ID: 1049368596

View in Genome Browser
Species Human (GRCh38)
Location 8:142252842-142252864
Sequence TTGTGCAGAGGAAATGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 389}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368596_1049368602 10 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368596_1049368608 23 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data
1049368596_1049368601 -5 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368601 8:142252860-142252882 CACAATGGGACACTGCTTCCTGG No data
1049368596_1049368603 11 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368596_1049368604 12 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368596_1049368611 28 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368611 8:142252893-142252915 AGTGGGGCAGGTATGAGGCTTGG No data
1049368596_1049368606 16 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368596 Original CRISPR TTGTGCAGAGGAAATGGCTG AGG (reversed) Intronic
900081816 1:864220-864242 TTGTGCAGAGGAGGGTGCTGAGG - Intergenic
901144488 1:7055914-7055936 TTGTGCAGAGGAAGGGGCAGGGG - Intronic
901157735 1:7151667-7151689 TCCTCCAGAGGAAATGGCTTTGG + Intronic
901459531 1:9383298-9383320 TTGTGCAGAGCAGATGGCGCGGG + Intergenic
901697564 1:11020476-11020498 CTGTACAGAGGACATGACTGAGG + Exonic
902063419 1:13664419-13664441 CTGTGCAGAGGAAATTTCTCAGG - Intergenic
902379480 1:16045867-16045889 TTGTGCAAATGAGATGACTGAGG - Intronic
903208713 1:21802837-21802859 TTTTGCAGAGGAAGAAGCTGAGG - Intergenic
903669302 1:25026010-25026032 TTGTACAGAGGGGAAGGCTGAGG + Intergenic
904041125 1:27585892-27585914 TTGTATAGAGGAGATGGCTGAGG - Intronic
904810056 1:33157698-33157720 TTCTCCAGATGAAATGACTGAGG - Intronic
904920582 1:34004912-34004934 TTGAGAAGAGGTAATTGCTGAGG - Intronic
905922263 1:41727569-41727591 GTGTCCAGAGGAAGTGGCTGAGG + Intronic
905929577 1:41777627-41777649 GTGTGCAGAGGAAAGAGCTTTGG + Intronic
905974092 1:42162956-42162978 TTGTGCAGAGGAAATCGCTGAGG - Exonic
906034737 1:42743130-42743152 TGTTGCAGAGGAAGTGGCAGTGG - Intergenic
906834084 1:49064235-49064257 TTGAGAAGAGGAAATAGATGTGG - Intronic
907575155 1:55519778-55519800 TTGGGCAGAGGAAAGAACTGGGG - Intergenic
907581574 1:55577095-55577117 TTGTGCAGATGAAGAGACTGAGG + Intergenic
907760014 1:57348542-57348564 TTGTACAGATGAAATAACTGAGG + Intronic
907831404 1:58067776-58067798 TTGTACAGATGAACTGGTTGAGG - Intronic
907934919 1:59033397-59033419 TTGATCAAAGGACATGGCTGAGG - Intergenic
908251901 1:62272507-62272529 TTGTGCAAAGGCAGTGTCTGGGG - Intronic
908758627 1:67491791-67491813 TGGTGCTGAGGACATAGCTGTGG + Intergenic
909673610 1:78214678-78214700 TTATGGGGAGGAAATGGCAGTGG - Intergenic
909695606 1:78465271-78465293 TGCTGCAGTGGCAATGGCTGAGG + Intronic
910006327 1:82401376-82401398 TTGTACAGGGGAAATTACTGTGG + Intergenic
910178454 1:84455982-84456004 TTGGGAAGGGGAAATGGATGGGG + Intergenic
911121575 1:94302193-94302215 TGGTGCAGTGGAACTTGCTGTGG - Intergenic
912569369 1:110610169-110610191 TTCAGCAGAGGGAAGGGCTGTGG + Intronic
914354795 1:146875298-146875320 CTGTGAGGAGGAAATGGCAGGGG - Intergenic
914956195 1:152164875-152164897 CTGGGCAGAGGCAAGGGCTGTGG + Intergenic
915270528 1:154750320-154750342 TGGGGCCGAGGAAATGGGTGAGG - Intronic
916354231 1:163886148-163886170 TGGTGAAGAGGAAATGGCCCTGG + Intergenic
916503543 1:165407553-165407575 TAGAGCAGAGAAGATGGCTGGGG - Intronic
917717081 1:177749122-177749144 CTGTGCAGAGGCAATAGCAGTGG + Intergenic
920560169 1:206933038-206933060 TTTTGCAGAGGAAAAGGCGGTGG - Exonic
920757977 1:208753357-208753379 TTGTGCAGAGGGAATAGCAAGGG + Intergenic
923519688 1:234725945-234725967 CTGTGCTGAGGACATGGCCGAGG + Intergenic
1063124507 10:3126893-3126915 TCGTGCAGGGGGAACGGCTGAGG + Intronic
1063618335 10:7621816-7621838 TTGTGCTTAGGAAATATCTGTGG - Intronic
1063778697 10:9295129-9295151 TATTGCAAAGGAAATGGCTCTGG + Intergenic
