ID: 1049368599

View in Genome Browser
Species Human (GRCh38)
Location 8:142252848-142252870
Sequence GTCCCATTGTGCAGAGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368599_1049368611 22 Left 1049368599 8:142252848-142252870 CCATTTCCTCTGCACAATGGGAC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1049368611 8:142252893-142252915 AGTGGGGCAGGTATGAGGCTTGG No data
1049368599_1049368603 5 Left 1049368599 8:142252848-142252870 CCATTTCCTCTGCACAATGGGAC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368599_1049368602 4 Left 1049368599 8:142252848-142252870 CCATTTCCTCTGCACAATGGGAC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368599_1049368608 17 Left 1049368599 8:142252848-142252870 CCATTTCCTCTGCACAATGGGAC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data
1049368599_1049368604 6 Left 1049368599 8:142252848-142252870 CCATTTCCTCTGCACAATGGGAC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368599_1049368606 10 Left 1049368599 8:142252848-142252870 CCATTTCCTCTGCACAATGGGAC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368599 Original CRISPR GTCCCATTGTGCAGAGGAAA TGG (reversed) Intronic
903250784 1:22052060-22052082 GTCCCATTTTGCAGAGAAGACGG - Intergenic
903961623 1:27061406-27061428 TTCCCACTATGCTGAGGAAAAGG - Intergenic
906676586 1:47697870-47697892 GTTCCATTCTGGAAAGGAAATGG - Intergenic
909930120 1:81488006-81488028 GTCACAAAGTGCAGACGAAATGG + Intronic
910440103 1:87243006-87243028 TTCCAATTCTGAAGAGGAAAGGG - Intergenic
916391490 1:164335714-164335736 CTCCCTTTTTGCAGAGGAAGAGG - Intergenic
917036248 1:170750277-170750299 TTCCCATTGTGCTGGGAAAAGGG - Intergenic
921958035 1:221004082-221004104 GTCCCATTGCACAGAGGTAAAGG + Intergenic
922717284 1:227884274-227884296 GTCCCATCTCACAGAGGAAATGG - Intergenic
923201472 1:231716809-231716831 TTGCCATTATGCAAAGGAAATGG - Intronic
924089374 1:240486680-240486702 GCTCCCTTGTGCAGAGGGAAGGG - Intergenic
924382500 1:243477325-243477347 GCCCCACTGTGCAAAGGAAATGG - Intronic
924724444 1:246655811-246655833 GCCCCATTTTGCAGACGAAGAGG - Intronic
1063124504 10:3126887-3126909 ATCCCATCGTGCAGGGGGAACGG + Intronic
1063945221 10:11169524-11169546 CTCCCACAGTTCAGAGGAAATGG + Intronic
1064565549 10:16635576-16635598 GTATCATTTTGCAGAGAAAAGGG - Intronic
1066195191 10:33092341-33092363 GTCCCATTGGGAAGGGGAAGTGG - Intergenic
1066325824 10:34356689-34356711 CTCCCAGTGTGCAAAGGAGAAGG + Intronic
1068065081 10:52120670-52120692 GTCCCAGTGTGCACAGAAGATGG - Intronic
1068657157 10:59587669-59587691 GTGGCATGGTGGAGAGGAAAAGG - Intergenic
1069999742 10:72367441-72367463 GGCCCATCCTGGAGAGGAAATGG + Exonic
1070823135 10:79374930-79374952 TCCCCATTGTGCTGAGGCAAAGG - Intergenic
1070965365 10:80527099-80527121 ATCCCATTTTGCTGAGGAAATGG - Exonic
1071203446 10:83247308-83247330 CTCCCATTTTACAGAGGAGAAGG + Intergenic
1072853752 10:98924938-98924960 CTCCCATTGTGCACAGGCAATGG + Intronic
