ID: 1049368595

View in Genome Browser
Species Human (GRCh38)
Location 8:142252841-142252863
Sequence TGTGCAGAGGAAATGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 346}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368595_1049368604 13 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368595_1049368606 17 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368595_1049368601 -4 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368595_1049368602 11 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368595_1049368608 24 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data
1049368595_1049368603 12 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368595_1049368611 29 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368611 8:142252893-142252915 AGTGGGGCAGGTATGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368595 Original CRISPR TGTGCAGAGGAAATGGCTGA GGG (reversed) Intronic
900437026 1:2635624-2635646 TGGGCAGAGGAAATGCCCGTTGG - Intergenic
900489049 1:2937240-2937262 TGTGCAGAGGAGAGGGAGGAAGG + Intergenic
900870177 1:5296754-5296776 TGAGGAGAGGAAATGGCTTTTGG - Intergenic
901371502 1:8802020-8802042 TATGCAGAGAAAATGTCTGGAGG + Intronic
901410047 1:9076610-9076632 TGGGGAGAGGAAATGGCTCTTGG + Intronic
901489022 1:9586835-9586857 TGGACAGAGGAACTGGCTGCAGG + Intergenic
901943625 1:12683415-12683437 TGTGGAGAGGAAAAGGCAGGAGG + Intergenic
902238463 1:15073085-15073107 AGTGCAGAGCCACTGGCTGAGGG - Intronic
902308758 1:15564257-15564279 TGTAGAGAGAAAATGGATGATGG - Intronic
904505241 1:30947474-30947496 TGTGAGTAGGAAATGGGTGATGG + Intronic
904917659 1:33981999-33982021 TGTGCCGAGGGCATGGGTGAAGG + Intronic
905922264 1:41727570-41727592 TGTCCAGAGGAAGTGGCTGAGGG + Intronic
905929578 1:41777628-41777650 TGTGCAGAGGAAAGAGCTTTGGG + Intronic
906566195 1:46802895-46802917 AGTGCAGAAGAAAAGGCAGAAGG + Intronic
907246370 1:53111589-53111611 TTTGCTGAGGAACTGGCTGCAGG + Intronic
908034636 1:60038788-60038810 TCTGCATAGGAAAGGACTGAAGG + Intronic
908877651 1:68696404-68696426 TTTGCAGAGGAAAAGTCTAATGG + Intergenic
909561733 1:77015717-77015739 TGTGCTGAGGAAATGACATAAGG + Intronic
909695607 1:78465272-78465294 GCTGCAGTGGCAATGGCTGAGGG + Intronic
909932036 1:81507264-81507286 TGTGCAGGAGAAAGTGCTGAGGG - Intronic
909959490 1:81822261-81822283 TGTTAAGAGGATATTGCTGATGG + Intronic
910427686 1:87132584-87132606 TGGGCAAAGGAAATGGGCGACGG - Intronic
912526626 1:110288177-110288199 TGTGCAGATCAAATGGCGCATGG + Intergenic
913451550 1:118996231-118996253 TGTGCACAGAGAAGGGCTGAGGG - Intergenic
914343231 1:146777316-146777338 GGGGCAGAGAAAGTGGCTGAGGG - Intergenic
914354794 1:146875297-146875319 TGTGAGGAGGAAATGGCAGGGGG - Intergenic
914829687 1:151161573-151161595 TGAGCAGAGGTGATGGCTGCTGG - Intronic
920823600 1:209403780-209403802 GGTGCAGATGAAAAGGCAGAGGG + Intergenic
921827809 1:219693440-219693462 TTTGCAAAGGATGTGGCTGAAGG + Intronic
923027585 1:230218232-230218254 TGTGAAGAAGAGAGGGCTGAAGG + Intronic
923822640 1:237462667-237462689 TGTGCAGAAATAATGGCTAATGG - Intronic
924144084 1:241055840-241055862 TATGCAAAGGAAATGACTGGTGG - Intronic
1064124804 10:12650602-12650624 TGTGCAGTGGACATGGCAAAAGG + Intronic
1067060681 10:43076672-43076694 TGTGCAGCGGAAAGGGCAAAAGG + Intergenic
1067158129 10:43799821-43799843 TGGGCACAGGAACTGGCTTATGG + Intergenic
1070027605 10:72646990-72647012 CCTGCAGAGGTAATAGCTGAGGG - Intergenic