1063891760 10:10637377-10637399 TAGTGCAGAGCAAATTGCAGTGG - Intergenic
1064179329 10:13100639-13100661 TTATGGCGAGGAACTGGCTGCGG - Intronic
1064321510 10:14309768-14309790 TTGGGAAGAGGAAATGGTCGTGG - Intronic
1064564802 10:16629142-16629164 GTGTGCATAGGAATTGCCTGGGG + Intronic
1065378811 10:25068378-25068400 TCGGGAAGAGGAAATGACTGGGG + Intergenic
1067795457 10:49318251-49318273 ATGGCCAGAGGACATGGCTGTGG - Intronic
1069266944 10:66471065-66471087 TTCTGGAGAGGAAATGGCGTTGG + Intronic
1069885792 10:71622803-71622825 TTGTGCAGAGGAGAGGGATCGGG + Intronic
1071719452 10:88128831-88128853 TTTTGGAAAGGAAATGTCTGGGG + Intergenic
1072079562 10:92014744-92014766 TTGTGCAGTGCTAATGGCTTGGG + Intronic
1073098621 10:100995730-100995752 TTGTGCAGCGGGTAGGGCTGGGG - Intergenic
1074711739 10:116183620-116183642 TTCTGGAGAGGAGAGGGCTGGGG - Intronic
1075394100 10:122114094-122114116 TTGTGGAGGGGAAATGGAAGCGG + Intronic
1076548790 10:131264113-131264135 TTGGGCACAGGAAAGGGGTGTGG - Intronic
1076795020 10:132794185-132794207 TTGTGGGGAGGCACTGGCTGTGG - Intergenic
1077862230 11:6192548-6192570 TTTTACAGATGAAATAGCTGAGG - Intergenic
1078587227 11:12602756-12602778 TTTTGCTGAGGACATTGCTGGGG - Intergenic
1078617637 11:12880358-12880380 TTTTGCAGATGAAAAAGCTGAGG + Intronic
1080563524 11:33486459-33486481 TTGTTCAGAGGAAATTCCTTGGG + Intergenic
1080979870 11:37389042-37389064 TTCTTCAGAGGAAAAGACTGAGG + Intergenic
1081249169 11:40808568-40808590 TTGTGCAGAGGAGAAGGCAGGGG - Intronic
1081633080 11:44702523-44702545 TTGGGCAGTGGAGATGGCAGTGG + Intergenic
1081633085 11:44702548-44702570 ATGGGCAGTGGAGATGGCTGAGG + Intergenic
1082140461 11:48603083-48603105 GTGTGGAGAGGGAAAGGCTGTGG + Intergenic
1082567650 11:54700182-54700204 TTGTGGAAAGGGAAAGGCTGTGG + Intergenic
1083722665 11:64611168-64611190 TGGCTCAGAGGAAATGCCTGAGG - Intronic
1083855997 11:65393425-65393447 TATTGCAGAGTAAATGGCTCTGG + Intronic
1084612156 11:70210088-70210110 TTGTCCAGTGGAAAGGGCTGAGG - Intergenic
1085119436 11:73957729-73957751 GTGTGCAGCGGGCATGGCTGAGG - Intronic
1085346972 11:75774533-75774555 CTGTGCAGATGAGAAGGCTGAGG - Intronic
1085476623 11:76793366-76793388 TAGTGCAGAGGACAAGGCTGAGG + Intronic
1085746064 11:79115291-79115313 GTGGGCAGAGGAGAGGGCTGGGG + Intronic
1086913051 11:92495240-92495262 ATGAGTAGATGAAATGGCTGAGG + Intronic
1088008600 11:104971967-104971989 TTGTGCAGGGGAAATAGTTTGGG - Intergenic
1088318844 11:108534266-108534288 TTGTCCAGATGAACTGGCTTTGG + Intronic
1088423068 11:109669857-109669879 TTTTGCTGAGGTCATGGCTGTGG + Intergenic
1088895830 11:114077613-114077635 TTGCGCAGAGGAGAAGGTTGTGG + Intronic
1089169818 11:116504261-116504283 TGGTGTAGTGGAAAGGGCTGGGG - Intergenic
1089892138 11:121892248-121892270 TTCAGCAAAGGAAATGGCTCTGG - Intergenic
1090187116 11:124746044-124746066 GTGGGCAGAGGGAAGGGCTGGGG - Intronic
1090252075 11:125258695-125258717 AGCTGCAGAGGAAATGGCAGGGG + Intronic
1091292526 11:134449781-134449803 TTGTGAAAAGGAAATTGCTTGGG - Intergenic
1092887690 12:12939484-12939506 TTGGGCAGCAGACATGGCTGAGG - Intergenic
1093589698 12:20886775-20886797 TTGTGCAGTGGTAAAGTCTGGGG + Intronic
1094772543 12:33681720-33681742 TTATGCAAAGGAAATTGCTTAGG + Intergenic
1096439506 12:51628372-51628394 TTCTGCAGAAGAAATCTCTGAGG + Intronic
1098232306 12:68384234-68384256 TTGTGTACAGGAACTGGATGTGG + Intergenic
1098702939 12:73652247-73652269 TTGTGCAGAAAGGATGGCTGGGG - Intergenic
1099393076 12:82103403-82103425 GTATGGAGAGGAACTGGCTGTGG - Intergenic
1100162754 12:91879726-91879748 TTATGCAGGGGAGTTGGCTGAGG - Intergenic
1101502937 12:105320744-105320766 TGGTCCAGAGGAGCTGGCTGGGG - Intronic
1102504431 12:113374709-113374731 TTTTGCAGAGGAGAAAGCTGAGG - Intronic
1102549379 12:113680305-113680327 TCTTGCAGATGAGATGGCTGAGG + Intergenic
1102550895 12:113691559-113691581 TAATGCAGAGGAGATGACTGAGG + Intergenic
1103061924 12:117865377-117865399 TTATTCAGAAGAAAAGGCTGAGG - Intronic
