ID: 1049373225

View in Genome Browser
Species Human (GRCh38)
Location 8:142277499-142277521
Sequence CATGGCCGGCTCGGGGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049373214_1049373225 12 Left 1049373214 8:142277464-142277486 CCAAACCCCAGGCAGTGCCGCTG 0: 1
1: 1
2: 36
3: 108
4: 446
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373209_1049373225 23 Left 1049373209 8:142277453-142277475 CCTGGCCCTGCCCAAACCCCAGG 0: 1
1: 0
2: 5
3: 129
4: 936
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373219_1049373225 -5 Left 1049373219 8:142277481-142277503 CCGCTGCAGAGCGGAAAGCATGG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373211_1049373225 18 Left 1049373211 8:142277458-142277480 CCCTGCCCAAACCCCAGGCAGTG 0: 1
1: 4
2: 27
3: 149
4: 579
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373217_1049373225 5 Left 1049373217 8:142277471-142277493 CCAGGCAGTGCCGCTGCAGAGCG 0: 1
1: 0
2: 2
3: 14
4: 212
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373216_1049373225 6 Left 1049373216 8:142277470-142277492 CCCAGGCAGTGCCGCTGCAGAGC 0: 1
1: 0
2: 3
3: 35
4: 432
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373212_1049373225 17 Left 1049373212 8:142277459-142277481 CCTGCCCAAACCCCAGGCAGTGC 0: 1
1: 4
2: 30
3: 126
4: 594
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373215_1049373225 7 Left 1049373215 8:142277469-142277491 CCCCAGGCAGTGCCGCTGCAGAG 0: 1
1: 0
2: 1
3: 19
4: 255
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data
1049373213_1049373225 13 Left 1049373213 8:142277463-142277485 CCCAAACCCCAGGCAGTGCCGCT 0: 1
1: 4
2: 30
3: 121
4: 384
Right 1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049373225 Original CRISPR CATGGCCGGCTCGGGGCAAC TGG Intronic
No off target data available for this crispr