1073311652 10:102547037-102547059 TTCCCATTGTGCAGCCGAAGAGG + Intronic
1074754545 10:116614862-116614884 GTCCCATGGGGCACAGGCAATGG - Intergenic
1074936883 10:118190621-118190643 GTCCAATAGGGGAGAGGAAAAGG + Intergenic
1076646374 10:131957655-131957677 GTCCCACTGTGGAGATGAAGGGG + Intronic
1077209080 11:1360034-1360056 GCCCCATTCCACAGAGGAAAGGG - Intergenic
1077466471 11:2735990-2736012 GTCCCTTTGTACACAGGGAAGGG - Intronic
1078088994 11:8252218-8252240 GCCCCATTTTGCAGAGGACTAGG - Intronic
1078892273 11:15567942-15567964 GGCCCATTGTTAATAGGAAATGG + Intergenic
1080295374 11:30721007-30721029 GTCCCATAGTGCATAGCACAAGG - Intergenic
1081249173 11:40808574-40808596 GCTCCGTTGTGCAGAGGAGAAGG - Intronic
1081612130 11:44568960-44568982 TTCCCATGGGGCAGAGGAAGTGG - Intronic
1083103475 11:60334613-60334635 GTCCCAATATCCAGAGGCAAAGG - Intergenic
1083532744 11:63439371-63439393 GTCCCAGTTTGCAGACGACATGG + Intergenic
1083651739 11:64208224-64208246 GTCCGACTGTGGAGAGGATAGGG + Intronic
1085905015 11:80749680-80749702 TTCCCCTTATGCAGAGGAAACGG - Intergenic
1087564568 11:99837617-99837639 GTCCCAGTGTTCCTAGGAAAAGG + Intronic
1088367773 11:109057029-109057051 GTCTCACTGTGCACAGAAAAGGG + Intergenic
1089620190 11:119717706-119717728 GTCCCAGAGGGCAGAGGAGAGGG + Intronic
1090672155 11:128956012-128956034 CTCCTAATGTGCAGATGAAATGG + Intergenic
1092029157 12:5269400-5269422 AACCCATTCTGAAGAGGAAAAGG - Intergenic
1092082066 12:5724454-5724476 GTCCCATTGAGCAGGGGATGAGG - Intronic
1093144617 12:15550567-15550589 GGCCCATAGGGCAGATGAAATGG + Intronic
1093396967 12:18694338-18694360 CTCCCAACATGCAGAGGAAAAGG + Intronic
1093688887 12:22087112-22087134 TTTCCATTTAGCAGAGGAAATGG - Intronic
1094558001 12:31522235-31522257 ATCACATTGTGCAGTAGAAAAGG + Intronic
1096524047 12:52200261-52200283 CTCCCATTTTGCAGAGGAATGGG + Intergenic
1097913631 12:64996759-64996781 TTCCCATTTTGCAGATGAGAAGG - Intergenic
1098258226 12:68639753-68639775 GCCCCTTTTTGCAGAGGAAGGGG + Intronic
1099760887 12:86919066-86919088 GTCCCTGTGTGCAGATGACATGG + Intergenic
1100760810 12:97804820-97804842 GTCCCATTGTGGAAAGAATAGGG + Intergenic
1101049432 12:100845868-100845890 GTTTCATTGAGTAGAGGAAATGG + Intronic
1101603302 12:106229228-106229250 GTCGCCTTGTGCGCAGGAAAGGG + Intergenic
1110419564 13:75290804-75290826 TTCCCATTTTGTAGAGGAAGAGG + Intronic
1110692826 13:78451896-78451918 GTAACATTTTGCTGAGGAAAAGG + Intergenic
1110747058 13:79066463-79066485 GGCTCATTGTTTAGAGGAAATGG - Intergenic
1112308656 13:98298235-98298257 ATCCCATTTTGCCAAGGAAAAGG + Intronic
1112585026 13:100711483-100711505 GTCCCATTGTGCATAGAATAGGG + Intergenic
1114297975 14:21347373-21347395 ATCCCAATTTGCATAGGAAAGGG - Intronic
1114400670 14:22407274-22407296 GTCCCGTGATGCAGAGGAAGTGG - Intergenic
1115355192 14:32439379-32439401 GCCCCAGTGTGGGGAGGAAAGGG + Intronic
1119320786 14:73729033-73729055 ATCCCATTTTGCAGAGGAAATGG + Intronic