1104939871 12:132390042-132390064 GTGTGCAGAGGACGGGGCTGGGG - Intergenic
1106563298 13:30864618-30864640 CTGTGCAGAGGCCAAGGCTGGGG + Intergenic
1106641501 13:31588665-31588687 TTGTGCAAGGGAAACAGCTGAGG - Intergenic
1108544764 13:51481791-51481813 TTCTTAAGAGGAAAAGGCTGAGG + Intergenic
1110062178 13:71056115-71056137 TTGTGCACAGGTAGTGGCAGTGG + Intergenic
1111065868 13:83090277-83090299 CTGTGCAGAGGGCATCGCTGGGG - Intergenic
1111713420 13:91846916-91846938 TTGTGCAACTGAAATGGGTGCGG + Intronic
1111914142 13:94343346-94343368 TTGTGCGGAGGCAAAGGCTGCGG - Intronic
1112313501 13:98340912-98340934 TTATCCAGAGGAAATGGGTCAGG - Intronic
1113190768 13:107742958-107742980 GTGTGCTGAGGAAATTGGTGTGG - Intronic
1113875248 13:113590157-113590179 CTGTGCAGAGAACGTGGCTGTGG + Intronic
1114411750 14:22507270-22507292 TTGTGAAGATAAAAGGGCTGGGG - Intergenic
1115101349 14:29704561-29704583 TTGTGCAGTGGTAAGGGCTTTGG - Intronic
1116969499 14:51049880-51049902 CTGGGCAGAGGAAATGGCTCTGG + Intronic
1118362629 14:65069202-65069224 CTGTGCAGAGCAGATGGCTCTGG + Intronic
1118603827 14:67488690-67488712 TTGTGCCGTGGATGTGGCTGAGG - Intronic
1120234397 14:81874501-81874523 TTCTGCAGAGGAAAGGACTTTGG + Intergenic
1120652243 14:87148902-87148924 TTTTACACAGGAAATGGCTCTGG - Intergenic
1121329511 14:93041132-93041154 TTGTGAGGAGTAAATGGTTGAGG - Intronic
1121762523 14:96458024-96458046 TTGTGAATAGCAAATGGATGTGG + Intronic
1121863615 14:97342028-97342050 TTTTCCTGAGGAAATGGCAGTGG - Intergenic
1122042733 14:99000595-99000617 CTGTGCATAAGAAATGGGTGTGG - Intergenic
1122941534 14:104983556-104983578 AGGTGCAGAGGAAATGGCAGCGG - Intergenic
1123039280 14:105483786-105483808 GTCTGCAGAGGAAGGGGCTGTGG + Intergenic
1123122612 14:105924952-105924974 CTGTGCAGATGGAAAGGCTGAGG + Intronic
1124715227 15:32053795-32053817 TAGTGCAGAAGAATGGGCTGTGG + Intronic
1124792906 15:32746845-32746867 GTGAGGAGAGGAAAAGGCTGAGG + Intergenic
1125299441 15:38238812-38238834 TTGTGCTGGGGAAAGTGCTGAGG + Intergenic
1125419855 15:39494208-39494230 TTGTGCAGATGAAGAAGCTGAGG + Intergenic
1125743454 15:41983455-41983477 CTGTGGAGAGGAAAAGCCTGGGG - Exonic
1126312109 15:47329231-47329253 TTGTGCAGCAGAAAGAGCTGAGG + Intronic
1126869680 15:52974537-52974559 GTGAGCAAAGGAAATGGCAGGGG + Intergenic
1127043821 15:55005467-55005489 TTCTGAAGAGGAAATAGCTAGGG - Intergenic
1128346972 15:66860294-66860316 TTGCCCAGAGGAAACGGCCGTGG + Intergenic
1128384442 15:67137298-67137320 TGGTACACAGAAAATGGCTGTGG - Intronic
1129365923 15:75054598-75054620 TTGTGCAGAAAAAATGGGGGTGG + Intronic
1129697442 15:77748610-77748632 TTGTGGGGAGGAAAAGGCAGGGG - Intronic
1129907875 15:79202202-79202224 ATGTGCAGAGGATATGGGTGGGG + Intergenic
1130774366 15:86962847-86962869 TTGTGCACAGGAATCAGCTGGGG - Intronic
1131258720 15:90877539-90877561 GTGTGCGGGGGAAGTGGCTGCGG + Exonic
1132594091 16:740448-740470 TTATGCAGATGCAAAGGCTGTGG + Intronic
1132702740 16:1229033-1229055 TGCTTCAGAGGAAATGGCGGTGG + Exonic
1132705586 16:1241835-1241857 TGCTTCAGAGGAAATGGCGGTGG - Exonic
1132890107 16:2199611-2199633 GTGGGCAGAGGAAGGGGCTGCGG - Intergenic
1133420728 16:5644378-5644400 TTGTGCAAAGGAAATGCCCATGG + Intergenic
1134201289 16:12201589-12201611 CTGTGCAGAGGAATTGCCTGGGG + Intronic
1134393342 16:13839953-13839975 TTGGGAAGAGGAGATGGGTGAGG + Intergenic
1135968560 16:27055539-27055561 GTGTGGAGAGGACATGGGTGGGG - Intergenic
1136155770 16:28380930-28380952 TTGTGCAGATGGAGTGGCTTGGG - Intronic
1136207314 16:28734359-28734381 TTGTGCAGATGGAGTGGCTTGGG + Intronic
1136347358 16:29684724-29684746 TTTTGCAGAGGTTAAGGCTGAGG - Intronic
1136536222 16:30901359-30901381 TTGTACAGATGAGAAGGCTGAGG + Intronic
1137005947 16:35274441-35274463 TAGGGCAGTGGAAATGGGTGAGG + Intergenic
1137235587 16:46614572-46614594 TTGTGCAGTGGAAATAACTATGG + Intronic
1138101132 16:54253184-54253206 GTGTGGAGAGGCACTGGCTGGGG - Intronic
1138147698 16:54627109-54627131 TTGCGTAGAAGACATGGCTGTGG - Intergenic
