ID: 1049368600

View in Genome Browser
Species Human (GRCh38)
Location 8:142252854-142252876
Sequence AGCAGTGTCCCATTGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368600_1049368606 4 Left 1049368600 8:142252854-142252876 CCTCTGCACAATGGGACACTGCT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368600_1049368603 -1 Left 1049368600 8:142252854-142252876 CCTCTGCACAATGGGACACTGCT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049368603 8:142252876-142252898 TTCCTGGCCACTGCCCTAGTGGG No data
1049368600_1049368604 0 Left 1049368600 8:142252854-142252876 CCTCTGCACAATGGGACACTGCT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049368604 8:142252877-142252899 TCCTGGCCACTGCCCTAGTGGGG No data
1049368600_1049368611 16 Left 1049368600 8:142252854-142252876 CCTCTGCACAATGGGACACTGCT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049368611 8:142252893-142252915 AGTGGGGCAGGTATGAGGCTTGG No data
1049368600_1049368602 -2 Left 1049368600 8:142252854-142252876 CCTCTGCACAATGGGACACTGCT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG No data
1049368600_1049368608 11 Left 1049368600 8:142252854-142252876 CCTCTGCACAATGGGACACTGCT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049368608 8:142252888-142252910 GCCCTAGTGGGGCAGGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368600 Original CRISPR AGCAGTGTCCCATTGTGCAG AGG (reversed) Intronic
900296398 1:1953642-1953664 AGCAGAGTCCACTTGTGCCGTGG + Intronic
901196232 1:7441516-7441538 CGCAGTGTCCACTGGTGCAGGGG + Intronic
902178542 1:14670012-14670034 ACCAGTTTGCCATTGTACAGGGG - Intronic
903331301 1:22598409-22598431 AGCAGGATCCCATGGAGCAGAGG - Intronic
903746478 1:25590235-25590257 AGCAGTGTTCTTGTGTGCAGAGG - Intergenic
904998843 1:34652376-34652398 ATCACTGTCCCATTGTGGAGTGG - Intergenic
905259703 1:36708770-36708792 GTCATTGTCCCATTGTGCAATGG + Intergenic
907074005 1:51562840-51562862 ATCAGTGTCAAATTGTCCAGAGG - Intergenic
907434783 1:54438149-54438171 ATCAGTGTCTCATTTTACAGAGG - Intergenic
907575160 1:55519790-55519812 TGAAGTTTCCCATTGGGCAGAGG - Intergenic
908772999 1:67613082-67613104 GCCAGTGTTCCACTGTGCAGAGG - Intergenic
909115617 1:71531643-71531665 AACAGTTTCCCATTTTACAGGGG - Intronic
909493735 1:76254534-76254556 ACCATTTTCCCATTGTTCAGAGG - Intronic
911546511 1:99224152-99224174 AGCAGTGTCCCAGTAATCAGTGG + Intergenic
912145216 1:106785355-106785377 AGCAGTGTTCCATAAGGCAGTGG - Intergenic
912368113 1:109151417-109151439 CACTGTGTCCCATTGTGAAGAGG - Intronic
912511806 1:110194879-110194901 AGCTGTGTCCCAGTGTGGGGTGG - Intronic
915667284 1:157456601-157456623 ATCAGTGTCCCAAAGTGCTGTGG + Intergenic
916577712 1:166082033-166082055 AGCAGTGTCCCAGTGAGGAGAGG - Intronic
