCGG + Intronic
908205426 1:61843196-61843218 ATACAGAGGAAAGGGCTGAAAGG - Intronic
908903296 1:68980661-68980683 GAGCAAAGGAGAAGGCTGAGCGG + Intergenic
909695608 1:78465273-78465295 CTGCAGTGGCAATGGCTGAGGGG + Intronic
909932035 1:81507263-81507285 GTGCAGGAGAAAGTGCTGAGGGG - Intronic
910812649 1:91253809-91253831 CTGCAGAGGCAATGGCAGAGAGG - Intergenic
912677855 1:111702016-111702038 AAGCTGGGGAAATGGCTGAGTGG + Intronic
913410193 1:118542597-118542619 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
915284655 1:154845111-154845133 GGGCAGGGGAAATGGAAGAGTGG - Intronic
915493964 1:156267868-156267890 TTGAAGAGGGAATGGCTGAATGG - Intronic
915666416 1:157449104-157449126 CTGCAGAGGAAACAGCAGAGGGG + Intergenic
915726636 1:158022773-158022795 GTGGAGAGGAGCTGGCAGAGTGG - Intronic
917149393 1:171928675-171928697 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
917173292 1:172201701-172201723 CTGCAAAGGCAATGGCAGAGAGG + Intronic
917681650 1:177374137-177374159 GACCAGAGGAAATGCCTGGGAGG + Intergenic
918248966 1:182684790-182684812 GTTCAGAGGGGATGGCAGAGGGG + Intergenic
918912119 1:190588516-190588538 CTTCAGATGAAATGGCTTAGGGG + Intergenic
919577981 1:199336380-199336402 CTGCAGAGGCAATGGCAAAGGGG + Intergenic
920521322 1:206629301-206629323 GGGCAGAGGAAAGGGCAGAGAGG + Intergenic
920558719 1:206923295-206923317 GTGCAGAGGAAGTGTGTGGGGGG + Intergenic
920866407 1:209757328-209757350 GCGAAGAGGAAAGGGCTGTGGGG - Intronic
920884186 1:209910654-209910676 GTGAAGTTGAAATGCCTGAGTGG + Intergenic
922773873 1:228206227-228206249 GTGCAGAGAAGATGGCTGTGCGG - Intronic
923512878 1:234667812-234667834 GTGCAAAGGAGGTGGCAGAGAGG - Intergenic
924382495 1:243477317-243477339 GTGCAAAGGAAATGGGACAGAGG - Intronic
924539483 1:244968338-244968360 CCACAGAGGAAAAGGCTGAGAGG + Intergenic
924754923 1:246931975-246931997 GAGCAGAGGAAAGGGCGGAGAGG + Intronic
924801725 1:247332786-247332808 GTGCAGAGCAGATGGCGAAGGGG - Intergenic
1063962766 10:11320677-11320699 GTGATGAGGAAATGGTGGAGAGG - Intronic
1065122771 10:22544609-22544631 GTGAAGTGGTAAAGGCTGAGTGG + Intronic
1068033137 10:51727724-51727746 TAGCAGAGGAATTGGATGAGGGG + Intronic
1068558393 10:58483590-58483612 CTGCTGTGGAAATAGCTGAGTGG - Intergenic
1069904921 10:71726557-71726579 GCCCTGTGGAAATGGCTGAGAGG + Intronic
1070386924 10:75934255-75934277 TAGCAAAGGAAATGGCTCAGGGG - Intronic
1070713937 10:78703730-78703752 TTCCACAGGAAATGGCAGAGGGG + Intergenic
1073779921 10:106825811-106825833 GCCCAGAAGAAAAGGCTGAGTGG - Intronic
1073969436 10:109030616-109030638 TTGCAAAGGAAATTGCTGAGAGG + Intergenic
1074986336 10:118663008-118663030 GTGGGGGGGAAATGGCAGAGAGG - Intergenic
1077232341 11:1463418-1463440 GTGCTAAGCACATGGCTGAGGGG + Intergenic
1077631989 11:3817185-3817207 GTGCAGAGGAGAAGGATCAGAGG - Intronic
1077915596 11:6609663-6609685 TTGGGGAGGAAATGGCAGAGAGG + Intronic
1078164904 11:8874159-8874181 GTACAGAGGAAATGGCTTGCGGG - Intronic
1078273137 11:9815606-9815628 GTGCAAAGAGAATGGCAGAGGGG + Intronic
1078294825 11:10057316-10057338 TTGCAGAGGTAGTGGCAGAGAGG - Intronic
1078400754 11:11024445-11024467 GTGAAGTGGCAAAGGCTGAGAGG - Intergenic
1078619097 11:12891421-12891443 TGGCTGAGGAAATGGCAGAGGGG + Intronic
1078850682 11:15160283-15160305 GTGAAGAGGAAGTGGGAGAGAGG + Intronic
1078993278 11:16670460-16670482 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1079882697 11:25945606-25945628 CTGCAGTGGCAGTGGCTGAGGGG - Intergenic
1080082742 11:28239697-28239719 GGGAAGAGGAAATGGCTTGGAGG - Intronic
1080609046 11:33888037-33888059 GGGCAGGGGGAATGACTGAGTGG + Intronic
1081313131 11:41597704-41597726 ATGCAGAGGTTATGGGTGAGAGG + Intergenic
1081633087 11:44702550-44702572 GGGCAGTGGAGATGGCTGAGGGG + Intergenic
