ID: 1049374939

View in Genome Browser
Species Human (GRCh38)
Location 8:142284928-142284950
Sequence CCTTCTGTGCAGGAGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049374939_1049374946 16 Left 1049374939 8:142284928-142284950 CCTGGGTGCTCCTGCACAGAAGG 0: 1
1: 0
2: 4
3: 18
4: 291
Right 1049374946 8:142284967-142284989 CTGTGTAACAGCACTGAGCATGG No data
1049374939_1049374948 29 Left 1049374939 8:142284928-142284950 CCTGGGTGCTCCTGCACAGAAGG 0: 1
1: 0
2: 4
3: 18
4: 291
Right 1049374948 8:142284980-142285002 CTGAGCATGGGCCAGCACACAGG No data
1049374939_1049374947 17 Left 1049374939 8:142284928-142284950 CCTGGGTGCTCCTGCACAGAAGG 0: 1
1: 0
2: 4
3: 18
4: 291
Right 1049374947 8:142284968-142284990 TGTGTAACAGCACTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049374939 Original CRISPR CCTTCTGTGCAGGAGCACCC AGG (reversed) Intronic
900593731 1:3471182-3471204 CCCTATATGCAGGAGGACCCCGG + Intronic
901059015 1:6463117-6463139 CGTCCCTTGCAGGAGCACCCTGG - Exonic
901126099 1:6929894-6929916 CCTTCGGTCCATGAGCACCTAGG + Intronic
901171786 1:7264107-7264129 CGTCCTTTGCAGGAGCATCCAGG - Intronic
902697422 1:18149692-18149714 CCTTCGGGGCAGGATCAGCCTGG + Intronic
903853194 1:26320569-26320591 CCAGCTGTGCAGCAGCACCAGGG + Intergenic
905429313 1:37909993-37910015 CCATCTGTGCAGGACCCCACTGG + Intronic
905442403 1:38003969-38003991 CCCACTGTCCAGGAGGACCCTGG + Intronic
906080945 1:43087850-43087872 CCATCTGTGCAGGACCCCACTGG + Intergenic
906744498 1:48212358-48212380 CCATCTGTGCAGGACCCCACTGG - Intergenic
910433021 1:87177444-87177466 CCACCTGAGCAGGAGCACTCTGG + Intergenic
911861878 1:102961901-102961923 CTTTCAGTCCAGGTGCACCCTGG + Exonic
916141727 1:161705693-161705715 GCTTCTGTGCAGGTGGCCCCAGG - Intergenic
917977833 1:180251445-180251467 CATTCTGTGCTGGGTCACCCGGG - Intronic
919476422 1:198037135-198037157 CCATCTGTGCAGGACCCCACTGG + Intergenic
922565064 1:226596485-226596507 CCTTCTGGGAAGGAGCAATCAGG - Intronic
922701310 1:227762728-227762750 CCTTGCGTTGAGGAGCACCCAGG + Intronic
924180679 1:241436313-241436335 CCATCTGTGCAGGACCCCACTGG + Intergenic
1062916565 10:1244776-1244798 CCACCTGTGCAGAAGCTCCCTGG - Intronic
1064269098 10:13849184-13849206 CCTTCTGTCCGGGACCTCCCAGG - Intronic
1066103373 10:32137025-32137047 CCATCTGTGCAGGACCCCACTGG - Intergenic
1066437187 10:35405849-35405871 CCATCTGTGCAGGACCCCACTGG - Intronic
1066655878 10:37699645-37699667 GCTTCTCTGCAGGTTCACCCAGG - Intergenic
1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG + Intergenic
1071187259 10:83059490-83059512 CCATCTGTGCAGGACCCCACTGG + Intergenic
1071334367 10:84589209-84589231 CCATCTGTGCAGGGCCTCCCAGG - Intergenic
1071961134 10:90809767-90809789 CCATCTGTGCAGGACCCCACTGG + Intronic
1072305216 10:94100683-94100705 TCTTATCTGCAGGAGGACCCGGG - Intronic
1072431981 10:95380468-95380490 CTTTCTTTGCAGGAGCACCTGGG + Intronic