918931747 1:190863934-190863956 AGCTGTGTTCCATGGTGCAAGGG + Intergenic
920057158 1:203201157-203201179 AGTGGTGTCCCATTGCACAGAGG - Intergenic
923519566 1:234725344-234725366 AGGAGTGTCAGATTTTGCAGCGG - Intergenic
924665334 1:246065099-246065121 AACACTGTCCCATTGTTTAGAGG + Intronic
1064591771 10:16900127-16900149 AACAGTTTCCCATTGTTCAAGGG + Intronic
1065024735 10:21529366-21529388 AGCAGTGGCCCCTTTTGGAGAGG + Intergenic
1067856560 10:49798598-49798620 AGCAGTATTCCATTGTATAGAGG - Intergenic
1069512737 10:69054195-69054217 AGCAGTGTCCCCCTGAGCCGGGG + Intergenic
1070680881 10:78448242-78448264 AGCTCTGGCCCTTTGTGCAGAGG - Intergenic
1071440803 10:85691935-85691957 GACAGTCTCCCAGTGTGCAGTGG - Intronic
1071816832 10:89240808-89240830 TGCAGTGTGCCCTTGAGCAGGGG + Intronic
1073203214 10:101753096-101753118 GGCAGCGTCCCAGTGTGCTGGGG - Intergenic
1073905538 10:108275075-108275097 ACCAGTGTCCTATTCTGCTGTGG + Intergenic
1075114555 10:119614941-119614963 ATCAGTGTCCTGCTGTGCAGAGG - Intergenic
1075612321 10:123863854-123863876 AGCAGGGGCCCATTGTCCTGAGG - Intronic
1076191043 10:128483668-128483690 TGCAAAGTCCCACTGTGCAGAGG + Intergenic
1076342858 10:129761456-129761478 AGCAGTTTCTCACTCTGCAGTGG + Intronic
1077372734 11:2191122-2191144 AGCAGCCTCCCAGTGTGCAGGGG + Intergenic
1077699926 11:4431865-4431887 AGCAATGACCCATAGTGCAGAGG + Intergenic
1080009492 11:27443300-27443322 AGGAATTTCCCATCGTGCAGTGG - Intronic
1081249174 11:40808580-40808602 AGCTGTGCTCCGTTGTGCAGAGG - Intronic
1084580985 11:70023181-70023203 ACGAGTTTCCCACTGTGCAGCGG - Intergenic
1086206002 11:84258912-84258934 AGCACTGTCCCATTTTTAAGTGG - Intronic
1092123828 12:6062503-6062525 TGCAGAGTCCCAGTGTCCAGGGG + Intronic
1093443477 12:19227987-19228009 AGCGGGCTCCCATTGTCCAGAGG - Intronic
1096761224 12:53843657-53843679 AGGAGTGTCCCAGTGGGAAGAGG + Intergenic
1105874412 13:24540291-24540313 GTCAGCGTCCCATTCTGCAGAGG - Intergenic
1107152853 13:37131952-37131974 AGCAGAATCCCATGGTGCAAAGG + Intergenic
1111666598 13:91277237-91277259 AGCAGTCTCCCATTATTCACAGG + Intergenic
1113707066 13:112441862-112441884 AGCAGCGTCTCCTTGGGCAGAGG - Intergenic
1115338171 14:32263108-32263130 AGCAGTGTCTCCTTCTCCAGGGG - Intergenic
1116973921 14:51095187-51095209 AGCAGCGGCCCATTGGGCGGGGG + Exonic
1117513872 14:56480957-56480979 AGCATTGTCTCATGGTGAAGAGG + Intergenic
1119741652 14:77017672-77017694 TCCAGTGTTCCTTTGTGCAGAGG - Intergenic
1125222712 15:37357885-37357907 GGCAGTGTGACATTGTCCAGGGG + Intergenic
1126357593 15:47812717-47812739 AGAACTCTCCCATTCTGCAGAGG - Intergenic
1126394138 15:48194539-48194561 AACAGTGTCAAATTCTGCAGCGG - Intronic