1070793455 10:79203308-79203330 TGTGGAGAGGAAATTGAAGAAGG + Intronic
1072831226 10:98660794-98660816 TGTGAAGAGAAAATTGCTCAAGG - Intronic
1074723406 10:116283658-116283680 TCCGCAGAGGAAAGGGCTCATGG - Intergenic
1075182913 10:120228000-120228022 TGTGGAGAAGAAAGGCCTGAAGG + Intergenic
1075407736 10:122205705-122205727 TCTGCAGAGGAAGGGGCGGATGG + Intronic
1076165731 10:128281072-128281094 TGGGCAGAGGAAATGGGGCAGGG + Intergenic
1076997650 11:306735-306757 TCCGCAGAGGACATCGCTGAGGG - Intergenic
1077342587 11:2032692-2032714 CCTGCAGAGGTAATGTCTGAGGG - Intergenic
1078164905 11:8874160-8874182 CGTACAGAGGAAATGGCTTGCGG - Intronic
1078166257 11:8888347-8888369 TGTGCAGAGAAAGAGGCTGGTGG + Intronic
1078273136 11:9815605-9815627 TGTGCAAAGAGAATGGCAGAGGG + Intronic
1079079856 11:17406677-17406699 TGTGGAGTGGACAGGGCTGAAGG - Exonic
1081579936 11:44345276-44345298 TGGGCACTGGAAAAGGCTGAGGG + Intergenic
1081633086 11:44702549-44702571 TGGGCAGTGGAGATGGCTGAGGG + Intergenic
1082140462 11:48603084-48603106 TGTGGAGAGGGAAAGGCTGTGGG + Intergenic
1083682204 11:64356877-64356899 TGGGCAGAGGGAACCGCTGAGGG + Intronic
1083912470 11:65718286-65718308 GATGCAGAGAAAATGGCTCATGG - Exonic
1084346325 11:68552034-68552056 TGTGCTGAGGGAATGCCTGTTGG + Intronic
1085250610 11:75141189-75141211 CAGGCAGAGGAACTGGCTGATGG + Intronic
1085639080 11:78179938-78179960 TGTGCAAAGGAGATCGCTGCAGG - Intronic
1086460952 11:87004921-87004943 TGTGCTCAGTAAATGTCTGATGG + Intergenic
1087401506 11:97672316-97672338 TGTTCAAATGAAATGGCAGATGG + Intergenic
1088287342 11:108202292-108202314 TGAACAGATGAAATAGCTGAGGG + Intronic
1088788191 11:113201317-113201339 TGTGAAAAGAAAATGGCTGTTGG + Intronic
1088888758 11:114028496-114028518 TGTGCACATGAAAGGGCTGGAGG - Intergenic
1089310577 11:117555749-117555771 TGTGCATAGGTGGTGGCTGAGGG + Intronic
1089898137 11:121952927-121952949 TCTGCAGTGGGTATGGCTGATGG + Intergenic
1090379832 11:126318620-126318642 TGTGGAGAGGACATGGCGGGTGG + Intronic
1091024026 11:132126177-132126199 TTTGCAGAAGAAAAGTCTGATGG + Intronic
1091273955 11:134337546-134337568 GGTGGAGAGAACATGGCTGAAGG + Intronic
1091275417 11:134346319-134346341 TGAGCCGAGGAAATCGCTGACGG - Intronic
1202825573 11_KI270721v1_random:87881-87903 CCTGCAGAGGTAATGTCTGAGGG - Intergenic
1091622260 12:2098057-2098079 TGCGCAGAGCAAATGAGTGATGG + Intronic
1091897382 12:4116495-4116517 TGGACAGAGGAAATGCCTGTTGG - Intergenic
1092025480 12:5235903-5235925 TGTGCAGAGAAAATTTGTGAAGG - Intergenic
1092776004 12:11945805-11945827 TTGGCAGGGGAAATGGGTGAGGG + Intergenic
1092887689 12:12939483-12939505 TGGGCAGCAGACATGGCTGAGGG - Intergenic
1093177420 12:15928490-15928512 TGAGCACAGGAAAAGGCTAAGGG + Intronic
1095310958 12:40695906-40695928 AGTGTAAAGGAAATGGCTAATGG - Intronic
1096579085 12:52572967-52572989 TGTTCAGAGGGAAGGGCTCATGG - Intronic
1096761265 12:53843896-53843918 TGTGAAGAGGAAAGAGCAGATGG + Intergenic
1097381444 12:58900022-58900044 TGTGCAGGGGTAATGATTGAGGG - Intronic
1098916474 12:76261746-76261768 TGTGCAGTGGAAATGGAAGGAGG + Intergenic
1100002589 12:89855369-89855391 GAGGCAGAGGAAATGGCTCAGGG - Intergenic
1100041554 12:90325287-90325309 TGTGCAGAGGATGAGGCTTAAGG - Intergenic
1100162753 12:91879725-91879747 TATGCAGGGGAGTTGGCTGAGGG - Intergenic
1100273532 12:93048923-93048945 TTTGCAGAGGATGTGGTTGAAGG - Intergenic
1101760830 12:107657478-107657500 AGTGGAGAGGAAATGGGAGATGG - Intronic
1102355206 12:112228243-112228265 TATGAAGAGGCAATGCCTGATGG + Exonic