1119526255 14:75324865-75324887 ACTCCATTGTGCAGAGGAAGGGG - Intergenic
1119646859 14:76354483-76354505 GTCCCATTTTACAGATGTAAAGG + Intronic
1120051964 14:79877277-79877299 GCCCCATTGAGAAGAGGATAGGG - Intergenic
1120178235 14:81317679-81317701 GTCCCAGTGTTCAGAGTAGATGG + Intronic
1122193914 14:100070397-100070419 GTCCCAATTTGCAGAGTCAAGGG + Intronic
1122604113 14:102937142-102937164 GTCACATTATACAGAGGACATGG - Intronic
1124854090 15:33370263-33370285 GTCAGAGTGTGTAGAGGAAAGGG - Intronic
1125324908 15:38526614-38526636 TTACCACTGTGGAGAGGAAAAGG - Intronic
1128045708 15:64615968-64615990 GACTCATTGTGAAGGGGAAAAGG + Intronic
1128628739 15:69240754-69240776 CTCCCAAAATGCAGAGGAAAAGG + Intronic
1130351104 15:83092461-83092483 CTTCCTATGTGCAGAGGAAAGGG + Intergenic
1134037346 16:11040989-11041011 GTCCCACTGTGGAGAGGAGGAGG - Intronic
1137569406 16:49555469-49555491 TTCCCATTTTGTAGACGAAAGGG + Intronic
1138025350 16:53517947-53517969 CTCCAATTCTGCAGAAGAAATGG + Intergenic
1138302831 16:55946964-55946986 ATCCCATTGACCAGAGCAAAGGG + Intronic
1138582328 16:57949618-57949640 GTCCCCTCATGCAGAGGAGAGGG - Intronic
1140368220 16:74397860-74397882 TCCCCACTATGCAGAGGAAAAGG + Intergenic
1141289161 16:82701803-82701825 GTCCCCTTGTTCATAGCAAATGG - Intronic
1141856604 16:86685564-86685586 ATCACATTCTGCAGAGAAAACGG - Intergenic
1142328436 16:89433839-89433861 GCCCCACTGTGGAGAGAAAAGGG + Intronic
1143335074 17:6166015-6166037 GAGCCAGTGTGCAGGGGAAATGG - Intergenic
1143746305 17:8996709-8996731 CAACCATTGTGCACAGGAAAGGG + Intergenic
1143856538 17:9855262-9855284 ATCCCATTTTGCAGAAGAAGGGG + Intronic
1145795452 17:27652977-27652999 ACCCCATTTTGCAGAGGGAAGGG - Intergenic
1145917290 17:28582386-28582408 GTCCCACTAGGCAGAGGGAACGG - Intronic
1146256873 17:31396854-31396876 GGCCCACTGTCCAGAGGAGATGG - Intronic
1146660843 17:34664373-34664395 GTCCCATTTTCCAGAGGAAGAGG + Intergenic
1147239655 17:39082252-39082274 GGGCCATGGTGCAGAGGCAAAGG + Intronic
1149001550 17:51762806-51762828 GTTTCATTTTGCAGTGGAAAGGG - Intronic
1149524390 17:57343189-57343211 GACCCACTTTGCAGATGAAATGG + Intronic
1149991026 17:61383646-61383668 GTCCTATTCTGCAAAGGCAAAGG - Intronic
1150848604 17:68683763-68683785 CTCTCATTGTGTAGAGGCAATGG + Intergenic
1151129146 17:71877629-71877651 TTCCCATTGTGCAGATGAGCAGG + Intergenic
1156637894 18:39053219-39053241 GTCCCATTGAACAGAGAAGATGG + Intergenic
1157057541 18:44248556-44248578 GTCCCATTTTACAGATGAAGGGG - Intergenic
1158304263 18:56087338-56087360 GCCCCATTGTTCATAGGAAGAGG + Intergenic
1163982528 19:20914501-20914523 TTCCCATTGTGGAGAGTAAGAGG - Intergenic
1164619051 19:29682894-29682916 CTCCCACTGTGCAGAGGGAGGGG + Intergenic
1164633378 19:29776030-29776052 TTCCCATTTTGCAGATGGAAAGG + Intergenic
1164917309 19:32062270-32062292 GTCCCATTCTTGAGAGGAGAAGG + Intergenic
1165982843 19:39739232-39739254 GGGCTATTGTGCAGAGGATATGG - Intergenic
925199357 2:1953664-1953686 GTCCCATTGTGCGAAGCAAAGGG + Intronic