1128383989 15:67134223-67134245 AGCAGATTCTCAATGTGCAGTGG - Intronic
1128412199 15:67410892-67410914 ACCAGTGTGCCATGATGCAGTGG - Intronic
1132497117 16:269141-269163 ACCAGTGTCCCCTTGTGCCCAGG - Exonic
1133177539 16:4026632-4026654 AGTAGTGCCCCATTGTGGGGAGG - Intronic
1134076724 16:11297173-11297195 AGCAGTGTCCCATTGTATGGAGG - Intronic
1135492516 16:22922208-22922230 AGCAGTGGCCCCTTGAGCTGGGG + Intergenic
1136470874 16:30479170-30479192 TGCAGGGTCCCATGCTGCAGGGG + Exonic
1137393563 16:48101145-48101167 AGCAGCCTGCCATTCTGCAGTGG + Intronic
1138505692 16:57477188-57477210 GGCAGGGTCCCAGGGTGCAGTGG + Intronic
1143754301 17:9055320-9055342 AGCATTGTCCAGTGGTGCAGTGG - Intronic
1145416386 17:22716883-22716905 AGCAGTGCCCCAGGGTGAAGGGG + Intergenic
1146296200 17:31652652-31652674 AGCTGTGTGACATTGGGCAGAGG - Intergenic
1150214561 17:63459495-63459517 AGCAGGGTCCCAATGGGCAGGGG + Intergenic
1150860257 17:68794223-68794245 TGCAATGTCCCATGGTGCTGTGG - Intergenic
1152192737 17:78898400-78898422 AGCAGAGTCTCCTTGTGCTGTGG - Intronic
1153471334 18:5449750-5449772 ATCAGTCTCCCATTGTCCATGGG + Intronic
1157040013 18:44027657-44027679 TGCAGTGTCCCACTGTGTGGGGG + Intergenic
1159253982 18:65921676-65921698 AGTAGTGACCCAGTGTCCAGGGG + Intergenic
1160263826 18:77320896-77320918 AGCAGTGTTCCATGGTGCATGGG - Intergenic
1164560152 19:29286090-29286112 AGGAGTGTCCCCTAGTGGAGTGG - Intergenic
1166453124 19:42918316-42918338 AGTGATGTCCCATTGTGCTGTGG + Intronic
1166471531 19:43083107-43083129 AGTGATGTCCCATTGTGCTGTGG + Intronic
1166650117 19:44567096-44567118 AGCAGCATTCCATTGTGTAGAGG - Intergenic
1167339381 19:48905874-48905896 AGCAGGATCCCAGTGAGCAGGGG + Exonic
926151010 2:10425515-10425537 AGCAGGGCCCTACTGTGCAGGGG + Intronic
926229526 2:10992172-10992194 AGCAGCTTCCCACAGTGCAGCGG + Intergenic
926400344 2:12490153-12490175 AGCCCTGCCTCATTGTGCAGTGG - Intergenic
927711879 2:25331232-25331254 AGCAGTGTGGCATCGTGCTGGGG - Intronic
935315422 2:101829029-101829051 AGCAGTTTGTCACTGTGCAGTGG + Intronic
936115678 2:109701117-109701139 AGATCTGTCCCCTTGTGCAGAGG + Intergenic
941007619 2:160263639-160263661 AGCACTGACCAATGGTGCAGAGG + Intronic
943212786 2:184989499-184989521 AGCAGTGTCCCAATGTGGTCAGG - Intergenic
943580861 2:189682363-189682385 AGCAGACACCCAATGTGCAGTGG - Intronic
943761127 2:191610517-191610539 AGCAGAGTCAGTTTGTGCAGTGG + Intergenic
1171519692 20:25766276-25766298 AGCAGTGCCCCAGGGTGAAGGGG + Intronic
1171557228 20:26090217-26090239 AGCAGTGCCCCAGGGTGAAGGGG - Intergenic
1173969407 20:47140150-47140172 AGGAGTGTGTGATTGTGCAGAGG + Intronic
1175817526 20:61891285-61891307 AGTCGTGTCCCATTTTACAGAGG + Intronic
1175864578 20:62168421-62168443 AACTGTGGCCCATGGTGCAGTGG + Intronic