1139101924 16:63777904-63777926 TTGTGCAGAGAAGAAGGCTTTGG + Intergenic
1139151733 16:64389864-64389886 TAGTGCAGAGGAAGAGGGTGTGG - Intergenic
1139979225 16:70840234-70840256 CTGTGAGGAGGAAATGGCAGGGG + Intronic
1141162937 16:81641153-81641175 GTGTGCACAGGAATTGCCTGGGG - Intronic
1141479320 16:84295810-84295832 TTTTGCAGATGAGATTGCTGGGG - Intronic
1142412013 16:89921704-89921726 CTCTGCAGAGGAAATGGAGGTGG - Intronic
1143025256 17:3937790-3937812 TTGGGCAGAGGATGAGGCTGAGG + Intronic
1143179419 17:4974823-4974845 TTTTGCCTAGGAAAAGGCTGGGG - Intronic
1143335072 17:6166009-6166031 GTGTGCAGGGGAAATGGCAAAGG - Intergenic
1143984486 17:10899716-10899738 TTGTACAGAAGAAAAGGATGTGG + Intergenic
1144139647 17:12336411-12336433 GTGTGGAGAGGAACTGGCAGTGG + Intergenic
1144185201 17:12789991-12790013 TGGTGCAGGGGAAAGGACTGAGG - Intronic
1144264243 17:13552791-13552813 TTGAGAAGTGGAAATGGATGTGG + Intronic
1145263313 17:21367389-21367411 TTTTGCAGAGGAAGAAGCTGAGG + Intergenic
1145736130 17:27233099-27233121 TTGAGAAGGGGAAATGGATGTGG - Intergenic
1146169306 17:30620982-30621004 TGGTCTAGAGGAGATGGCTGGGG + Intergenic
1146170256 17:30626467-30626489 TGGTCTAGAGGAGATGGCTGGGG - Intergenic
1146343711 17:32042497-32042519 TGGTCTAGAGGAGATGGCTGGGG - Intronic
1147166854 17:38598137-38598159 CTGTGCAGAGGCAAGGGCTGTGG - Intronic
1148645817 17:49219303-49219325 CTGTGCAGAGGAAGTGGCTGTGG + Intronic
1149451293 17:56751951-56751973 TTTTGCAGAGGAGGAGGCTGAGG - Intergenic
1149713727 17:58767283-58767305 TTTTGCAGATGAAAAAGCTGAGG + Intronic
1150782240 17:68133532-68133554 TGGTCTAGAGGAGATGGCTGCGG + Intergenic
1151363997 17:73605371-73605393 TTGACCACAGGAAATGGGTGTGG + Intronic
1151394479 17:73813160-73813182 TTGTGCAGAAGAGATTGCTTTGG + Intergenic
1151423718 17:74016007-74016029 GTTTGCAGAGGAAACCGCTGTGG + Intergenic
1151968583 17:77445270-77445292 GGGTGCGGAGGAAAGGGCTGGGG - Intronic
1152751100 17:82062793-82062815 TTGCGCAGAGGACATAGCTGAGG - Intronic
1156251991 18:35360243-35360265 TTTTTAAGAGGAAATTGCTGGGG + Intergenic
1156514389 18:37667932-37667954 TAGTGCAGAGGAAATGGAGATGG - Intergenic
1160513115 18:79463511-79463533 ATGGGCACAGGAAATGGCCGTGG - Intronic
1161050282 19:2160198-2160220 ATGACCAGAGGAAATGGCTCAGG + Intronic
1161453829 19:4360644-4360666 TGGTCTAGAGGAGATGGCTGGGG + Exonic
1162785533 19:13032408-13032430 TTGGGTAGAGGAAAGGTCTGAGG + Intronic
1163604286 19:18265649-18265671 TGTGGCAGTGGAAATGGCTGGGG - Exonic
1163997392 19:21063985-21064007 TTATCCAGAGAAAATGACTGAGG - Intergenic
1164704337 19:30308948-30308970 TTGGGCAGGGGACAGGGCTGGGG - Intronic
1164964559 19:32471186-32471208 TTGTGCTGGAGAAAAGGCTGCGG + Intronic
1166205199 19:41264837-41264859 CTGGGCCGAGGAAAGGGCTGTGG + Intronic
1167359040 19:49020196-49020218 GACTGCAGAGGAAAGGGCTGGGG - Intergenic
1167366723 19:49058433-49058455 GACTGCAGAGGAAAGGGCTGGGG - Exonic
1167640239 19:50677719-50677741 ATGTTCAGAGGAACAGGCTGGGG - Intronic
1167677186 19:50894638-50894660 TTGCACAGAGGAAAGGGCTTGGG - Intergenic
1168056574 19:53868073-53868095 TTCTGCAGAGGAGAGGGCTGAGG + Intronic
1168671718 19:58245781-58245803 TTGTAGAGAGGAAGTGGGTGAGG + Intronic
925076888 2:1024069-1024091 TCGTGGAGGGGAAGTGGCTGCGG + Intronic
925832410 2:7909539-7909561 CTATACAGAGGACATGGCTGGGG + Intergenic
926971622 2:18472732-18472754 ATGTGGAGAGGTAATGGCTGGGG + Intergenic
927178939 2:20430184-20430206 GTGTGCAGAGGAAATGTAAGTGG - Intergenic
927291769 2:21411760-21411782 ATGTGGAGAGCAAGTGGCTGTGG + Intergenic
927662593 2:25005435-25005457 TTGTGCAGAGGTACAGGGTGTGG + Intergenic
927940075 2:27097965-27097987 TTCTGCAGAGGAAAAGACTGGGG - Intronic
928306883 2:30177681-30177703 TTTTGCAGATGAAGAGGCTGAGG - Intergenic
928350553 2:30549180-30549202 TTGGCCAGGAGAAATGGCTGGGG + Intronic
928898850 2:36296272-36296294 CTGTGCAGAAGGGATGGCTGGGG + Intergenic
928964616 2:36965044-36965066 TGGTGTAGTGGAAGTGGCTGTGG - Intronic