925586703 2:5471794-5471816 CTCCCATGCTGCAGAGCAAATGG - Intergenic
925972527 2:9116229-9116251 GGGCCATTGTGAAGATGAAATGG - Intergenic
930073662 2:47389659-47389681 TTCCCAAATTGCAGAGGAAATGG - Intergenic
935656646 2:105429045-105429067 GTCCTATACTGCAGAGGAGAAGG + Intronic
940575404 2:155497071-155497093 TACCCATTGTTCAAAGGAAAGGG - Intergenic
941944673 2:171081860-171081882 GTTTCACTGTTCAGAGGAAAGGG - Intronic
942982654 2:182100886-182100908 GTCCCAATGGTCAGAGGACAAGG + Intronic
943033438 2:182712921-182712943 TTCCCATTGCTCATAGGAAAAGG + Intergenic
944527500 2:200634924-200634946 GGGCCATTGTGGAGAGGACATGG + Intronic
945035191 2:205698356-205698378 GGCCCACTGTGCAAAGTAAATGG - Intronic
945673600 2:212831280-212831302 GCATCCTTGTGCAGAGGAAAGGG + Intergenic
946536443 2:220634960-220634982 GTGCTATTGTGAAGATGAAAGGG + Intergenic
946740475 2:222796098-222796120 GTCACCTTGTCCAGAGGGAAAGG + Intergenic
948991003 2:241553971-241553993 GACCCACTGGGCAAAGGAAATGG + Intergenic
1169402597 20:5295682-5295704 GGCCCAGTGTGCAGAGAAAAGGG - Intergenic
1169895252 20:10498385-10498407 GTTCCATTCTGCAGAGTAATGGG - Intronic
1170580662 20:17697324-17697346 GCCTCCCTGTGCAGAGGAAAAGG + Intronic
1173637522 20:44573685-44573707 TTCCCATTTTACAGATGAAAAGG - Intronic
1173638542 20:44582412-44582434 GGCTCATTGTCCAAAGGAAATGG + Intronic
1173684182 20:44911011-44911033 GCCCCATTTTGCAGATGAAAAGG - Intronic
1173888861 20:46487287-46487309 GACTCATTGTTCAGAGAAAATGG - Intergenic
1175242389 20:57559361-57559383 GTCCCATTTTGCTGATAAAACGG - Intergenic
1177051607 21:16241850-16241872 CTCCCTCTGTGCAGATGAAAAGG - Intergenic
1177486022 21:21757308-21757330 GTCTCTTTCTGCAAAGGAAATGG - Intergenic
1179591155 21:42409479-42409501 GCCCCGTTGGACAGAGGAAAAGG - Exonic
1179941423 21:44640953-44640975 GTCCCAATCTGGAGAGGAAGAGG + Intronic
1181018598 22:20086089-20086111 GTCCAGTGGTGCAGAGGTAATGG + Exonic
1181721298 22:24776631-24776653 GGCTCACTGGGCAGAGGAAAAGG + Intergenic
1182967362 22:34534778-34534800 AGCCTAGTGTGCAGAGGAAATGG + Intergenic
1183931840 22:41239864-41239886 GAGCCATTGGGCAGAGGCAAAGG - Intronic
1184116728 22:42426719-42426741 GTCTCAGGGTGCAGAGGAATAGG + Intronic
949639435 3:6018715-6018737 GTCCCCTTGAGGACAGGAAAAGG + Intergenic
950267574 3:11586013-11586035 GTCCCACTTTGCAGGGGGAAGGG - Intronic
950570004 3:13793851-13793873 ATCCCATTTTGCAGAGCAAGAGG - Intergenic
952426412 3:33179143-33179165 GTCCCATTGTAGAGAAGAAATGG - Intronic
953376199 3:42430534-42430556 GCCCCATTTTGAAGATGAAAAGG + Intergenic
953496470 3:43391704-43391726 GTCCCATAGTGGTGAGGAACTGG + Intronic
954386262 3:50245728-50245750 TTCCCTCTGTGCAGTGGAAAGGG + Intronic
954521007 3:51226467-51226489 TTCCCATTTGACAGAGGAAAAGG + Intronic
955541809 3:59984567-59984589 GCCCCAGAGTGCAGAGTAAAAGG + Intronic
955822672 3:62912690-62912712 GTTCCATGGTGTAGTGGAAAGGG - Intergenic
957096588 3:75782487-75782509 GGCCTGTTGTGCAGTGGAAATGG - Intronic