1072546785 10:96446209-96446231 CCTTCTCTGCATCAGCACCAAGG + Intronic
1073683546 10:105729720-105729742 CCATCTGTGCAGGACCCCACTGG + Intergenic
1073774332 10:106769164-106769186 CCTTCTGTGAAGGCTCACTCAGG + Intronic
1073933229 10:108600144-108600166 CCGTCTGTGCAGGACCCCACTGG + Intergenic
1074019052 10:109564707-109564729 CCATCTGTGCAGGACCCCACTGG + Intergenic
1075587491 10:123668114-123668136 CCTTCCGTGTGGGAGAACCCTGG + Intronic
1075940680 10:126388155-126388177 CCTTCAGTGCAGCAGCTCTCGGG + Exonic
1076586193 10:131549273-131549295 CCTTCTGTGCAGCAGGTCCTGGG - Intergenic
1077318518 11:1929698-1929720 CCTTCAGTGAAGGGGAACCCAGG + Intronic
1077431248 11:2517032-2517054 CCTCCTTTCCAGGAGCAGCCTGG - Intronic
1079128608 11:17735224-17735246 CCCCCTGGGCAGGGGCACCCGGG - Exonic
1079727049 11:23890552-23890574 CCATCTGTGCAGGACCCCACTGG - Intergenic
1080682221 11:34487460-34487482 TCCTCTGGGCAGGAGCATCCTGG + Intronic
1081649885 11:44816815-44816837 CCTCCTGAGCAGGAGGAGCCTGG + Intronic
1081775709 11:45674790-45674812 CCTGCGGTGAAGGAGCTCCCAGG + Intergenic
1083254375 11:61487134-61487156 CCTCTTGTGCAGGAGCCCACAGG + Exonic
1083882893 11:65557318-65557340 AGTTCTGAGCAGGAGCACACAGG - Intronic
1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG + Intronic
1084316070 11:68346642-68346664 CCATCTGCGCAGGAGGACCCAGG + Intronic
1084689758 11:70718290-70718312 CTTTCTGTGAAGGGGCAGCCGGG + Intronic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1085570219 11:77552274-77552296 CCATCTGTGCAGGACCCCACTGG + Intronic
1086550240 11:88045533-88045555 CCATCTGTGCAGGACCCCACTGG + Intergenic
1087049001 11:93867684-93867706 CCTTCTGTGGAGGACCCCACTGG - Intergenic
1087127841 11:94643958-94643980 CCATCTGTGCAGGACCCCACTGG + Intergenic
1087153759 11:94881661-94881683 CCTTCAGGGCAGGATCACCATGG - Intergenic
1089124822 11:116169443-116169465 ACCTCTGTGAGGGAGCACCCTGG + Intergenic
1089987709 11:122829464-122829486 CCATCTGTGCAGGACCCCACTGG + Intergenic
1090107572 11:123868968-123868990 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090251310 11:125253814-125253836 CCTTCATCGCAGGAGCAGCCAGG + Intronic
1090526783 11:127546102-127546124 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090546463 11:127772446-127772468 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090871933 11:130756880-130756902 CCATCTGTGCAGGACCCCACTGG - Intergenic
1091457308 12:617619-617641 CCTTCTGTGTAGGAAAGCCCTGG - Intronic
1091654032 12:2331725-2331747 CATTTTGGGCAGGAGCACCACGG - Intronic
1097362340 12:58671643-58671665 CCTTCTGTGCAGGCACAATCAGG + Intronic
1098919929 12:76293801-76293823 CCATCTGTGCAGGACCCCACTGG + Intergenic
1099115918 12:78623913-78623935 CCTGCTCTGCAGGAGCAGTCAGG - Intergenic
1100378676 12:94041865-94041887 CCTTCTGTGCCTGATCATCCAGG - Intergenic
1102967835 12:117141666-117141688 CCTGCGGTGGAGGAGCACACTGG + Intergenic