1102488554 12:113274745-113274767 TGTGCAGATGAAGAGACTGAGGG + Intronic
1102549380 12:113680306-113680328 CTTGCAGATGAGATGGCTGAGGG + Intergenic
1102807566 12:115795364-115795386 AGTTCAGAGGGAATGGGTGAAGG - Intergenic
1103224105 12:119271913-119271935 TGTGCAGAGAGACTGGATGACGG + Intergenic
1103726677 12:123000702-123000724 GGTGCAGAGGAATAGTCTGAGGG - Intronic
1104410841 12:128556416-128556438 TGTATAGTGGAAATGGGTGATGG - Intronic
1105245081 13:18642465-18642487 TGTGCGTATGAAATGGCTTAAGG + Intergenic
1105483263 13:20799227-20799249 TGTGCAGAGGACATTGATGAAGG - Exonic
1106004859 13:25759263-25759285 TGTGCACAGGTGATGGGTGAAGG + Intronic
1106074117 13:26442553-26442575 TGTTCACAGGAGATTGCTGAAGG - Intergenic
1106479349 13:30124963-30124985 TTTGGTGAGGAAGTGGCTGAAGG + Intergenic
1107001787 13:35555313-35555335 TCAGCAAAGGAAATGGCAGAAGG - Intronic
1109134357 13:58627636-58627658 TGTGGAAGGGAAATGGCAGAAGG + Intergenic
1110003962 13:70241904-70241926 TGTGCAGGGTAAATGCCAGATGG - Intergenic
1111914141 13:94343345-94343367 TGTGCGGAGGCAAAGGCTGCGGG - Intronic
1112158035 13:96838616-96838638 TGTCCAGTGGAGATGGCGGAAGG - Exonic
1113190767 13:107742957-107742979 TGTGCTGAGGAAATTGGTGTGGG - Intronic
1113635383 13:111915570-111915592 TGTGTAGATGAAATCGCTGTAGG - Intergenic
1116288630 14:43004686-43004708 TGCCCACAGGAAATGCCTGATGG + Intergenic
1117316615 14:54577138-54577160 TGTGCTTGGGAAGTGGCTGAAGG + Intronic
1118243240 14:64082101-64082123 TGTGCATAGGATAGTGCTGATGG + Intronic
1118603826 14:67488689-67488711 TGTGCCGTGGATGTGGCTGAGGG - Intronic
1120171578 14:81251478-81251500 AGTGAAGAGGGAATGACTGAAGG - Intergenic
1120822202 14:88922417-88922439 TCTGCAGAGGTTCTGGCTGAGGG - Intergenic
1121058314 14:90879483-90879505 TGTGCTGAACCAATGGCTGATGG + Intronic
1121499792 14:94425696-94425718 TGTGAAGAAGAAATGCTTGAAGG - Intergenic
1122509424 14:102254587-102254609 GGTGGAGAGGAATTGGTTGAAGG - Intronic
1122649377 14:103217358-103217380 TGTGCAGGGGGAATAGCTGGTGG - Intergenic
1123039281 14:105483787-105483809 TCTGCAGAGGAAGGGGCTGTGGG + Intergenic
1125956735 15:43795543-43795565 TGGAGAGAGGAAATGGCTGCTGG + Intronic
1126195037 15:45922207-45922229 TGTACAAAGGACAAGGCTGAAGG - Intergenic
1126312110 15:47329232-47329254 TGTGCAGCAGAAAGAGCTGAGGG + Intronic
1127315822 15:57792831-57792853 TGTGCAGATGAAAGGGCAGATGG + Intergenic
1127842899 15:62845982-62846004 TGTGCAGGGAAAATGCATGATGG + Intergenic
1128382270 15:67121642-67121664 TGTATAGACTAAATGGCTGAAGG - Intronic
1129388683 15:75209731-75209753 TGGGCAGTGGAAATGGGAGAGGG - Intronic
1130681766 15:86003093-86003115 TGTGTGGAGGACATGGCAGAGGG + Intergenic
1131654658 15:94443591-94443613 TGTGCAGAGGAAAGGGTAAAAGG + Intronic
1132890106 16:2199610-2199632 TGGGCAGAGGAAGGGGCTGCGGG - Intergenic
1133550965 16:6854344-6854366 TATGAAGAGGAAAGGGCTTAAGG + Intronic
1134393343 16:13839954-13839976 TGGGAAGAGGAGATGGGTGAGGG + Intergenic
1135870537 16:26145814-26145836 AGAGCAGAGTAAATGGATGATGG - Intergenic
1135968559 16:27055538-27055560 TGTGGAGAGGACATGGGTGGGGG - Intergenic
1136631775 16:31493178-31493200 TGTGTATGGGTAATGGCTGAGGG - Intronic
1138367375 16:56491387-56491409 TGTGAAGAGGCAAAGCCTGAGGG - Intronic
1138522761 16:57580680-57580702 TTTGAAGATGAAATGGCTGCAGG + Intronic
1138960505 16:62023413-62023435 TTTGCAGAAGAAAAGACTGAAGG - Intronic
1139979226 16:70840235-70840257 TGTGAGGAGGAAATGGCAGGGGG + Intronic
1139990760 16:70938011-70938033 GGGGCAGAGAAAGTGGCTGAGGG + Intronic