957230019 3:77501006-77501028 GTGCCAGTATGCAGAGCAAAAGG + Intronic
958798890 3:98733521-98733543 GTTCCATTGTGGAGGGAAAAAGG - Intronic
958915243 3:100042750-100042772 GTCCCTTTGTGTGGAAGAAATGG - Intronic
960837242 3:121919323-121919345 GTCCCATGATGAAGAGGAATGGG + Intronic
961082772 3:124040675-124040697 GTCCCATTTTGCAGAAGATGAGG - Intergenic
961810533 3:129519232-129519254 GTCCCCATGTGCACAGGAGAAGG - Intronic
967319036 3:188177632-188177654 CTCCCATTTTACAGAGGAGAGGG - Intronic
967717800 3:192783263-192783285 ATCACATTGAGCAGAGGAGAGGG + Intergenic
969893599 4:10282030-10282052 GTCTCTTTGTGCAGAAGAATGGG + Intergenic
969894552 4:10291184-10291206 GTCCCTTTGTGCAGACGGATGGG + Intergenic
971414070 4:26407194-26407216 GTACCGTTTTGCAAAGGAAAAGG + Intronic
971653573 4:29311204-29311226 GTTACACTGAGCAGAGGAAAAGG + Intergenic
971937396 4:33169700-33169722 GTCCCTATTTGCAGATGAAAGGG + Intergenic
975821264 4:78273244-78273266 GTCCCTATTTGCAGAGGACATGG - Intronic
976683415 4:87783650-87783672 GTCCCTTTTTGCAGAGGATGAGG - Intergenic
977572775 4:98646965-98646987 GTGCCATTTTGCAGATGAAGGGG + Intronic
977715308 4:100175421-100175443 GTCGGACTGAGCAGAGGAAATGG - Intergenic
983852754 4:172602950-172602972 ATGCCATTGTGCTGAGCAAAAGG + Intronic
986069665 5:4269654-4269676 GTCCCGATGTGCAGAGGATTGGG + Intergenic
986474615 5:8114829-8114851 CTCCCATTGTGAGGTGGAAATGG - Intergenic
988196204 5:28009247-28009269 GGCCCTTTGAACAGAGGAAAGGG + Intergenic
988793060 5:34626781-34626803 AACCCATTGTGCAGAGGTACAGG - Intergenic
989064496 5:37445999-37446021 GTCCCTGTGTGCAGATGACATGG + Intronic
992377647 5:76204486-76204508 GTCCCATCTTCCAGTGGAAATGG + Intronic
992693902 5:79265428-79265450 GTCCCATTCTGCAGATCTAAAGG + Intronic
996861860 5:128076236-128076258 GTCCCATTCTTCAGAGGTTATGG - Intergenic
1002302438 5:178264997-178265019 GTCCCATTTTACAGAAGGAATGG + Intronic
1002882970 6:1269085-1269107 GTCCCACTTTATAGAGGAAATGG - Intergenic
1003378255 6:5598932-5598954 GTTCCAGTGTACAGAGGAAAAGG - Intronic
1004073774 6:12326687-12326709 GCTCCCTTGTGCAGAGGAAGGGG - Intergenic
1005108179 6:22248120-22248142 TTCCCATCCTCCAGAGGAAATGG - Intergenic
1006839157 6:37017193-37017215 GTCCCACTGTGCAGATGCACCGG + Intronic
1006870521 6:37247097-37247119 GTCCCATTGCCTAGAGGAAAAGG + Intronic
1016464919 6:144315661-144315683 GTGCCTTTGTGCAAAGCAAAAGG + Intronic
1016652717 6:146481683-146481705 GTCCCAGCGTGGAGAGCAAAGGG - Intergenic
1018688694 6:166325321-166325343 GTCCCATTTTAAAGAAGAAAGGG - Intronic
1019163939 6:170087045-170087067 GTCCAACTGTGTAGAGGAAAGGG + Intergenic
1020762708 7:12288446-12288468 TTTTCAATGTGCAGAGGAAATGG - Intergenic
1020951947 7:14690420-14690442 GTCCGATTGTGCCAAGTAAAAGG + Intronic
1027810525 7:82891466-82891488 GTCCCTTTTTGCAGATGACATGG - Intronic
1029581925 7:101442043-101442065 ATCCCATCGTGCAGAGGTTAAGG + Intronic
1031593795 7:123624917-123624939 GTTCCATTCAGCAGAGGAAGAGG - Intronic