1103520675 12:121535761-121535783 CCTTCCTTGCAGAAACACCCAGG + Intronic
1103865071 12:124045181-124045203 GCTTCTGAGCAGGGGCAGCCCGG + Intronic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1104800864 12:131554532-131554554 CCTGATGGGCAGGAGCTCCCTGG + Intergenic
1104821049 12:131677831-131677853 CCTTCTGAGCAGGTGCAAGCCGG - Intergenic
1104965935 12:132508877-132508899 CCTCCTGGGCAGGAGGCCCCTGG - Intronic
1105068321 12:133218584-133218606 CCTTCTCTGCACGAGTGCCCCGG + Exonic
1105622862 13:22086180-22086202 CCTTCTGTGGAGGAGAGCCTGGG + Intergenic
1109499316 13:63215465-63215487 CCATCTGTGCAGGACCCCACTGG + Intergenic
1113091712 13:106623933-106623955 CCTTCTGTCTGGGAACACCCCGG + Intergenic
1113484592 13:110645074-110645096 GCTCCCGTGCAGGAGCAGCCTGG + Intronic
1113949874 13:114065999-114066021 CCATCTGTTCAGGGGCACCGAGG + Intronic
1116703265 14:48265744-48265766 CCATCTGTGCAGGACCCCACTGG - Intergenic
1118253474 14:64184206-64184228 CTTGCTGTGCAGCAGCACCATGG + Intronic
1120021898 14:79540495-79540517 CCTGCTGTGCAGTAGAACACCGG + Intronic
1121193274 14:92048079-92048101 CCATCTGTGCAGGACCCCACTGG - Exonic
1122507659 14:102241970-102241992 CCATCTGTGCAGGACCCCACTGG + Intronic
1122549679 14:102543310-102543332 ACTCCTCTGCAGGAGCAGCCTGG + Intergenic
1124079331 15:26476729-26476751 CCCTCTGGGAAGGAGCACTCTGG + Intergenic
1125629246 15:41133850-41133872 CCATCTGTGCAGGACCCCACTGG + Intergenic
1126912380 15:53430202-53430224 CCATCTGTGCGGGACCACACTGG - Intergenic
1129259459 15:74356271-74356293 CCATCTGTGCAGGACCCCACTGG + Intronic
1129393207 15:75230912-75230934 CCCCCTGTTCAGGAGCACCTGGG - Intergenic
1132270387 15:100519223-100519245 CATTTTGTGGAGGAGAACCCTGG + Intronic
1132655941 16:1041679-1041701 CCTTCCCTGCTGGAGCTCCCAGG - Intergenic
1133065279 16:3201983-3202005 CCTCCTCTGCAGGAGCAGTCAGG + Intergenic
1134570337 16:15285126-15285148 ACCTCTGTGCAGGACCACCGAGG - Intergenic
1134732039 16:16470927-16470949 ACCTCTGTGCAGGACCACCGAGG + Intergenic
1134935402 16:18241036-18241058 ACCTCTGTGCAGGACCACCGAGG - Intergenic
1136641315 16:31568135-31568157 TCTTCTGTGCAGGAATTCCCAGG + Intergenic
1139217753 16:65145708-65145730 ACTTCTGAGCAGAAGCAGCCTGG - Intergenic
1139832690 16:69812717-69812739 CATTCTTGGCAGGAACACCCAGG + Intronic
1141418796 16:83898741-83898763 CCTCCGGTGCAGGAGTTCCCAGG + Intergenic
1141601069 16:85126774-85126796 TTTTCTGAGCAGGACCACCCAGG - Intergenic
1142205605 16:88781552-88781574 CCTTCTGAGCATCAGCTCCCTGG - Intronic
1142379323 16:89722519-89722541 CGCTCTGTGCAGGAGCAGGCCGG + Exonic
1144485363 17:15659978-15660000 CTTGCTGGGCAGGAGCACACAGG + Intronic
1144788809 17:17846332-17846354 CCTTCTGAGCAACAGCAGCCTGG + Intronic
1144961206 17:19045145-19045167 CCATCTCTGCACGAGCAGCCTGG - Intronic
1144973955 17:19129379-19129401 CCATCTCTGCACGAGCAGCCTGG + Intronic
1146255199 17:31388338-31388360 ACTTCTCTGCAGGAGCACATGGG + Intergenic