1176653836 21:9572560-9572582 AGCAGTGCCCCAGGGTGAAGGGG + Intergenic
1176664883 21:9677103-9677125 AGCAGTGTGTCAGTGTGCTGAGG + Intergenic
1177720658 21:24902718-24902740 AGCAGTGTCCAAGTGAGGAGTGG + Intergenic
1180153410 21:45964846-45964868 AGCAGTGTCCCATGGTGTTGGGG - Intergenic
1182457875 22:30463437-30463459 AGCAGAGTCACATGGGGCAGAGG + Intronic
1183408097 22:37640181-37640203 TGAACTGTCCCATTGTCCAGAGG - Intronic
1184868271 22:47216212-47216234 AGCAGTGCCCATTTTTGCAGGGG + Intergenic
949216039 3:1568283-1568305 ATCTGTGTCCCATTGTGGTGGGG + Intergenic
949408204 3:3736561-3736583 CTCAGTGTCCCAAAGTGCAGAGG - Intronic
952156494 3:30649019-30649041 AGCAGTGAGCCTTTGTGCATGGG + Intronic
953436977 3:42885425-42885447 AGCAGTGTCACATTTTGTTGGGG + Intronic
954778481 3:53041755-53041777 AGGAGTCTCCCATTCTTCAGGGG - Intronic
956705209 3:71993688-71993710 AACAGTGCCCCTTTGTGCAGAGG + Intergenic
957686129 3:83504512-83504534 AGGAGAGTCCCATTATGTAGTGG - Intergenic
960022558 3:112971594-112971616 AACAGTGTCCCATTGAGTGGCGG - Intronic
960436198 3:117629572-117629594 AGCAGTGTCTGATCGTGGAGTGG + Intergenic
962137919 3:132756824-132756846 AGCCGTGGCCCAGAGTGCAGGGG - Intergenic
965309533 3:167112290-167112312 AGCAGTGGACCATTCTGAAGTGG + Intergenic
968017568 3:195351930-195351952 AGCAGTGTACAAGAGTGCAGGGG - Intronic
969282413 4:6179568-6179590 AGCAGGGTCACCTTTTGCAGAGG - Intronic
974645860 4:64691502-64691524 GACAGTTTCCCATTGTGTAGTGG + Intergenic
976282358 4:83337527-83337549 CTCTGTCTCCCATTGTGCAGCGG - Intergenic
980365407 4:131797827-131797849 AGCAGTGTGCCATAGTTTAGAGG - Intergenic
985676924 5:1236800-1236822 TGCAGTGTCTCAGTGTGCTGAGG + Intronic
986069662 5:4269648-4269670 AGCCATGTCCCGATGTGCAGAGG + Intergenic
986235247 5:5903652-5903674 AGCCATGTACCATTGAGCAGAGG - Intergenic
987671484 5:21015753-21015775 AGCAGTGGCACATTGTACATAGG + Intergenic
994235647 5:97358943-97358965 AGCAGTGCCCTATTCTGCTGTGG + Intergenic
997251676 5:132393451-132393473 AGCAGTGTTCCACCATGCAGGGG - Intronic
997761463 5:136452226-136452248 AGCATTGTCACATTGTCTAGGGG - Intergenic
998590963 5:143477693-143477715 AGCACTTTCACATTGTGCTGTGG + Intergenic
998847906 5:146328664-146328686 AGCATGGTCCCATTGTTCTGTGG - Intronic
998944345 5:147321553-147321575 AACAGTGTTCGAATGTGCAGGGG - Intronic
1004089245 6:12483273-12483295 AGCAAAATCCCATTTTGCAGAGG - Intergenic
1007179896 6:39922513-39922535 AGCATTGTCCCATAGAGCATGGG - Intronic
1007835078 6:44667933-44667955 AGCAGAGCCCCATTTTGCCGAGG + Intergenic
1007914364 6:45547100-45547122 ATCAGTTTCCCATGGTGCCGGGG + Exonic
1011595155 6:89008967-89008989 AGGTGTGTCTCATTTTGCAGAGG - Intergenic
1018683191 6:166281799-166281821 ACAGGTGTCCCAGTGTGCAGAGG - Intergenic