1034421576 7:150993658-150993680 GTCCCATTGTGTATGGGATAGGG + Intronic
1035202173 7:157274716-157274738 GTCCCTCTGTGCAGTGGAATAGG + Intergenic
1035235326 7:157494125-157494147 GTCACATTGTGAAAAGGCAATGG - Intergenic
1035927460 8:3743891-3743913 GACAAATGGTGCAGAGGAAAAGG - Intronic
1037647795 8:20809547-20809569 TTCCCATTCTACAGATGAAAAGG + Intergenic
1043931589 8:86097962-86097984 GTCCAATTTTGCAGAGGTAGTGG + Intronic
1048190554 8:132284520-132284542 GTCCCATGGAGAGGAGGAAAGGG + Intronic
1048565786 8:135595658-135595680 GTCCCACTGTGAAGGGGAAATGG - Intronic
1048642782 8:136383011-136383033 GTCACATTGACCAGAGGAGATGG + Intergenic
1048836153 8:138520778-138520800 CTCCCACTGTGCAGGGGACATGG - Intergenic
1048970777 8:139643871-139643893 CTTCCATGGTGCAGAGGAAGGGG - Intronic
1049251176 8:141589939-141589961 TTCCCATTTCGCAGAGGAGAAGG + Intergenic
1049363568 8:142225663-142225685 GTCCCAGACTGCAGAGGAGATGG - Intronic
1049368599 8:142252848-142252870 GTCCCATTGTGCAGAGGAAATGG - Intronic
1049696106 8:143985048-143985070 GTCCCATGGTGCAGGGTAGAGGG - Exonic
1051106166 9:13582950-13582972 GTCCCACTGTGTAGCGGAACTGG + Intergenic
1052476792 9:28970980-28971002 TTCCCCTTGAGGAGAGGAAAGGG + Intergenic
1053148442 9:35727770-35727792 GTCTAAGTGTCCAGAGGAAATGG - Intronic
1053567200 9:39265871-39265893 GTCCGTATCTGCAGAGGAAATGG + Intronic
1053567466 9:39268533-39268555 GTCCGTATCTGCAGAGGAAATGG + Intronic
1053833483 9:42109484-42109506 GTCCGTATCTGCAGAGGAAATGG + Intronic
1054129677 9:61350465-61350487 GTCCGTATCTGCAGAGGAAATGG - Intergenic
1054129943 9:61353127-61353149 GTCCGTATCTGCAGAGGAAATGG - Intergenic
1056434092 9:86558576-86558598 GTCCCAATGGGTAGAGGAGATGG + Intergenic
1056479458 9:86986319-86986341 GGCCCTTTGTGCAGAGAAGAAGG - Intergenic
1058524800 9:105846032-105846054 TTCTCAGAGTGCAGAGGAAAAGG + Intergenic
1060247030 9:121955662-121955684 GTAGCCTTGTGCAGTGGAAAAGG - Intronic
1060894787 9:127210680-127210702 GTCCCCTGCTTCAGAGGAAAAGG - Intronic
1061259342 9:129471217-129471239 GTCGCAGTGTGTATAGGAAAGGG + Intergenic
1062443648 9:136584404-136584426 GTCCCATGGAGCAGGGGACACGG - Intergenic
1186543424 X:10424259-10424281 GCCCACTTGTGGAGAGGAAAGGG + Intergenic
1186847529 X:13545273-13545295 ATCCCTTTGAGCAGAGGAATAGG - Intergenic
1189684698 X:43551786-43551808 GTCCCATGGTGCACAGGAAATGG - Intergenic
1191204839 X:57822770-57822792 CTCCCCCTGTACAGAGGAAAGGG + Intergenic
1195940971 X:110167922-110167944 GCCCCATGCTGCAGAGGGAAAGG - Intronic
1196731188 X:118943100-118943122 TTCCCATGGGCCAGAGGAAAGGG + Intergenic
1198061117 X:133045938-133045960 GTCCAATTCTGGAAAGGAAAAGG + Intronic
1198226055 X:134647027-134647049 GCCCCATTTTGCTGAGGACATGG - Intronic
1199654599 X:149981759-149981781 GACCCATTTTACAGAGGAAGAGG - Intergenic
1199799868 X:151239902-151239924 GTCACAATGTGAAGAGCAAAGGG - Intergenic
1201166303 Y:11212289-11212311 GTCATGTTGTGCAGTGGAAATGG - Intergenic