1081887006 11:46506617-46506639 GTGGGGAGGAAATGACTGACAGG + Intronic
1082181248 11:49122275-49122297 GTGCAGAAGAAATGAATCAGTGG - Intergenic
1083290961 11:61689916-61689938 GGGCAGCTGAAAGGGCTGAGGGG - Intronic
1083912469 11:65718285-65718307 ATGCAGAGAAAATGGCTCATGGG - Exonic
1084463760 11:69310367-69310389 GTGCAGAGCCAAAGGCAGAGAGG - Intronic
1084476278 11:69391452-69391474 GAGCTGAGGAAAAGGCTCAGGGG + Intergenic
1084607781 11:70182477-70182499 GTGCAGGGGACATGGCAGTGAGG - Intronic
1085023640 11:73224121-73224143 GGTCTGAGGAAATGGCTAAGGGG - Intronic
1085042092 11:73332568-73332590 CTGCTGTGGAAAAGGCTGAGTGG + Intronic
1085250611 11:75141190-75141212 AGGCAGAGGAACTGGCTGATGGG + Intronic
1085384565 11:76149721-76149743 GGGCAGGGGATATGGCTGGGTGG + Intergenic
1086374221 11:86183948-86183970 GTGCACAGGGGAGGGCTGAGAGG + Intergenic
1086684242 11:89712572-89712594 GTGCAGAAGAAATGAATCAGTGG + Intronic
1088729993 11:112671822-112671844 CTGTAGAGGAAATGGCAAAGGGG - Intergenic
1089069571 11:115689040-115689062 GTGCAAAGGGAATTGCTGAGTGG + Intergenic
1090136415 11:124204019-124204041 GAGGAGAGGAAATGGAAGAGTGG - Intergenic
1090332302 11:125941715-125941737 CTGCAGAGGAAATGGGTTAGAGG - Intergenic
1091363755 11:134999959-134999981 GAGCAGAGGAAATAGGGGAGGGG + Intergenic
1091451079 12:572206-572228 GGGCTGAGGACATCGCTGAGAGG + Intronic
1092587883 12:9919512-9919534 GTGCAGAGGCAGTGGCAGAGAGG + Intronic
1092776005 12:11945806-11945828 TGGCAGGGGAAATGGGTGAGGGG + Intergenic
1092976496 12:13750044-13750066 TTGCAGAGGAAATGCTTTAGTGG + Intronic
1093690194 12:22101611-22101633 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1095310957 12:40695905-40695927 GTGTAAAGGAAATGGCTAATGGG - Intronic
1095835908 12:46638351-46638373 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1096527134 12:52217026-52217048 GTGAAGGGGAAATGGCATAGAGG + Intergenic
1096846173 12:54408262-54408284 ATGGAGAGGAAGTGGCAGAGGGG + Intronic
1097381443 12:58900021-58900043 GTGCAGGGGTAATGATTGAGGGG - Intronic
1097417272 12:59327995-59328017 GTGAAGGGGAAGTGGTTGAGGGG + Intergenic
1098244289 12:68500411-68500433 GAGCAGAGGAAATAGCTTTGAGG + Intergenic
1100002588 12:89855368-89855390 AGGCAGAGGAAATGGCTCAGGGG - Intergenic
1102472618 12:113168102-113168124 GGGCACAGGAAAGGGCTGCGGGG - Intronic
1102702130 12:114848638-114848660 CTGCAGAGGCAGTGGCTGTGTGG + Intergenic
1103193114 12:119019454-119019476 GTGGAGGGGAAATGCTTGAGGGG - Intronic
1103678168 12:122672990-122673012 GGGCAGGGGAAATGGAAGAGAGG - Intergenic
1103726676 12:123000701-123000723 GTGCAGAGGAATAGTCTGAGGGG - Intronic
1104315838 12:127700187-127700209 GTGCGGAGGAATTGGGGGAGAGG - Intergenic
1104580854 12:130009747-130009769 GAGCAGATGAAAAGGCTGACTGG - Intergenic
1105239599 13:18598051-18598073 GCACCCAGGAAATGGCTGAGCGG + Intergenic
1105408585 13:20151333-20151355 GTGCAGAGGAATGGGTTGTGGGG - Intronic
1105583391 13:21721698-21721720 GTGCAGAGGAATCTGCGGAGTGG + Intergenic
1105795234 13:23845022-23845044 GTGCATAGGAAATGCCTGGAAGG - Intronic
1105841901 13:24261022-24261044 ATGCAGAGGAGGAGGCTGAGAGG + Intronic
1106480304 13:30132834-30132856 CTGCAGAGGCAAAGGCTGAGAGG - Intergenic
1110060636 13:71034061-71034083 CTGCAGTGGCAATGGCAGAGGGG - Intergenic
1112934409 13:104781169-104781191 GTGTGGGGGAAATGGCTGACTGG + Intergenic
1112934475 13:104781415-104781437 GGGTGGAGGAAATGGCTGGGTGG + Intergenic
1112934514 13:104781556-104781578 GGGTGGAGGAAATGGCTGGGTGG + Intergenic
1112934531 13:104781607-104781629 GGGTGGAGGAAATGGCTGGGTGG + Intergenic
1112934536 13:104781624-104781646 GGGTGGAGGAAATGGCTGGGTGG + Intergenic
1112934541 13:104781641-104781663 GGGTGGAGGAAATGGCTGGGTGG + Intergenic
1113060508 13:106317204-106317226 GAGCAGAGCACATGCCTGAGAGG - Intergenic