929056134 2:37877963-37877985 TTTTGCAGATGAAAAGACTGAGG - Intergenic
929461017 2:42101977-42101999 GTGGGCAGAGGAGAGGGCTGGGG + Intergenic
932980444 2:76659128-76659150 TTGTGTATGGGACATGGCTGAGG - Intergenic
933331614 2:80899423-80899445 TTTTGCAGAAGAAAAGACTGAGG - Intergenic
935088361 2:99870150-99870172 TGGTGCAGAGGCTAAGGCTGGGG - Intronic
935543524 2:104377058-104377080 TTGTGCTGAGTAAATGGAGGAGG - Intergenic
936038506 2:109130453-109130475 GTGTGCAGAGGGAGTGTCTGGGG - Intronic
937250925 2:120523135-120523157 CATTGCAGAGAAAATGGCTGGGG + Intergenic
939141209 2:138356841-138356863 TTTTACAGAGAAAAAGGCTGAGG + Intergenic
939764072 2:146224119-146224141 TTGTCCAGAGAAAATGGGGGAGG + Intergenic
940211799 2:151262733-151262755 TTGTGCAGAGGAAAAGGCCCAGG - Intergenic
942208687 2:173649014-173649036 TTTTGCAGAGGAGAAGACTGAGG - Intergenic
943332352 2:186574639-186574661 TTGTGCATAGGAAACAACTGAGG + Intergenic
945908922 2:215624364-215624386 ATGTGCAGAGGAAATTTCTTTGG + Intergenic
947668610 2:231922941-231922963 TTGTGCAGAGGAAAGGGTCTGGG + Intronic
947876415 2:233470758-233470780 GTGTGAGGAGGAAATGGCTCTGG + Exonic
948192916 2:236073905-236073927 ATGTGCAGCGGAAATGCTTGGGG - Intronic
1169193228 20:3670596-3670618 TTGTGCAGAGGAAGTGGCAAAGG + Intronic
1169937690 20:10902267-10902289 TTTTGCAGGGGAGAAGGCTGAGG + Intergenic
1172015171 20:31869204-31869226 TTGTGCTGAGGAGGAGGCTGAGG + Intronic
1172357543 20:34290639-34290661 CTGTGCAGAGACAGTGGCTGTGG + Intronic
1172422096 20:34825985-34826007 TTGTGAAGAGCAAATGGAGGTGG + Intergenic
1172586350 20:36087881-36087903 ATGTGTAGAAGAAATGGGTGGGG - Intergenic
1173058056 20:39635621-39635643 ATGTGCTGAGGATATGACTGTGG + Intergenic
1173750464 20:45471360-45471382 TTCTCCAGAGGAAAATGCTGAGG + Intronic
1174124194 20:48290628-48290650 TTGTGCAGACAGAATGACTGTGG - Intergenic
1174294625 20:49536854-49536876 TTTTGCAGATGAGATCGCTGAGG + Intronic
1174902363 20:54513855-54513877 TTTAGCAGAGGAAGGGGCTGTGG + Intronic
1175354592 20:58354281-58354303 TTTTACAGAGGAAATGGATAAGG - Intronic
1175539941 20:59742088-59742110 GTGTGGAGAGAAAATGTCTGTGG - Intronic
1175809959 20:61852574-61852596 TTCTGCAGAGGAGAGAGCTGAGG + Intronic
1176234390 20:64047579-64047601 GTGTGCAGAGGAAAGGCCCGAGG + Exonic
1176243803 20:64087886-64087908 TGGTGCAGATGAAATGGCCCAGG - Intronic
1177092907 21:16792175-16792197 GTGTGCAGTGCAAATGGCAGCGG - Intergenic
1177638150 21:23812371-23812393 TGCTGCAGAGGAGATCGCTGAGG - Intergenic
1177995326 21:28089819-28089841 GTGTGGAGAGGAACTGGCAGTGG + Intergenic
1178415843 21:32404572-32404594 CTGAGCAGAGGAAAAGGATGAGG + Intergenic
1179453124 21:41478975-41478997 TTATTCATAGGAAGTGGCTGAGG - Intronic
1179565241 21:42243610-42243632 TTTTACAGAGGAACTGGCTGGGG - Intronic
1179565837 21:42248219-42248241 TTTTACAGAGAAACTGGCTGGGG - Intronic
1181975535 22:26726756-26726778 TTGTGCATGGAAAATGGCTGGGG + Intergenic
1182975603 22:34621421-34621443 TTGTTGTGAGCAAATGGCTGGGG - Intergenic
1183307809 22:37092237-37092259 CTGAGCAGAGGGAATGGCAGGGG - Intronic
1183503003 22:38192447-38192469 TTGAACAGAGGCCATGGCTGAGG + Intronic
949421639 3:3872361-3872383 CTGTGTAGCTGAAATGGCTGGGG + Intronic
949596380 3:5552236-5552258 TTTTGCAGATGAAAAGACTGAGG + Intergenic
950520823 3:13496797-13496819 TTGTGCAGAGGAAGGTGCTGAGG + Exonic
950583176 3:13876314-13876336 CTGGGAAGAGGAGATGGCTGAGG + Intronic
950672433 3:14535332-14535354 TTTTGCAGAGGAGAAGTCTGAGG - Intronic
950883526 3:16343294-16343316 TTTAGCAGAGGAAGTGGCTGGGG - Intronic
951275982 3:20686785-20686807 TTGTGAAGAGTCAATTGCTGGGG - Intergenic
951659098 3:25042442-25042464 TTCTGCAGAGCAAAGGACTGTGG - Intergenic
952044835 3:29305820-29305842 TTTTCCAGAGGAAATTGCTTAGG + Intronic
952849926 3:37719501-37719523 TTGTGCAGAGGGAGAGGATGTGG + Intronic
953518937 3:43622660-43622682 CTGGGCAGAAGGAATGGCTGGGG - Intronic
954602159 3:51878240-51878262 TGCTGCAGAAGAAATGCCTGAGG - Intergenic