1141162936 16:81641152-81641174 TGTGCACAGGAATTGCCTGGGGG - Intronic
1141289157 16:82701796-82701818 TGTTCATAGCAAATGGTTGAAGG - Intronic
1142741008 17:1932074-1932096 TGTCCAGGGGAATTTGCTGAGGG + Intergenic
1143518229 17:7430487-7430509 AGTGGAGAGGTCATGGCTGAAGG - Intergenic
1143568519 17:7740018-7740040 TATGCAAAGGAAATGGTGGAAGG + Intronic
1144139648 17:12336412-12336434 TGTGGAGAGGAACTGGCAGTGGG + Intergenic
1144141225 17:12350374-12350396 AGTAGAGAGGAAATGGTTGAAGG - Intergenic
1144588632 17:16504857-16504879 GGAGCAGAGGATATGGATGAGGG - Intergenic
1144725511 17:17499955-17499977 TGTGCAGAGGTGCTGGCGGAGGG + Intergenic
1147028211 17:37608148-37608170 TGTGCAGAGGAAATGAAAAATGG + Intronic
1147166853 17:38598136-38598158 TGTGCAGAGGCAAGGGCTGTGGG - Intronic
1147587030 17:41658670-41658692 TGTGCAGAGCAAAAGCCTGCTGG - Intergenic
1148234139 17:45956184-45956206 TGTGCAAAGGAATGAGCTGAAGG + Intronic
1148645818 17:49219304-49219326 TGTGCAGAGGAAGTGGCTGTGGG + Intronic
1150659930 17:67066335-67066357 TGTGCAGAGGATTTGGCAAAAGG - Intergenic
1151385675 17:73753839-73753861 TGGGAAGAGGAAATGGCACATGG - Intergenic
1153128674 18:1828727-1828749 TGTGCTCAGGTACTGGCTGATGG - Intergenic
1153443010 18:5141567-5141589 AGTGTAGTGGAAATGGCTGTTGG - Intergenic
1156354509 18:36329662-36329684 TGTGAAGAAGAACTGGCTCAAGG + Intronic
1156722874 18:40091820-40091842 TGTACAATGGAAGTGGCTGAGGG - Intergenic
1158402318 18:57132291-57132313 TGTGCAGATGAGACAGCTGAAGG - Intergenic
1158511589 18:58095330-58095352 GGTGCAAATGAAATGGATGATGG + Intronic
1160513114 18:79463510-79463532 TGGGCACAGGAAATGGCCGTGGG - Intronic
1160939587 19:1614115-1614137 GGTGAAGATGAAATGGGTGAAGG + Intronic
1161100034 19:2416897-2416919 TGTGCAGTGGAATTGGTTTAGGG - Intronic
1161263104 19:3348420-3348442 CTTGCAGAGGAAACGTCTGAAGG + Intergenic
1161271199 19:3390269-3390291 TGTGCAGAGAAGGTGGCTGCCGG + Intronic
1165601445 19:37058367-37058389 AGTGCAGAGGAAATGCCGCACGG - Intronic
1165697790 19:37914104-37914126 AGTGGAGAGCAAATGGCTGATGG + Intronic
1166205200 19:41264838-41264860 TGGGCCGAGGAAAGGGCTGTGGG + Intronic
1167359039 19:49020195-49020217 ACTGCAGAGGAAAGGGCTGGGGG - Intergenic
1167366722 19:49058432-49058454 ACTGCAGAGGAAAGGGCTGGGGG - Exonic
1167962157 19:53114807-53114829 AGAACAGAAGAAATGGCTGAGGG + Intronic
925662058 2:6213145-6213167 TGTGCAGGAGACCTGGCTGAGGG + Intergenic
925899065 2:8495546-8495568 GCTGCAGAGGGAATGGCTGGAGG + Intergenic
926136862 2:10342622-10342644 TGTGCAGAGGTGCTGGCTGGAGG + Intronic
926739651 2:16100872-16100894 AGTGCAGAGGAACTTGCTGCAGG + Intergenic
927178938 2:20430183-20430205 TGTGCAGAGGAAATGTAAGTGGG - Intergenic
928166761 2:28977581-28977603 TGGGGAGAGGAAGTGGCTGGCGG - Intronic
928486338 2:31736209-31736231 TTTTCAGAGGAAATGTCTGAAGG + Intergenic
929056133 2:37877962-37877984 TTTGCAGATGAAAAGACTGAGGG - Intergenic
929818510 2:45255460-45255482 TGTGCAGAGGAAAGGGGTACAGG - Intergenic
929965329 2:46530291-46530313 TGTGCACAGTAAAGGGATGATGG + Intronic
932881075 2:75502758-75502780 TGAACAGTGGTAATGGCTGACGG - Intronic
933874413 2:86604309-86604331 TCTGAAGAGGAAATGTCGGAGGG - Exonic
934618805 2:95791794-95791816 TGTGCAGAGGGAAAGAATGAGGG - Intergenic
934642088 2:96032763-96032785 TGTGCAGAGGGAAAGAATGAGGG + Intronic
934799623 2:97139812-97139834 TAAGGAGAGGAAATGGCCGATGG + Intronic
934833819 2:97563635-97563657 TAAGGAGAGGAAATGGCCGATGG - Intronic