1019528180 7:1490368-1490390 AGGGGTGTCCCTTTATGCAGAGG - Intronic
1025028301 7:55535846-55535868 GGCACTGTCCCTCTGTGCAGAGG + Intronic
1025280179 7:57621226-57621248 AGCAGTGCCCCAGGGTGAAGGGG + Intergenic
1025304554 7:57844275-57844297 AGCAGTGCCCCAGGGTGAAGGGG - Intergenic
1035400597 7:158562818-158562840 AGCTGTGTCCCATTCTGTTGAGG - Intronic
1038592191 8:28849611-28849633 AGCAGTGCCTTCTTGTGCAGGGG - Intronic
1044628100 8:94254283-94254305 AGCAATGTACCAATGTGCTGGGG - Intronic
1044759765 8:95505823-95505845 ATCAGTGTTCCATTTTTCAGAGG - Intergenic
1046556164 8:115775973-115775995 AGCAGTCTCCGTTTGTGCAATGG + Intronic
1047671509 8:127152195-127152217 TGCAGTGTTCCATTCTGCAGAGG - Intergenic
1048501024 8:134975102-134975124 AACAGGGTCCCATGGTGCACAGG - Intergenic
1049368600 8:142252854-142252876 AGCAGTGTCCCATTGTGCAGAGG - Intronic
1053629759 9:39923689-39923711 AGCAGTGTGCCATAGTTTAGAGG - Intergenic
1053776005 9:41539858-41539880 AGCAGTGTGCCATAGTTTAGAGG + Intergenic
1054214128 9:62327013-62327035 AGCAGTGTGCCATAGTTTAGAGG + Intergenic
1054365726 9:64338635-64338657 AGCAGTGTGCCATAGTTTAGAGG - Intergenic
1054673355 9:67828344-67828366 AGCAGTGTGCCATAGTTTAGAGG - Intergenic
1057587958 9:96346489-96346511 ATCAATTTCCCATTGTGAAGAGG - Intronic
1058903765 9:109464195-109464217 AGCAGTTTTCCATCGTACAGTGG - Intronic
1059464836 9:114461606-114461628 AGAAGTGTTCCAGTGTGCAGAGG - Intronic
1060554158 9:124499853-124499875 AGCAGTGGCTCCTTGAGCAGAGG + Intronic
1060937165 9:127522357-127522379 CGCAGTGCCACATGGTGCAGAGG - Intronic
1061072784 9:128322011-128322033 AGCAGAAGCCCATGGTGCAGAGG + Intronic
1061785775 9:133027337-133027359 AGGAGTGTCCCTTAGTGCACAGG - Intergenic
1062733529 9:138121921-138121943 AGCTGAGTCCCAGGGTGCAGTGG - Exonic
1203631557 Un_KI270750v1:76012-76034 AGCAGTGCCCCAGGGTGAAGGGG + Intergenic
1203661218 Un_KI270753v1:44646-44668 AGCAGTGTGTCAGTGTGCTGAGG - Intergenic
1188583053 X:31738716-31738738 AGTAGTATTCCATTGTGCATAGG - Intronic
1188817539 X:34733530-34733552 AGTAGTATTCCATTGTCCAGAGG + Intergenic
1189241621 X:39529050-39529072 AGTAGCTTTCCATTGTGCAGGGG + Intergenic
1189692235 X:43629237-43629259 AACACTGTCCTACTGTGCAGTGG + Intergenic
1190180747 X:48190183-48190205 AGCTGTTTCCCATTGTTCTGTGG + Exonic
1192596590 X:72414728-72414750 AGGTGTGTCCACTTGTGCAGTGG + Intronic
1193832294 X:86304269-86304291 AGCAGGGTCCCATTTTTCACTGG - Intronic
1193957967 X:87886108-87886130 ATCAGTGCCCCATTCTGCTGCGG + Intergenic
1194396738 X:93395564-93395586 AGCAGTGCCCTATTCTGCTGTGG + Intergenic
1198449894 X:136756567-136756589 TGCCGTGTCCCATTGTGCTCTGG - Intronic
1199089719 X:143677562-143677584 CACAGTGTCCCATTGTGCTCTGG + Intergenic