954608066 3:51929090-51929112 TGCTGCAGAAGAAATGCCTGAGG - Intergenic
954983380 3:54767020-54767042 TGGTGCAGAGAAGATGGCTTGGG - Intronic
955321090 3:57974843-57974865 TTCTGTAGTGGAAATGGCTGAGG - Intergenic
955543312 3:60000936-60000958 CTGGGAAGAGGAAATGGCAGTGG - Intronic
956316754 3:67946588-67946610 CTATGCAGAAGAAATGCCTGTGG + Intergenic
959686292 3:109150970-109150992 TTTTGGAGAAGAAATTGCTGAGG - Intergenic
959838211 3:110944950-110944972 TTGCAGATAGGAAATGGCTGTGG - Intergenic
960428939 3:117545195-117545217 GTGTGCAGAGGAAACGGGTGAGG - Intergenic
961811721 3:129525800-129525822 TTTTGCAGATGAAAAGACTGAGG - Intergenic
961911243 3:130318694-130318716 ATGTGCACAGGAAATACCTGGGG - Intergenic
962868728 3:139469888-139469910 CAGTGCTGAGGAAAGGGCTGTGG + Intronic
964080789 3:152753968-152753990 CAGAGCAGAGGAAAGGGCTGTGG + Intergenic
965058607 3:163753837-163753859 TTGTGCTCAGCAAATGGGTGGGG - Intergenic
965079983 3:164022516-164022538 TTGTGCTGAGGTCATGGCTTGGG + Intergenic
966938827 3:184732263-184732285 TGTTGCAGAGGAAAATGCTGAGG + Intergenic
967319033 3:188177626-188177648 TTTTACAGAGGAGAGGGCTGAGG - Intronic
967434141 3:189425129-189425151 TTTTGCAGAGGAAGTGGATGAGG + Intergenic
967852127 3:194090138-194090160 TGGTGCAGTGAAAATTGCTGGGG - Intergenic
968381746 4:102319-102341 TTTTGCAGATGAAAAAGCTGAGG + Intergenic
968398333 4:264311-264333 TTGTCCAGAGGAAATGTGTAGGG - Intergenic
968405136 4:334458-334480 TTTTGCAGATGAAAAAGCTGAGG + Intergenic
971783398 4:31068547-31068569 TGCTGCAGAGTAAATTGCTGTGG + Intronic
974993611 4:69125401-69125423 TTGTCAAGAGGAAATGGGTGAGG + Intronic
975588584 4:75977363-75977385 CTTTGCAGATGAAAGGGCTGAGG - Intronic
975691877 4:76973364-76973386 TGGTGCAAGGGAACTGGCTGTGG + Intronic
975724538 4:77279119-77279141 TTTTCCAGAGGAAGTGGCTTGGG + Intronic
975783392 4:77862896-77862918 TCTTGCAGGGGAAATGGCTCTGG + Intronic
976236845 4:82906449-82906471 AGGTGCAGAGAAACTGGCTGAGG + Exonic
976430127 4:84953289-84953311 TTGCGCAGAGGAAATGGGAGAGG + Intronic
978802312 4:112766903-112766925 TTGTACAGTGGAAATGTGTGTGG - Intergenic
981188025 4:141828037-141828059 TTGGGCCTAGGAAATGGATGGGG + Intergenic
982315539 4:154027520-154027542 TTATGCAGAGAGAATGGCTCTGG - Intergenic
984682703 4:182628645-182628667 TTTTGAATAGGAAATGCCTGTGG - Exonic
985008593 4:185559782-185559804 GTGTGTAGAGGAACTGGCAGTGG + Intergenic
985510037 5:308265-308287 ATGTGCAGTGGAAGTTGCTGTGG + Intronic
987112831 5:14702695-14702717 TGGTCTAAAGGAAATGGCTGAGG - Intergenic
987144259 5:14976610-14976632 TTGTGAAGAGGAAATTCCAGCGG + Intergenic
989098779 5:37805709-37805731 TCCAGCAGAGAAAATGGCTGGGG + Intergenic
989506011 5:42228670-42228692 CTTTGCAGAGGCAATGGCAGAGG + Intergenic
991485759 5:67134953-67134975 TTCTGCAAAGGAAATTGGTGTGG + Intronic
991599843 5:68341326-68341348 TTGTAGATAGGAAATGGCTGAGG - Intergenic
992323524 5:75637302-75637324 TGGTGCAGGGGATGTGGCTGTGG + Intronic
993916832 5:93754382-93754404 TTGTGTACAGGACATTGCTGTGG - Intronic
994097736 5:95862315-95862337 ATGTGCTGAGGACATGGATGTGG - Intergenic
994856077 5:105121110-105121132 ATGTGCAGAGGAATTACCTGGGG - Intergenic
995379474 5:111516076-111516098 TAGAGAAGAGGAAATGGCAGAGG + Intergenic
997260063 5:132459186-132459208 TTGTGGTTAGGAAATGTCTGTGG - Intronic
997473929 5:134131898-134131920 GTGAGCAGGGGACATGGCTGGGG + Intronic
998676586 5:144415400-144415422 TGGAGCAGAGGAAAGGGATGAGG + Intronic
999330923 5:150672767-150672789 TTCTGCAGATGAAGAGGCTGCGG + Intronic
999737525 5:154523794-154523816 TTGTCCAGATGAGAGGGCTGGGG - Intergenic
1000352603 5:160363710-160363732 TTGTGCAGAGGAGGCAGCTGAGG - Intronic
1000847801 5:166303397-166303419 TTATACATAGAAAATGGCTGAGG - Intergenic
1001989960 5:176108240-176108262 TTGTGAGGAGGAAATGACTTTGG + Intronic
1002226910 5:177729898-177729920 TTGTGAGGAGGAAATGACTTTGG - Intronic
1002302443 5:178265003-178265025 TTTTACAGAAGGAATGGCTGGGG + Intronic