936810144 2:116388823-116388845 TGGGTAGAGGGAATGGCAGATGG + Intergenic
937250926 2:120523136-120523158 ATTGCAGAGAAAATGGCTGGGGG + Intergenic
937708594 2:124950707-124950729 TCTGCAGAGGAAAAGGCCGAAGG - Intergenic
939275324 2:139991418-139991440 TTAGCAGGGGAAATGGCAGAGGG + Intergenic
940981059 2:160004603-160004625 TATCTAGAGGAAATGGCTTAGGG - Intronic
941599460 2:167523369-167523391 TGAGGAGGGGAAATGGGTGATGG - Intergenic
942208686 2:173649013-173649035 TTTGCAGAGGAGAAGACTGAGGG - Intergenic
942491737 2:176496075-176496097 GAAGCAGAGGAAATGGCAGAGGG + Intergenic
944900318 2:204207246-204207268 TGCGCAGAGGAAAGGAATGAAGG - Intergenic
945125605 2:206506280-206506302 TTTGCAGAGGAAAAGGCTTATGG + Intronic
946013546 2:216585962-216585984 AGAGAAGAGGAAAGGGCTGAGGG - Intergenic
946284452 2:218692630-218692652 AGGGCAGAGGAAATGGCTCCAGG - Exonic
947568921 2:231215655-231215677 AGTGCAGAGTAAATGACAGAAGG + Intronic
948192915 2:236073904-236073926 TGTGCAGCGGAAATGCTTGGGGG - Intronic
1169193229 20:3670597-3670619 TGTGCAGAGGAAGTGGCAAAGGG + Intronic
1169912854 20:10661395-10661417 AGTCCAGAGGGAGTGGCTGAGGG + Intronic
1170580666 20:17697331-17697353 TGTGCAGAGGAAAAGGCCTTTGG + Intronic
1170785798 20:19466424-19466446 TGTGCAGTGGAAGTGGCTCGTGG + Intronic
1170871425 20:20210103-20210125 AGTCCAGTGGAGATGGCTGAGGG - Intronic
1172357544 20:34290640-34290662 TGTGCAGAGACAGTGGCTGTGGG + Intronic
1172760346 20:37317024-37317046 GGTGCAGGGGATTTGGCTGAAGG + Exonic
1173058057 20:39635622-39635644 TGTGCTGAGGATATGACTGTGGG + Intergenic
1173366924 20:42394444-42394466 GGTCCACAGGAAATGTCTGAGGG + Intronic
1173402286 20:42736336-42736358 TGTGCAGTGAAAAGGTCTGAAGG + Intronic
1173527243 20:43742595-43742617 TCAGCAGAGGAAATGGGTGATGG - Intergenic
1175539940 20:59742087-59742109 TGTGGAGAGAAAATGTCTGTGGG - Intronic
1175768328 20:61606539-61606561 TATGCAGAGGAACTGGGAGAGGG - Intronic
1176387634 21:6146806-6146828 TGAGCAGAACAAAAGGCTGAGGG - Intergenic
1177951863 21:27548142-27548164 GGAGGAGAGGACATGGCTGAAGG + Intergenic
1177995327 21:28089820-28089842 TGTGGAGAGGAACTGGCAGTGGG + Intergenic
1178415844 21:32404573-32404595 TGAGCAGAGGAAAAGGATGAGGG + Intergenic
1179460767 21:41533555-41533577 GGTGCAGGGGCAGTGGCTGAGGG - Intergenic
1179565240 21:42243609-42243631 TTTACAGAGGAACTGGCTGGGGG - Intronic
1179735838 21:43391442-43391464 TGAGCAGAACAAAAGGCTGAGGG + Intergenic
1180588361 22:16914113-16914135 TCTGCAGAGGAGAAGGCTGTTGG - Intergenic
1181304461 22:21907032-21907054 TGAGCTGAGGAAGAGGCTGAAGG - Intergenic
1181620797 22:24089948-24089970 GGGGCTCAGGAAATGGCTGATGG - Intronic
1182108774 22:27707911-27707933 TGTGCAGAAGAGGTGGCTGCAGG + Intergenic
1183503004 22:38192448-38192470 TGAACAGAGGCCATGGCTGAGGG + Intronic
1184143659 22:42595365-42595387 GATGCAGAGCAAATGGCTCATGG - Intronic
1184266321 22:43348623-43348645 TGGGAAGAGGAAAGGCCTGACGG + Intergenic
1184669570 22:46005663-46005685 GGTGCAGGGGACAGGGCTGAGGG - Intergenic
949896988 3:8775206-8775228 TGTGTTGAGAAAATGGCTGATGG + Intronic
950141758 3:10620625-10620647 TGTGCAGAGCAGATGCTTGATGG + Intronic
950443901 3:13025223-13025245 TGGGGAGATGGAATGGCTGAGGG - Intronic
950583177 3:13876315-13876337 TGGGAAGAGGAGATGGCTGAGGG + Intronic
950784895 3:15426481-15426503 TTTGCAAAGGAAAGGGCTGCAGG - Exonic
952044836 3:29305821-29305843 TTTCCAGAGGAAATTGCTTAGGG + Intronic
952055420 3:29439066-29439088 TGTGCAGAGCCAAGGGCTGGAGG + Intronic
953043253 3:39273389-39273411 TCTGGAGAGGAAAAGTCTGAAGG + Intronic