1114278707 14:21170278-21170300 CTGCAGAGGCACTGGCAGAGGGG - Intergenic
1115737168 14:36345427-36345449 GTGAATAGGAAATGGCTTAAAGG + Intergenic
1119429061 14:74553995-74554017 GTTGAGGGGAAAGGGCTGAGAGG + Intronic
1119875238 14:78053832-78053854 TTGTAGAGGAAAAGGCTGAGTGG + Intergenic
1120776118 14:88439889-88439911 GTCCAGAGGTGAGGGCTGAGGGG - Intronic
1121712719 14:96051510-96051532 ATGCTGAGGAGATGGATGAGGGG - Intronic
1122509423 14:102254586-102254608 GTGGAGAGGAATTGGTTGAAGGG - Intronic
1122581284 14:102773291-102773313 ATGCAGAGGAAATGGGGGTGGGG - Intergenic
1122687228 14:103515107-103515129 TTGCAGAGGAATTGGCCCAGTGG - Intergenic
1123496808 15:20834639-20834661 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123554040 15:21408231-21408253 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123590287 15:21845596-21845618 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1125794347 15:42393478-42393500 GTACAGAGGGATGGGCTGAGAGG + Intronic
1125832687 15:42728001-42728023 GTGCAGAGAACATTGCTGTGGGG - Exonic
1126225212 15:46262116-46262138 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1126312111 15:47329233-47329255 GTGCAGCAGAAAGAGCTGAGGGG + Intronic
1127315823 15:57792832-57792854 GTGCAGATGAAAGGGCAGATGGG + Intergenic
1127701810 15:61508516-61508538 GTGCTGGGGAAATGGCTTTGTGG + Intergenic
1127824799 15:62693508-62693530 GTGGAGAGGAAGATGCTGAGGGG - Intronic
1128292666 15:66489976-66489998 TGCCAGAGGAAATGCCTGAGGGG + Intronic
1130681767 15:86003094-86003116 GTGTGGAGGACATGGCAGAGGGG + Intergenic
1130686300 15:86040704-86040726 GTGCAGAGGAGCTGCCTGAGAGG - Intergenic
1131200408 15:90390798-90390820 CTGCAGAGGAGATGGATGAAAGG + Exonic
1132349868 15:101133047-101133069 GTGCAGGGGAAAGGCCAGAGTGG - Intergenic
1202962388 15_KI270727v1_random:135427-135449 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1132518787 16:378012-378034 CAGCAGAGGATCTGGCTGAGGGG - Intronic
1134422393 16:14106355-14106377 CTGCATAGGTAAGGGCTGAGAGG + Intronic
1135173614 16:20208831-20208853 TGGCAGGGGATATGGCTGAGGGG + Intergenic
1135870536 16:26145813-26145835 GAGCAGAGTAAATGGATGATGGG - Intergenic
1135965139 16:27029245-27029267 GTGCAGGGGAAATGAGAGAGAGG + Intergenic
1136555430 16:31004965-31004987 GTCCTGAGGACATGGCAGAGTGG - Intronic
1137540934 16:49361146-49361168 GGACAGAGGAAAAGGCTAAGGGG - Intergenic
1138367374 16:56491386-56491408 GTGAAGAGGCAAAGCCTGAGGGG - Intronic
1141990452 16:87606210-87606232 GTGCAAAGGAAAAGTCAGAGTGG - Intronic
1144588631 17:16504856-16504878 GAGCAGAGGATATGGATGAGGGG - Intergenic
1144801480 17:17931286-17931308 GTGCAGAGGCATGGGCTGCGTGG - Intronic
1145414004 17:22698262-22698284 ATGAAGAGGAAATGGCAAAGTGG - Intergenic
1146751897 17:35389475-35389497 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1147166852 17:38598135-38598157 GTGCAGAGGCAAGGGCTGTGGGG - Intronic
1147323814 17:39660912-39660934 GTGCAGAAGACCTGGCTGAAAGG - Intronic
1147324524 17:39663897-39663919 GGGGAGAGGGAATGGGTGAGTGG - Intergenic
1148254794 17:46120692-46120714 GTGCAAAGGAAATGGAAGGGAGG - Intronic
1148647207 17:49225867-49225889 GTGTGGAGGAGAGGGCTGAGAGG + Intronic
1148693124 17:49544486-49544508 GAGAAGAGGAGATGGCAGAGGGG + Intergenic
1149435640 17:56631173-56631195 GGGCAGAGGAAATAGCAGAGAGG + Intergenic
1149541569 17:57471782-57471804 CTGCAGAGTCAAGGGCTGAGAGG - Intronic
1149771743 17:59327908-59327930 GATGAGAGGAAAGGGCTGAGGGG + Intergenic
1152126187 17:78448585-78448607 GTGTAAAGGAAATTGCAGAGGGG + Intronic
1153443009 18:5141566-5141588 GTGTAGTGGAAATGGCTGTTGGG - Intergenic