1002459648 5:179366965-179366987 TTGTGCACAGGACAAGGGTGTGG + Intergenic
1003697779 6:8428484-8428506 TAGTTCAGAGAAAATGGTTGGGG - Intronic
1004065781 6:12242482-12242504 TTTTATAGAGGAAATGACTGAGG - Intergenic
1004423195 6:15489570-15489592 TTGGACAGAGGAAAGAGCTGAGG + Intronic
1005265133 6:24104400-24104422 TTGAGGAGAATAAATGGCTGAGG + Intergenic
1005763930 6:28992150-28992172 TTAAGCAGAGGGAATGGGTGGGG + Intergenic
1005807965 6:29492799-29492821 TTTTGCAGAGGAAATACCAGAGG - Intergenic
1006011396 6:31045643-31045665 ATGTTCAGAGGAAATTGATGAGG + Intergenic
1006456878 6:34136994-34137016 TTCTGCAGAGGGAAGAGCTGGGG + Intronic
1007578482 6:42940980-42941002 CTGAGCATAGAAAATGGCTGGGG + Intergenic
1008148884 6:47925931-47925953 TTGTGCAGAGGCTGAGGCTGGGG + Intronic
1010660181 6:78561222-78561244 TTCTGCATAGGAAATGACAGAGG - Intergenic
1010833154 6:80555339-80555361 GTGTGCAGAGGAGAGGGCTGAGG + Intergenic
1011556971 6:88580788-88580810 TTGTGCAAAGGAAATTGCCAGGG - Intergenic
1012688419 6:102282657-102282679 TTGTACAGAGGAAAAGACTGAGG - Intergenic
1013535755 6:111061759-111061781 TTGTGGTGAGGAAATGGAGGTGG - Intergenic
1015614030 6:135056023-135056045 TTGTGCATAGCAAAAAGCTGAGG - Intronic
1016138364 6:140576122-140576144 TTATGTGGAGGAAAAGGCTGAGG + Intergenic
1016581552 6:145633947-145633969 TTTTGCAGACGAAGAGGCTGAGG - Intronic
1018225725 6:161626793-161626815 TTGTGCTGAATAAATGCCTGCGG - Intronic
1018650156 6:165986317-165986339 AGGTGCAGAGGAAAGGGGTGGGG + Intronic
1018803540 6:167241329-167241351 ATGAGCAGAGAAAATGCCTGTGG + Intergenic
1019575933 7:1737655-1737677 TGGCGCAGAGGACAGGGCTGCGG - Intronic
1020119617 7:5495705-5495727 CTGTGCAGAGGAAACGGCGCTGG - Intronic
1021003081 7:15358296-15358318 TTCTGCACATAAAATGGCTGAGG + Intronic
1021929068 7:25561744-25561766 TGGTGCAGAGGGTAAGGCTGTGG - Intergenic
1022270353 7:28801169-28801191 TTGTGCAAAGCAAATGTCTGAGG + Intronic
1023361602 7:39422611-39422633 ATGTGCAGAGGTTATGACTGTGG + Intronic
1024566335 7:50684158-50684180 TTGTCCTGGGGAAATGGGTGAGG - Intronic
1024980195 7:55151922-55151944 GTGTTCAGAGGACAGGGCTGGGG - Intronic
1025948861 7:66127466-66127488 ATGGGGAGAGGACATGGCTGTGG + Intronic
1026953170 7:74360903-74360925 TTGAGAAGAGGAATAGGCTGGGG + Intronic
1028631918 7:92944404-92944426 TTTTGCAGAGGAGATAGCTGTGG + Intergenic
1028784946 7:94781878-94781900 TTGTGCAGAGGTGATGGATGGGG - Intergenic
1031454529 7:121962852-121962874 TTGTGCACAGGAGCTGGGTGTGG - Intronic
1032518532 7:132525013-132525035 TTGGGCAGATGAAATGGCTCTGG - Intronic
1033523048 7:142181838-142181860 TTCTGCACAGCAAATGGCTTTGG + Intronic
1033597571 7:142868056-142868078 ATGAGGAGAGGAAATGGGTGGGG + Intronic
1034338699 7:150339106-150339128 GTGAGCAGAGGAAAAGGGTGAGG + Intronic
1035450345 7:158973780-158973802 CTGTGCAGAGGCCGTGGCTGGGG + Intergenic
1035523454 8:293333-293355 TTGTGCAGAGGAGGGTGCTGAGG + Intergenic
1035862731 8:3047283-3047305 TTCTACAGAAGAGATGGCTGGGG - Intronic
1037199466 8:16234450-16234472 TTGAGCACAGGAACAGGCTGAGG - Intronic
1038547404 8:28436081-28436103 GAGTGCAGAGGAGATGGCTGAGG + Intronic
1038884851 8:31651995-31652017 ATGTGCAGAGGGACTGGCAGTGG - Intronic
1039758328 8:40546855-40546877 ATGTTCAGAGGAACTGGCAGAGG - Intronic
1039941528 8:42095481-42095503 TTGGGCAGAAGAAATGCCTTGGG - Intergenic
1040069421 8:43178451-43178473 TTGTGCAGAGGAAAAGTCTGAGG + Intronic
1041727361 8:61030630-61030652 TTGTGCCGAGAAGGTGGCTGTGG + Intergenic
1043222564 8:77685841-77685863 CTGTACAGAGAGAATGGCTGGGG - Intergenic
1044612306 8:94105087-94105109 TTGGGCAGAGGGAAGGGTTGGGG + Intergenic
1044875731 8:96664530-96664552 CAATGCAGAGGATATGGCTGAGG + Intronic
1044922853 8:97184392-97184414 TTTTGCAGAAGACAAGGCTGGGG - Intergenic
1044952773 8:97449909-97449931 TTCTGGAGTGGAAGTGGCTGTGG - Intergenic
1045007056 8:97925667-97925689 TTTTGCAGAGGAAGAGACTGAGG + Intronic
1046729125 8:117706437-117706459 TTGTGAAGATTAAATTGCTGTGG + Intergenic