955029416 3:55201900-55201922 TGCCCAGAGCAGATGGCTGATGG + Intergenic
955321089 3:57974842-57974864 TCTGTAGTGGAAATGGCTGAGGG - Intergenic
955543311 3:60000935-60000957 TGGGAAGAGGAAATGGCAGTGGG - Intronic
956510881 3:69991965-69991987 TATGCAGATGTAATGGCTGAAGG + Intergenic
960570233 3:119178383-119178405 AGTGCAGAGGGAATGACCGAGGG + Intronic
961082086 3:124035058-124035080 TGTGCAGAGGAAAAAACTGGAGG + Intergenic
961128771 3:124446135-124446157 TGGGCAGAGGAGATGCATGATGG - Intronic
962429067 3:135302583-135302605 TATGCTGATGAAATGGCTGCTGG - Intergenic
962783228 3:138741143-138741165 TGTTTAGAGAAAATGCCTGAAGG + Intronic
962868729 3:139469889-139469911 AGTGCTGAGGAAAGGGCTGTGGG + Intronic
964080790 3:152753969-152753991 AGAGCAGAGGAAAGGGCTGTGGG + Intergenic
964495157 3:157280957-157280979 TGTCCAGAGGGAAAGACTGATGG + Intronic
964633012 3:158833095-158833117 TGGGAAGAGAAAATGGCTGGAGG + Intergenic
965186301 3:165468642-165468664 TTTGCAGAGGAAATGGGATAAGG + Intergenic
965227204 3:166005230-166005252 TGTAGAGAGGAAATGCCTGCTGG - Intergenic
966009845 3:175061250-175061272 TGTGCAGATGAAAAAGCTAATGG + Intronic
966834145 3:184036517-184036539 TGTGTAGGTGAAAGGGCTGAAGG - Intronic
966837007 3:184057021-184057043 TGTGTAGAGGAAAGAACTGAAGG - Exonic
966843022 3:184104933-184104955 TGTGTAGAGGAATGAGCTGAAGG - Exonic
967104200 3:186242270-186242292 TGTGCAGAGGGCAGGGCTGGAGG - Intronic
967221730 3:187253100-187253122 CTTGCAGAGGCAGTGGCTGAGGG - Intronic
967861728 3:194157172-194157194 TTTGAAGAGGAAATGGGAGAAGG - Intergenic
968953373 4:3706225-3706247 TGTGCTGAGGAACTGACAGAAGG - Intergenic
970372791 4:15424755-15424777 TGTGGACTGAAAATGGCTGATGG + Intronic
971097728 4:23427121-23427143 AGTGCAGTGGGAGTGGCTGAGGG - Intergenic
971515031 4:27474881-27474903 TCTGCAGAGGTGATAGCTGAGGG + Intergenic
972907228 4:43765850-43765872 TGTGGAGAGGAAAAGACAGAAGG + Intergenic
975245061 4:72110846-72110868 TGAGCAGAAGAAATTGCTAAAGG - Intronic
975668194 4:76754558-76754580 TAGCCAGAGGGAATGGCTGAAGG - Exonic
978349236 4:107803944-107803966 TGGGCAGTGGAAATGGCTCAAGG - Intergenic
980282832 4:130742576-130742598 TAAGCAGAGGAAATGCCAGATGG - Intergenic
983258592 4:165430847-165430869 AGTCCAGAGGAAATGAATGATGG + Intronic
983601709 4:169536815-169536837 TGAGCAAAGGAAAAGGCTGGAGG + Intronic
984103160 4:175511854-175511876 TGTGCTGAGTAAATGGCTTAAGG - Intergenic
984174531 4:176399844-176399866 TGTGAAGAGGCAAGTGCTGATGG + Intergenic
984329214 4:178293803-178293825 CGTGCAGGGGAAATGCCAGATGG - Intergenic
984944689 4:184961826-184961848 TGTGGACTGGAAGTGGCTGATGG + Intergenic
985008594 4:185559783-185559805 TGTGTAGAGGAACTGGCAGTGGG + Intergenic
985750305 5:1669841-1669863 TGTGCTGTGGAAAGGGCTGGAGG - Intergenic
985834501 5:2260729-2260751 TGTGAAAAGAAAAGGGCTGATGG + Intergenic
986282292 5:6333641-6333663 TGTGCAGAGGAAATTGGATAAGG + Intergenic
986924913 5:12734907-12734929 CGTGCAGAGGAAGGGCCTGAGGG - Intergenic
987304776 5:16627142-16627164 TGTTCAGAGGAAATAGCTAAAGG + Intergenic
988981161 5:36570656-36570678 TGTGAAGAGTAAGAGGCTGATGG + Intergenic
989016167 5:36937319-36937341 TGTCAAGAGTATATGGCTGAAGG - Intronic
990128007 5:52542985-52543007 TGTGCAGAGTATCAGGCTGAAGG + Intergenic
990257568 5:53987051-53987073 TGGGCAGTGGAGATGGCTGAAGG + Intronic
990965023 5:61436903-61436925 TGGGCAGTGGAAATGACTGCAGG - Intronic
991550981 5:67835491-67835513 TGTGCCAAGGAGATGGCTGGTGG - Intergenic