1154181363 18:12142487-12142509 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1154182541 18:12149097-12149119 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1154454711 18:14510323-14510345 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1156754605 18:40506742-40506764 CTGCAGTGGGAATGGTTGAGAGG + Intergenic
1157439188 18:47697103-47697125 GCGCAGAGGAGAGGGCGGAGAGG - Intergenic
1157856411 18:51109363-51109385 CTGCAGAGGCCAAGGCTGAGGGG + Intergenic
1157885387 18:51361360-51361382 GTGCAGAGTAAAAGGCAGACCGG - Intergenic
1160175739 18:76592569-76592591 GGGCAGAGGAAACGGCCCAGAGG - Intergenic
1160513113 18:79463509-79463531 GGGCACAGGAAATGGCCGTGGGG - Intronic
1160568627 18:79801753-79801775 GTGCAGTGGCAAAGGCTGTGTGG + Intergenic
1161127162 19:2564618-2564640 GAGGAGAGGACATGGCTGTGTGG + Intronic
1162791718 19:13066465-13066487 GGGAAGAGGACATGGCAGAGGGG - Intronic
1163561858 19:18023890-18023912 GTGCTGAGGCAGTGGGTGAGGGG + Intergenic
1163781527 19:19251952-19251974 GGGCAGGGCAAACGGCTGAGGGG - Exonic
1164457527 19:28421091-28421113 GTGCAAAGGAAATGACACAGTGG - Intergenic
1165472999 19:36014222-36014244 GTGGGGCGGAAATGGCTGGGAGG - Exonic
1165697791 19:37914105-37914127 GTGGAGAGCAAATGGCTGATGGG + Intronic
1166218542 19:41351770-41351792 ATGCAGGGGAATGGGCTGAGCGG - Intronic
1166380084 19:42351161-42351183 GTCCAAAGGAAAGGGCTGAGTGG + Intronic
1166911695 19:46163617-46163639 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1167006376 19:46778747-46778769 GTGAAGAGGAAGTAGATGAGGGG + Exonic
925646945 2:6045223-6045245 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
925662059 2:6213146-6213168 GTGCAGGAGACCTGGCTGAGGGG + Intergenic
926587316 2:14701374-14701396 GTGCAGCTGAAATGACTGACAGG + Intergenic
926724951 2:15990320-15990342 GTGCACAGGGAATGCCTGGGTGG + Intergenic
926786264 2:16521433-16521455 GGGAGAAGGAAATGGCTGAGTGG - Intergenic
926867460 2:17375513-17375535 GTGTGGAAGGAATGGCTGAGAGG + Intergenic
926891888 2:17645485-17645507 GTGCAGAGGAAATGTGTCACTGG + Intronic
927073650 2:19554921-19554943 TTTCAGAGGAAAGGGTTGAGAGG - Intergenic
928284763 2:29980189-29980211 CTGCAGAAGAAAGGGTTGAGAGG - Intergenic
929985493 2:46727801-46727823 GTATAAAGGAAATTGCTGAGAGG - Intronic
930221895 2:48754322-48754344 GCTCAAAGGAAATGGCAGAGGGG + Intronic
933874412 2:86604308-86604330 CTGAAGAGGAAATGTCGGAGGGG - Exonic
934765060 2:96876005-96876027 GGGAAGAGGAGATGGCTGGGAGG + Exonic
934900851 2:98158787-98158809 ATACAGAGGACAGGGCTGAGAGG + Intronic
935177523 2:100662937-100662959 GTGTAGACGAAAGAGCTGAGAGG - Intergenic
936927624 2:117753730-117753752 TAGCAGTGGAAATGGCTAAGGGG + Intergenic
937274667 2:120675961-120675983 GTGCAGAGGGAGTGGCCCAGAGG + Intergenic
938112552 2:128578674-128578696 GAGCAGAGGACAGGGCTGCGTGG + Intergenic
939649315 2:144742039-144742061 CTGTAAAGGAAATGGGTGAGAGG + Intergenic
939963625 2:148588775-148588797 TCCCAGAGGAAATGGCAGAGTGG - Intergenic
940981058 2:160004602-160004624 ATCTAGAGGAAATGGCTTAGGGG - Intronic
942491738 2:176496076-176496098 AAGCAGAGGAAATGGCAGAGGGG + Intergenic
943240218 2:185374963-185374985 TGTCAGAGGAAAAGGCTGAGAGG + Intergenic
943750908 2:191508487-191508509 GGGCAGAGGAAGTGGGGGAGGGG + Intergenic
944450608 2:199838514-199838536 CTGCAGAGAAAATGTGTGAGGGG + Intronic
945016295 2:205520420-205520442 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
945026462 2:205624377-205624399 AGGCAGAGGAAATGGGGGAGTGG - Intergenic
945125606 2:206506281-206506303 TTGCAGAGGAAAAGGCTTATGGG + Intronic
946434912 2:219644944-219644966 GTCCAGAGCAGATGGCAGAGAGG - Intergenic
947568922 2:231215656-231215678 GTGCAGAGTAAATGACAGAAGGG + Intronic
948176735 2:235949468-235949490 GTGCAGAAGAACAGGCGGAGAGG - Intronic
948192914 2:236073903-236073925 GTGCAGCGGAAATGCTTGGGGGG - Intronic
