ID: 1049368606

View in Genome Browser
Species Human (GRCh38)
Location 8:142252881-142252903
Sequence GGCCACTGCCCTAGTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049368590_1049368606 26 Left 1049368590 8:142252832-142252854 CCTCCCCACCCCTCAGCCATTTC 0: 1
1: 0
2: 5
3: 79
4: 770
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368592_1049368606 22 Left 1049368592 8:142252836-142252858 CCCACCCCTCAGCCATTTCCTCT 0: 1
1: 1
2: 5
3: 61
4: 568
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368595_1049368606 17 Left 1049368595 8:142252841-142252863 CCCTCAGCCATTTCCTCTGCACA 0: 1
1: 0
2: 3
3: 31
4: 346
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368599_1049368606 10 Left 1049368599 8:142252848-142252870 CCATTTCCTCTGCACAATGGGAC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368596_1049368606 16 Left 1049368596 8:142252842-142252864 CCTCAGCCATTTCCTCTGCACAA 0: 1
1: 1
2: 3
3: 38
4: 389
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368588_1049368606 28 Left 1049368588 8:142252830-142252852 CCCCTCCCCACCCCTCAGCCATT 0: 1
1: 1
2: 9
3: 119
4: 1167
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368589_1049368606 27 Left 1049368589 8:142252831-142252853 CCCTCCCCACCCCTCAGCCATTT 0: 1
1: 2
2: 9
3: 93
4: 835
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368591_1049368606 23 Left 1049368591 8:142252835-142252857 CCCCACCCCTCAGCCATTTCCTC 0: 1
1: 1
2: 6
3: 104
4: 651
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368600_1049368606 4 Left 1049368600 8:142252854-142252876 CCTCTGCACAATGGGACACTGCT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368594_1049368606 18 Left 1049368594 8:142252840-142252862 CCCCTCAGCCATTTCCTCTGCAC 0: 1
1: 1
2: 2
3: 47
4: 373
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data
1049368593_1049368606 21 Left 1049368593 8:142252837-142252859 CCACCCCTCAGCCATTTCCTCTG 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049368606 Original CRISPR GGCCACTGCCCTAGTGGGGC AGG Intronic
No off target data available for this crispr