992800545 5:80291735-80291757 TGTGCAGCTGAAATAGCTGCAGG + Intergenic
994856076 5:105121109-105121131 TGTGCAGAGGAATTACCTGGGGG - Intergenic
997658235 5:135570843-135570865 TGTACAGAGGAAAGGGCGCATGG + Exonic
1001266291 5:170276829-170276851 TTTACAGAGGAGATGGCAGATGG + Intronic
1001612095 5:173011076-173011098 TGCGAAAAGGAGATGGCTGAGGG - Intronic
1002165089 5:177338933-177338955 GATGGAGAGGAAATGGCTGGTGG - Intronic
1002177471 5:177409390-177409412 TGAGCAGAGGCCATGGCTCATGG + Intronic
1002930266 6:1629525-1629547 AGTGGAGAGGAAGTGGCAGAGGG + Intronic
1003286291 6:4736548-4736570 GGTGCAGGGGACATGGCTGCAGG + Intronic
1003891824 6:10570541-10570563 TGTCCAGAAGAGAGGGCTGATGG - Intronic
1005265134 6:24104401-24104423 TGAGGAGAATAAATGGCTGAGGG + Intergenic
1005753207 6:28902925-28902947 TGTGGGGAGGAAATGGTTAATGG - Intergenic
1006272688 6:32976366-32976388 AGTGGAGAGGAAATGACTGATGG - Exonic
1007389837 6:41544777-41544799 TGTGAAGATTAAATGGCTGGTGG + Intergenic
1007578483 6:42940981-42941003 TGAGCATAGAAAATGGCTGGGGG + Intergenic
1008072183 6:47108956-47108978 TCTGAAGAGGAGATGGATGATGG + Intergenic
1010833155 6:80555340-80555362 TGTGCAGAGGAGAGGGCTGAGGG + Intergenic
1012061053 6:94481627-94481649 TAAGCTGAGGAAATTGCTGAGGG - Intergenic
1012845399 6:104381559-104381581 TGTGCAGTGCCAATAGCTGAAGG + Intergenic
1013023980 6:106251171-106251193 TGTGCAGAGGGAGTGGCAGCTGG - Intronic
1013760590 6:113513114-113513136 TGTGCAGTGGAAATGGAGGGAGG + Intergenic
1020119616 7:5495704-5495726 TGTGCAGAGGAAACGGCGCTGGG - Intronic
1022191104 7:28017630-28017652 TGTGCCTAGGACATGGCTGCTGG - Intronic
1022423094 7:30242625-30242647 TGTTAAGAGGAACTGGCTGGTGG - Intergenic
1023229178 7:38007414-38007436 AGTACAGAGGAAAAGGGTGAGGG - Intronic
1023793417 7:43771585-43771607 TGAACAGAGGAAGGGGCTGATGG - Intronic
1023967780 7:44971960-44971982 GGTGGAGTGAAAATGGCTGATGG - Intronic
1024566334 7:50684157-50684179 TGTCCTGGGGAAATGGGTGAGGG - Intronic
1025935472 7:66032408-66032430 TGGGGAGAGGACATGGCTGTTGG - Intergenic
1025948862 7:66127467-66127489 TGGGGAGAGGACATGGCTGTGGG + Intronic
1027440691 7:78216338-78216360 TGTGAAGAGCAGATGGATGAAGG - Intronic
1028835262 7:95367689-95367711 TGTGGTGATGAAATTGCTGATGG - Intronic
1031438694 7:121765122-121765144 TGTGGACAGGAACTGCCTGAAGG + Intergenic
1031853216 7:126890867-126890889 TGTGGAGTGGAAATTGCAGAGGG - Intronic
1033273783 7:139956021-139956043 TGTGAAGAGGATTTTGCTGAAGG - Intronic
1034338700 7:150339107-150339129 TGAGCAGAGGAAAAGGGTGAGGG + Intronic
1034912489 7:155008756-155008778 TGGCCAGTGGAAATGGCTGGAGG - Intergenic
1035560102 8:597972-597994 GGTGCAGAGGCAATGGCTACAGG - Intergenic
1035665371 8:1376319-1376341 GGTGCACAGGAGCTGGCTGATGG - Intergenic
1038265654 8:26038151-26038173 TGTGCAGATGAGATGGGTAATGG - Intronic
1038669262 8:29569178-29569200 TGTACAGAAGGCATGGCTGAGGG - Intergenic
1038902839 8:31863451-31863473 TGTGCAGAGGTCAGGGCTGGTGG - Intronic
1040546493 8:48401953-48401975 TGTGCAAGAGAAAAGGCTGAGGG - Intergenic
1041460514 8:58106492-58106514 TGTGTAGAAGAAATAGCTGATGG + Intronic
1042209212 8:66361886-66361908 ATTGCAAAGGAAATGGCAGAGGG - Intergenic
1043561350 8:81497756-81497778 AGGGCAGAGGAAATAGCTGAAGG - Intergenic
1044981886 8:97724205-97724227 TGTGCAGAGAAAAAGGGAGAGGG - Intronic
1045007057 8:97925668-97925690 TTTGCAGAGGAAGAGACTGAGGG + Intronic
1045430930 8:102114540-102114562 TGAGGGGAGGAAGTGGCTGAAGG + Intronic
1046527237 8:115396148-115396170 TGTGAAGAGCAAATGCATGATGG - Intergenic