1168856012 20:1009618-1009640 GTCCAGAGGAAGAGGGTGAGGGG - Intergenic
1169189248 20:3646918-3646940 GTGGCGGGGAAATGGCTGTGCGG + Exonic
1170776317 20:19377778-19377800 GTGAACAGGAAAAGGCTGGGTGG - Intronic
1170786423 20:19471515-19471537 GTCCAGATAAAATGGCTGGGTGG + Intronic
1171459534 20:25291020-25291042 GGGCAGAAGACACGGCTGAGGGG - Intronic
1172207907 20:33177541-33177563 GTGCAAAGAAAAGCGCTGAGAGG - Intronic
1172908900 20:38391186-38391208 GTGTACAGGAAATTGCTAAGAGG + Intergenic
1174109132 20:48185797-48185819 GTGCAAAGGAAGAGGCTGGGTGG - Intergenic
1174196960 20:48779813-48779835 AGGGAGAGGAAATGGATGAGTGG + Intronic
1174202195 20:48814507-48814529 GAGCAAAGGAAAAGGCTTAGAGG + Intronic
1174708102 20:52677385-52677407 GTGCAGAGGAAATGAGTGTTTGG - Intergenic
1175622964 20:60466285-60466307 GGCCAGAGGACATTGCTGAGTGG + Intergenic
1176376277 21:6088305-6088327 CTGCAGAGGGGCTGGCTGAGGGG - Intergenic
1176819453 21:13642985-13643007 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1178051308 21:28750881-28750903 GTGGAGAAGAGATGGCTGAAAGG - Intergenic
1178059275 21:28834473-28834495 GGGCAGAGGAAGTGGCAGAAAGG + Intergenic
1178160603 21:29908904-29908926 TTGCAGAGGAAATACTTGAGAGG - Intronic
1178631376 21:34264295-34264317 GAGCTGAGAAAAGGGCTGAGTGG + Intergenic
1179747198 21:43449939-43449961 CTGCAGAGGGGCTGGCTGAGGGG + Intergenic
1181880713 22:25977605-25977627 GTACAGAGCACATGCCTGAGTGG + Intronic
1183090456 22:35518777-35518799 GAGCAGAGGAAAAGGGGGAGGGG - Intergenic
1183867003 22:40711982-40712004 GTGCAGAGTAAATGTGTGCGTGG + Intergenic
1184092694 22:42300772-42300794 GAGCAGAGGCAAAGGCAGAGAGG - Intronic
1184143658 22:42595364-42595386 ATGCAGAGCAAATGGCTCATGGG - Intronic
1184673185 22:46026421-46026443 TTGCAGAGGCAGTGGCTGTGAGG - Intergenic
1185021565 22:48379707-48379729 CTTCAGAGGAAGTGGCAGAGTGG + Intergenic
1185060560 22:48604338-48604360 ATGCAGAGGACATGTCTGAGTGG - Intronic
1185409315 22:50674134-50674156 GTGCGGGGGGAGTGGCTGAGCGG - Intergenic
949932365 3:9088920-9088942 GTACGGAGGACATGGCTGGGTGG - Intronic
950443900 3:13025222-13025244 GGGGAGATGGAATGGCTGAGGGG - Intronic
950529364 3:13544353-13544375 GCTCAGAGGTAAGGGCTGAGAGG - Intergenic
951197064 3:19836196-19836218 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
951283412 3:20780011-20780033 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
953860684 3:46541773-46541795 GAGCAGAGGTAATTGCTGTGTGG - Intronic
954378646 3:50207873-50207895 GTGCAGACGTGCTGGCTGAGAGG - Intronic
955027654 3:55185742-55185764 GTGCCAAGGAAATGGCTTGGTGG - Intergenic
955525042 3:59811227-59811249 ATGCAGAGGCAATGGCAGTGGGG + Intronic
955958342 3:64313500-64313522 GTGCAAGGGAAAAGGCAGAGGGG - Intronic
956637108 3:71376710-71376732 GTTAAGAGGAAAAGGCTAAGAGG - Intronic
958896636 3:99836827-99836849 GTTCAGACACAATGGCTGAGGGG - Intronic
959443843 3:106412834-106412856 CTGCAGGGTAAATGGCTGTGGGG - Intergenic
959520202 3:107316601-107316623 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
960121228 3:113950090-113950112 GAGCAGAGGAGATGCCTCAGGGG - Intronic
960902047 3:122563616-122563638 GAGGAGAGGAGATGGGTGAGGGG - Intronic
962339946 3:134574090-134574112 CTGCAGAGGAAATGGCTGAGTGG - Intronic
963053027 3:141158502-141158524 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
963208085 3:142657079-142657101 ATGTAGAGCAAAAGGCTGAGAGG + Intronic
964599019 3:158474641-158474663 GAGCAGAGAAAGTGGCTGAAAGG - Intronic
965317809 3:167212400-167212422 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
966065363 3:175815225-175815247 GTCCAGAGGAAAACTCTGAGTGG + Intergenic
966313085 3:178616060-178616082 GTGGAGAGGAAAGGGAAGAGTGG - Intronic
968177522 3:196564101-196564123 TTGGAGAGGAAATGACTCAGAGG + Intronic