1046836594 8:118808638-118808660 TTCTGCAGATGAAATATCTGAGG - Intergenic
1046853190 8:118999255-118999277 TAGTGAATGGGAAATGGCTGAGG + Intronic
1048350778 8:133614287-133614309 TGGAGCAGTGGAGATGGCTGAGG + Intergenic
1048454155 8:134562790-134562812 ATGTGCAGAAGAAATGGATTTGG - Intronic
1048531893 8:135257268-135257290 TGGGGAAGAGGAAATAGCTGGGG - Intergenic
1048579458 8:135719213-135719235 TTGTGCAGAGGAATCACCTGGGG + Intergenic
1048781189 8:138003763-138003785 CTGTACAGAGGGCATGGCTGGGG - Intergenic
1048819991 8:138371775-138371797 TAGTGCAGAGAAGATGTCTGTGG - Intronic
1048982979 8:139713092-139713114 TTGTGTAGAGGAGAGAGCTGAGG + Intergenic
1049044122 8:140136192-140136214 GTGGGCAGAGGAGAGGGCTGTGG + Intronic
1049368596 8:142252842-142252864 TTGTGCAGAGGAAATGGCTGAGG - Intronic
1051291674 9:15552074-15552096 TTGTGCAGAGGAGGTGGTGGTGG + Intergenic
1051409886 9:16778684-16778706 TTGTGCAGTGGAAAGAGCTCAGG - Intronic
1052812382 9:33073050-33073072 TTGTGCAAAGGAAATGGCTCAGG + Intronic
1053147875 9:35724169-35724191 GTATGCAGAGGACTTGGCTGGGG - Intronic
1056107889 9:83365532-83365554 TTGTGCATAGGGCATGGCTAGGG + Intronic
1056841239 9:89999584-89999606 CTGTGCACAGGAGCTGGCTGAGG + Intergenic
1057436236 9:95043100-95043122 TTGTGTAGATGAGGTGGCTGGGG - Intronic
1057691786 9:97292377-97292399 TTGTGCAGAGGAGAAAACTGAGG - Intergenic
1057785257 9:98082607-98082629 AAGTGCAAAGGAAAGGGCTGAGG - Intronic
1057976532 9:99611098-99611120 TTGTGAAGACAAAAGGGCTGGGG - Intergenic
1058880101 9:109278309-109278331 AGATGCAGAGGAAGTGGCTGAGG + Intronic
1059148654 9:111926708-111926730 CTGTGCGCAGGAAATGCCTGCGG + Intronic
1059385608 9:113961938-113961960 ATATATAGAGGAAATGGCTGTGG + Intronic
1059954383 9:119500447-119500469 TTGTGCACAGTAAAGGCCTGGGG - Intronic
1060030792 9:120213239-120213261 ATGGGCAGAGAAAATGGTTGTGG + Intergenic
1060111647 9:120910963-120910985 ATGTGCAGATGAGATGGATGTGG - Intronic
1060247028 9:121955656-121955678 TTGTGCAGTGGAAAAGGCAAAGG - Intronic
1061484917 9:130915317-130915339 TTGGGCAGAGGCAAAGGCAGGGG - Intronic
1061891639 9:133624541-133624563 TTGTACAGGAGCAATGGCTGAGG + Intergenic
1062368918 9:136226554-136226576 TTGTGCTGTGGAAGTGTCTGTGG - Intronic
1062686189 9:137814688-137814710 GTGAGCCGAGGACATGGCTGCGG + Intronic
1186199608 X:7143870-7143892 GTTTGCAAAGGAGATGGCTGAGG - Intronic
1186308846 X:8294924-8294946 TGATGCACAGGAAATTGCTGTGG - Intergenic
1187179267 X:16928155-16928177 TGGGGAAAAGGAAATGGCTGGGG - Intergenic
1187266281 X:17737216-17737238 ATTTGCTGAGGAGATGGCTGTGG - Intergenic
1189273047 X:39765157-39765179 TTTTACAGAGGAAGTGACTGAGG + Intergenic
1189318037 X:40069565-40069587 TTGTTCTGAGTAGATGGCTGGGG - Intronic
1189390225 X:40570336-40570358 CTGTGCAGAAGAAATGGGTGAGG + Intergenic
1189971182 X:46419947-46419969 TTGGGAAGAGGAAATGATTGTGG - Intergenic
1190324028 X:49195641-49195663 TTGTAGAGAGAAAATGTCTGTGG + Intronic
1190407665 X:50103748-50103770 TTGAGAAGTGGAAATGGGTGGGG + Intergenic
1190596110 X:52053714-52053736 GAGTGTAGAGGAAATGGATGAGG - Intronic
1190612714 X:52200359-52200381 GAGTGTAGAGGAAATGGATGAGG + Intronic
1190878509 X:54476290-54476312 TGGGGCAGTGGGAATGGCTGTGG - Intronic
1192235225 X:69291359-69291381 TTTTACAGAGGAAATAGCTGAGG - Intergenic
1195822878 X:108966172-108966194 TGTTGCTGAGAAAATGGCTGGGG - Intergenic
1195831201 X:109060926-109060948 TTGTGCAGAGGATATTAATGGGG + Intergenic
1196246170 X:113402933-113402955 GTGAGCAGAGGAAATGCCAGAGG - Intergenic
1196525540 X:116724890-116724912 TTTTTAAGAGGAAATTGCTGGGG + Intergenic
1196612049 X:117726679-117726701 TTGTTCAAAGAAAAGGGCTGCGG - Intergenic
1199063500 X:143387736-143387758 CTGTACAGGGGACATGGCTGGGG - Intergenic
1201574771 Y:15451164-15451186 ATTTGCAAAGGAGATGGCTGAGG - Intergenic
1201907181 Y:19097519-19097541 CTGTACAGAAGACATGGCTGGGG + Intergenic
1202107959 Y:21390091-21390113 TTTTGCAGAGAAAATCACTGTGG + Intergenic