1046628194 8:116597723-116597745 TTTTCAGAGGAAATGGCAGGAGG + Intergenic
1046859986 8:119079780-119079802 GTTGCAGAGGAACTAGCTGAAGG + Intronic
1048009552 8:130444616-130444638 TCTGCAGAGGAAATGGTTAGTGG + Intergenic
1048322672 8:133412501-133412523 TGGGCAGAGGAAAGGGTTGGAGG - Intergenic
1048454154 8:134562789-134562811 TGTGCAGAAGAAATGGATTTGGG - Intronic
1048565783 8:135595651-135595673 TGTGAAGGGGAAATGGCTACTGG - Intronic
1048633393 8:136268875-136268897 TGTGCAGAGCAAAAGGGGGAAGG - Intergenic
1048710649 8:137206535-137206557 TTTTCAGAGGAAAATGCTGATGG + Intergenic
1048880085 8:138864721-138864743 TGAGCAGAGGCAATGGATGGAGG + Intronic
1049044123 8:140136193-140136215 TGGGCAGAGGAGAGGGCTGTGGG + Intronic
1049368595 8:142252841-142252863 TGTGCAGAGGAAATGGCTGAGGG - Intronic
1049739447 8:144230100-144230122 GGTGCAGCAGAAATTGCTGATGG - Intronic
1050073474 9:1840350-1840372 CGTGCAGAGGAAATGGAGGAAGG + Intergenic
1050829117 9:9989558-9989580 TGAGCAGAGGAAGTGGCTCTCGG - Intronic
1051136511 9:13928171-13928193 TGTGCAGGTAAACTGGCTGAAGG + Intergenic
1053434308 9:38065431-38065453 GGTTGAGGGGAAATGGCTGAGGG - Intronic
1054788702 9:69234855-69234877 TGTGCAAAGGCCATGGCTGCTGG + Intronic
1055402589 9:75940399-75940421 TCTTCAGAGGAAATGGCTTATGG - Intronic
1056427340 9:86490470-86490492 TGTGCAGAAGATATGGCATATGG - Intergenic
1056762220 9:89423873-89423895 GGTGCTGAGGGAATAGCTGAGGG - Intronic
1056762246 9:89423977-89423999 GGTGCTGAGGAAGTAGCTGAGGG - Intronic
1056841240 9:89999585-89999607 TGTGCACAGGAGCTGGCTGAGGG + Intergenic
1058549573 9:106099488-106099510 TGTGAAGAGGACTTGGCTCAAGG - Intergenic
1059145660 9:111897079-111897101 TGGGGAGAGGAAAGGGCGGAGGG - Exonic
1059330234 9:113530440-113530462 GGAGCACAGGAAGTGGCTGATGG + Intronic
1061765658 9:132879470-132879492 TGTGAAGAGGGAACTGCTGAAGG + Intronic
1062512904 9:136917282-136917304 AGGGCAGAGGAGATAGCTGAGGG - Intronic
1186199607 X:7143869-7143891 TTTGCAAAGGAGATGGCTGAGGG - Intronic
1186302413 X:8214446-8214468 TGTGCAGAGGGAATGGGTTCCGG - Intergenic
1187058907 X:15767113-15767135 CATGCAGAGTAAATGGATGAGGG - Intronic
1187266280 X:17737215-17737237 TTTGCTGAGGAGATGGCTGTGGG - Intergenic
1187435153 X:19261115-19261137 TGGGCAGTAGAAATGGCCGAGGG - Intergenic
1189241102 X:39525276-39525298 TTGCCTGAGGAAATGGCTGAAGG + Intergenic
1190596109 X:52053713-52053735 AGTGTAGAGGAAATGGATGAGGG - Intronic
1190612715 X:52200360-52200382 AGTGTAGAGGAAATGGATGAGGG + Intronic
1190969104 X:55331698-55331720 GGTGCAGAGCAAATGCCAGATGG + Intergenic
1191850579 X:65582967-65582989 TGGGCAGAAGGAATGGCTTAAGG + Intergenic
1193247860 X:79250972-79250994 AGTGAAGAGGGAATGGCTCAAGG + Intergenic
1195380073 X:104261952-104261974 TGTGCAGAGAATATAGCTGGAGG - Intergenic
1197722602 X:129755423-129755445 TGTGTAGAGGAACAGGGTGAGGG + Intronic
1198651878 X:138872151-138872173 TGAACAGAAGTAATGGCTGATGG + Intronic
1198859568 X:141055075-141055097 AGTGCAGAGGGAAAGGCAGAGGG - Intergenic
1198903125 X:141532315-141532337 AGTGCAGAGGGAAAGGCAGAGGG + Intergenic
1199013045 X:142779254-142779276 TCTGCAGAGGAGACAGCTGAGGG + Intergenic
1199085389 X:143622954-143622976 TGTGCAGTGGATATTGCTCATGG - Exonic
1199691323 X:150311039-150311061 AGTGCAGAGGCACTGGGTGAAGG - Intergenic
1201574770 Y:15451163-15451185 TTTGCAAAGGAGATGGCTGAGGG - Intergenic
1201942989 Y:19479514-19479536 CCTGCAGAGGAAATGGATCATGG - Intergenic
1202621991 Y:56823503-56823525 TAAGGAGAGGAAATGGCCGATGG - Intergenic