968698467 4:2043690-2043712 CTGCAGAGGAAAGAGATGAGTGG + Intronic
969649074 4:8452889-8452911 GGGAAGAAGAAAGGGCTGAGAGG + Exonic
969853844 4:9983318-9983340 GTGCAGAATAAATGTCAGAGAGG - Intronic
970312425 4:14797030-14797052 GTGCAGTGGATATTGCTCAGGGG + Intergenic
970536467 4:17035293-17035315 GTGATGAGGAAATAGCTTAGTGG - Intergenic
971097727 4:23427120-23427142 GTGCAGTGGGAGTGGCTGAGGGG - Intergenic
973545159 4:51973591-51973613 CTGCAGGGGAAATTGCTGACTGG + Intergenic
974020619 4:56688839-56688861 GTTCAGAGGAAAAGGCTTTGGGG + Intergenic
974985940 4:69026272-69026294 CTGCAGATGCAGTGGCTGAGAGG + Intronic
975081815 4:70289929-70289951 GTCCAAAAGAAATGGCTGAGTGG + Intergenic
975106174 4:70571531-70571553 TTGCAGAGGCAGTGGCAGAGAGG + Intergenic
975663364 4:76709195-76709217 CTGCACAGGCCATGGCTGAGAGG - Intronic
976954662 4:90880556-90880578 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
977729319 4:100332027-100332049 ATGCAGAGGCAGTGGCTGAGAGG - Intergenic
977819853 4:101458734-101458756 CTGCAGAGGCACTGGCAGAGAGG - Intronic
978043046 4:104093000-104093022 CTGCAGAGGCAATGGCAGAAAGG - Intergenic
978683730 4:111414802-111414824 ATGCAGAGGCAGTGGCAGAGAGG + Intergenic
979013098 4:115396199-115396221 CTGCAGAGGAAGTGGCAGAGAGG + Intergenic
981046243 4:140267720-140267742 GGGCAGAGGAAAGGGAGGAGGGG - Intronic
981642138 4:146956967-146956989 ATGAAGAGGAAATGGTTAAGTGG - Intergenic
985843319 5:2325871-2325893 CTGGAGAGGAAAGGGCTGGGAGG - Intergenic
986083992 5:4424508-4424530 GTGCAGAGGCCATGGCTGGTTGG - Intergenic
986223838 5:5794725-5794747 GTGCAGGGGGCATGGGTGAGAGG - Intergenic
986230208 5:5856995-5857017 GAGGAGGGGAAATGGCAGAGTGG + Intergenic
986924912 5:12734906-12734928 GTGCAGAGGAAGGGCCTGAGGGG - Intergenic
987304777 5:16627143-16627165 GTTCAGAGGAAATAGCTAAAGGG + Intergenic
987644329 5:20648929-20648951 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
987760921 5:22162208-22162230 GTTCAGAGCAAATGACTGAATGG - Intronic
988094348 5:26584495-26584517 ATTCACAGGAAATGGCAGAGTGG - Intergenic
988936014 5:36083490-36083512 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
989318066 5:40104845-40104867 GTGCAGAGAAGCAGGCTGAGTGG - Intergenic
989370325 5:40700368-40700390 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
990257569 5:53987052-53987074 GGGCAGTGGAGATGGCTGAAGGG + Intronic
990851586 5:60211050-60211072 GTGGAGAGAAAGCGGCTGAGGGG - Intronic
991398873 5:66233379-66233401 GTGTTGAGAAAATGGCTTAGGGG + Intergenic
991895698 5:71395670-71395692 GTTCAGAGCAAATGACTGAATGG - Intergenic
992406396 5:76461594-76461616 CTGCAGAGGAGATGGATGAGAGG + Exonic
993351261 5:86853238-86853260 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
993634346 5:90326090-90326112 CTGCAGTGGCAATGGCAGAGGGG + Intergenic
994446433 5:99879908-99879930 GTGCAGTTGCAATGGCAGAGGGG - Intergenic
995187829 5:109290258-109290280 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1000449336 5:161365265-161365287 GCCCAGATGAAATGGCTTAGAGG + Intronic
1000763150 5:165251876-165251898 AAGCAGAGAGAATGGCTGAGGGG + Intergenic
1001612094 5:173011075-173011097 GCGAAAAGGAGATGGCTGAGGGG - Intronic
1001713759 5:173798181-173798203 GACCAATGGAAATGGCTGAGTGG - Intergenic
1001761643 5:174212609-174212631 GTGGAGAGGAGATGGCTAAGTGG - Intronic
1002165088 5:177338932-177338954 ATGGAGAGGAAATGGCTGGTGGG - Intronic
1003094498 6:3131806-3131828 TGGCAGAGGATGTGGCTGAGGGG - Intronic
1003286292 6:4736549-4736571 GTGCAGGGGACATGGCTGCAGGG + Intronic
1003459631 6:6318257-6318279 TTGTAGAGGAAATAGTTGAGAGG + Intronic
1006246284 6:32739734-32739756 GTGCAGACGTGATGACTGAGTGG + Intergenic
1006272687 6:32976365-32976387 GTGGAGAGGAAATGACTGATGGG - Exonic
1006376512 6:33674362-33674384 CTGCAGAGGGAATGGCAGAGAGG - Intronic
1007406850 6:41640275-41640297 GAGCAGAGAAAATGGATAAGGGG - Intronic
1008173242 6:48234680-48234702 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1009325779 6:62346221-62346243 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1014783727 6:125593852-125593874 GTGCTGAGGAAGAGACTGAGTGG + Intergenic
1015197289 6:130537358-130537380 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1016881607 6:148917197-148917219 AAACAGAGCAAATGGCTGAGGGG - Intronic
1017244499 6:152207921-152207943 GTGCGGTGGAAATGCCTAAGAGG + Intronic
1018107956 6:160507011-160507033 CTGCAGCTGAAATGGCAGAGGGG + Intergenic
1018123501 6:160659626-160659648 CTGCAGCTGAAATGGCAGAGGGG + Intronic
1018459653 6:163985806-163985828 ATGGAGAGGAAATGGCTGGCTGG + Intergenic
1019575931 7:1737653-1737675 GCGCAGAGGACAGGGCTGCGGGG - Intronic
1021107195 7:16651561-16651583 GTGCAGAGGAAACTGCTGGCTGG + Intronic
1022208939 7:28189467-28189489 GGGCAGAAGCAAAGGCTGAGAGG + Intergenic
1023575417 7:41621387-41621409 GGGCACAGGAAATGGATCAGAGG + Intergenic
1023990698 7:45126534-45126556 GTGCTGGGGAAATGGCTGAGAGG + Intergenic
1024165437 7:46724787-46724809 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1024566333 7:50684156-50684178 GTCCTGGGGAAATGGGTGAGGGG - Intronic
1024680416 7:51681208-51681230 TTTCAGAGGAAATGTCTGAGTGG - Intergenic
1026458068 7:70589992-70590014 CTGCAGAGGCAAGGCCTGAGTGG + Intronic
1027627616 7:80564636-80564658 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1027919499 7:84374879-84374901 ATGCAGAGGCTATGGCAGAGTGG - Intronic
1029052183 7:97700652-97700674 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1029659919 7:101953153-101953175 GAGAAGAGGAAATGGCTGGGAGG - Intronic
1029673373 7:102049307-102049329 GTGCAGATGAAATGGCAGAACGG - Intronic
1030361387 7:108598855-108598877 GTGCAGAGGAAGAGGGAGAGAGG + Intergenic
1030891468 7:115004244-115004266 ATGCAGAGGTAATGCCTGCGAGG + Intronic
1031818424 7:126469604-126469626 GTGCAGAGCAAAGGAGTGAGGGG - Intronic
1032508749 7:132455337-132455359 GTGCAGAGGGAATGACAGAGAGG + Intronic
1032648744 7:133854742-133854764 AAGCAGATGAAATGGCTAAGAGG - Intronic
1033019216 7:137705563-137705585 GTGGAGGGGAGATGGCTGATTGG + Intronic
1033634784 7:143201923-143201945 GTCCAAAGGAAATCACTGAGAGG - Intergenic
1033649618 7:143330953-143330975 GTGCAGAGGAAAACTCTGTGGGG + Intronic
1033910909 7:146262098-146262120 GTTGAAATGAAATGGCTGAGTGG - Intronic
1034459310 7:151189698-151189720 CAGCAGAGGAAATGACAGAGTGG - Intergenic
1035144708 7:156802796-156802818 GTGCAGAGTCAGTGGCTGACTGG - Intronic
1035678191 8:1469452-1469474 CTGCACAGGAAATGGCAGAGAGG - Intergenic
1037673616 8:21036347-21036369 GTACAGAGGAAATGTCTTAGAGG + Intergenic
1037833968 8:22205376-22205398 GTGCAGAGGAGCAGGCTGGGTGG + Intronic
1037904868 8:22710411-22710433 GTGCAAAGAAAAGGGATGAGAGG + Intergenic
1038502716 8:28059173-28059195 GTGTGGAGGAAATGGTGGAGGGG + Intronic
1038669280 8:29569417-29569439 GTGAGGGGGAAAGGGCTGAGAGG - Intergenic
1041100937 8:54396054-54396076 GGACAGAGGAAAAGGCTGTGGGG + Intergenic
1042209211 8:66361885-66361907 TTGCAAAGGAAATGGCAGAGGGG - Intergenic
1046262258 8:111783842-111783864 CTGCATAGGCAATGGCTTAGGGG - Intergenic
1046570107 8:115952711-115952733 GTGCTGAGAAAAAGGCTGGGTGG - Intergenic
1046701600 8:117406955-117406977 GTGCCCAGGAAAAGGCTGACTGG - Intergenic
1046859987 8:119079781-119079803 TTGCAGAGGAACTAGCTGAAGGG + Intronic
1047096678 8:121633763-121633785 AGGCAGAGGAAATGGCTTCGAGG - Intronic
1048454153 8:134562788-134562810 GTGCAGAAGAAATGGATTTGGGG - Intronic
1048974783 8:139665037-139665059 GTGCAGTAGCAATGGCTGTGTGG - Intronic
1049368594 8:142252840-142252862 GTGCAGAGGAAATGGCTGAGGGG - Intronic
1049523625 8:143108754-143108776 GTGCAGGGGACATGCCTCAGAGG + Intergenic
1050073475 9:1840351-1840373 GTGCAGAGGAAATGGAGGAAGGG + Intergenic
1051337198 9:16076601-16076623 GTGCTGAGGGAAGGGCTGAGTGG - Intergenic
1051899717 9:22025397-22025419 TTGCAGAGGTAGTGGCAGAGAGG + Intronic
1052311609 9:27074722-27074744 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1056044941 9:82705339-82705361 GTGAAGGGGAAGGGGCTGAGGGG + Intergenic
1056762245 9:89423976-89423998 GTGCTGAGGAAGTAGCTGAGGGG - Intronic
1056841241 9:89999586-89999608 GTGCACAGGAGCTGGCTGAGGGG + Intergenic
1058179672 9:101781358-101781380 GAGAACAGGAAATGGGTGAGAGG - Intergenic
1059145659 9:111897078-111897100 GGGGAGAGGAAAGGGCGGAGGGG - Exonic
1059506405 9:114803521-114803543 ATGGAGAAGAAATGGCTCAGAGG - Intronic
1060376833 9:123122706-123122728 GTGCAGAGGATATGGCTTCAAGG + Exonic
1060792566 9:126496369-126496391 GTGGATAGGTAGTGGCTGAGTGG - Intronic
1061311145 9:129763526-129763548 GTGGAGAGGAAAAGGGAGAGAGG - Intergenic
1061500673 9:131000024-131000046 GTGCTCAGGAAATGGTTGGGAGG + Intergenic
1061802973 9:133122079-133122101 GGGCAGAGCACATGGCTGCGTGG + Intronic
1061814963 9:133189006-133189028 CAGCACAGGAGATGGCTGAGAGG + Intergenic
1061841679 9:133362130-133362152 CTGCAGAGCCAATGGATGAGAGG + Exonic
1062512903 9:136917281-136917303 GGGCAGAGGAGATAGCTGAGGGG - Intronic
1203527905 Un_GL000213v1:106585-106607 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1187266279 X:17737214-17737236 TTGCTGAGGAGATGGCTGTGGGG - Intergenic
1187655186 X:21463842-21463864 GGGGAGAGGAAATGGAAGAGTGG - Intronic
1188842887 X:35037526-35037548 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1189901397 X:45710498-45710520 GGGGAGAGGAAAAGGCTGATCGG + Intergenic
1193028746 X:76875031-76875053 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1193061707 X:77214422-77214444 TTGCAGATGAAGTGGCAGAGAGG + Intergenic
1193111123 X:77731822-77731844 GAGCAGTGGGAATGGCTCAGTGG - Intronic
1193714909 X:84926817-84926839 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1193805208 X:85985982-85986004 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1193981602 X:88187625-88187647 GAGGAGAGGAAATGGAAGAGTGG + Intergenic
1194055596 X:89127824-89127846 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1194948065 X:100091928-100091950 CTGCAGAGGAAGTGGCAGAGAGG - Intergenic
1195148855 X:102044762-102044784 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1195208132 X:102624748-102624770 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1195690068 X:107617076-107617098 CTGCAGAAGAAATGACTGACTGG + Intergenic
1196227933 X:113188618-113188640 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1197211556 X:123832159-123832181 GTGCAGTGGAAAAATCTGAGAGG - Intergenic
1197722603 X:129755424-129755446 GTGTAGAGGAACAGGGTGAGGGG + Intronic
1197904742 X:131412817-131412839 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1197922731 X:131612528-131612550 GGGAAGAGGAGATGACTGAGAGG - Intergenic
1198504857 X:137291346-137291368 GTTCAGAGAAAATTGCTGTGAGG - Intergenic
1198822374 X:140662303-140662325 GTGCAGAGGAGCTGGGTGAAAGG + Intergenic
1198859567 X:141055074-141055096 GTGCAGAGGGAAAGGCAGAGGGG - Intergenic
1198903126 X:141532316-141532338 GTGCAGAGGGAAAGGCAGAGGGG + Intergenic
1199249037 X:145638215-145638237 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
1199307007 X:146279054-146279076 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1199599805 X:149535219-149535241 GAGCAGAGGAAAAGGAGGAGGGG - Intergenic
1199650836 X:149945033-149945055 GAGCAGAGGAAAAGGAGGAGGGG + Intergenic
1201942988 Y:19479513-19479535 CTGCAGAGGAAATGGATCATGGG - Intergenic