1146696597 17:34913310-34913332 CCTTCTCAGCATGAGAACCCTGG + Intergenic
1148463240 17:47850082-47850104 CCTTCTGTGCTGCCCCACCCCGG - Intronic
1148841706 17:50502918-50502940 CCTCCCATGCAGCAGCACCCAGG - Intergenic
1149082543 17:52676594-52676616 CATTCTGTGGAATAGCACCCTGG - Intergenic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1152450589 17:80376812-80376834 CCTGCTGAGCAGCAGCACCCAGG + Intronic
1152889603 17:82873015-82873037 CCGTCTGGGCAGCAGCTCCCAGG + Intronic
1155173843 18:23286383-23286405 CCATCTGTGCAGGACCCCACTGG + Intronic
1156241361 18:35257701-35257723 CCTTCTGTGGAGAATTACCCAGG + Intronic
1156376506 18:36519586-36519608 CACTGTGTGCAGGAGCACCATGG + Intronic
1157201888 18:45666687-45666709 CGTTCTGTGGAGGAGGACTCTGG - Intronic
1157847545 18:51017732-51017754 CCCTCTGTGCTGTACCACCCAGG - Intronic
1158394620 18:57069993-57070015 CCATCTGTGCAGGACCCCACTGG - Intergenic
1159929238 18:74294775-74294797 CCATCTGTGCAGGACCCCACTGG + Intergenic
1160078655 18:75702738-75702760 CTTTCTGTCCTGGAGCAGCCCGG - Intergenic
1160533375 18:79578081-79578103 CCTGGTGTCCATGAGCACCCAGG - Intergenic
1161712065 19:5854453-5854475 CCATCTGTGCAGGACCCCACTGG + Intergenic
1162320660 19:9969366-9969388 CCATCTGTCCAGGGGCTCCCAGG + Exonic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1164258788 19:23551607-23551629 CCATCTGTGCAGGACCCCACTGG + Intronic
1164648615 19:29876225-29876247 CCTTCTGGGCAGGTGGACCTGGG - Intergenic
1164683358 19:30150579-30150601 CCTGCTATGCAGGAGGACACGGG + Intergenic
1165039027 19:33055773-33055795 CCTTCTCTGCCGGAGCCTCCAGG + Intronic
1165255222 19:34573592-34573614 CCATGTGTGCATGTGCACCCAGG + Intergenic
1165267113 19:34669505-34669527 CCATGTGTGCATGTGCACCCAGG - Intronic
1165496983 19:36158784-36158806 CCATCTGTGCAGGACCCCACTGG - Intergenic
1165510296 19:36262850-36262872 CCATCTGTGCAGGAACCCACTGG - Intergenic
1165835383 19:38751954-38751976 CCATCTGTGCAGGACCCCACTGG + Intronic
1168248164 19:55124884-55124906 CCATCTGTGCAGGACCCCACTGG + Intergenic
925433832 2:3819270-3819292 CCATCTGTGCAGGACCCCACTGG - Intronic
925615891 2:5744221-5744243 CTTTGTGGGCAGGAGCACCTCGG + Intergenic
925880485 2:8348424-8348446 CTTTCTGTCCAGGAGAACCTGGG - Intergenic
927849350 2:26489256-26489278 CCTGCTGCGCAGTGGCACCCTGG - Exonic
928385016 2:30859703-30859725 CCTCCTGTGCATGCTCACCCTGG - Intergenic
930050424 2:47211483-47211505 ACTGCTGTGCTGGAGCTCCCTGG + Intergenic
930099059 2:47589034-47589056 CCATCTGTGCAGGACCCCACTGG - Intergenic
931698402 2:64889357-64889379 CCTTCTGGGCTGAAGTACCCTGG + Intergenic
931850447 2:66246275-66246297 CCATCTGTGCAGGACCCCACTGG + Intergenic
931946476 2:67314086-67314108 AATTCTGTGCTTGAGCACCCCGG - Intergenic
931948281 2:67333941-67333963 CCATCTGTGCAGGACCCCACTGG + Intergenic
932580982 2:72992595-72992617 CGTTCTGGGCAGGAGCCTCCTGG + Intronic
932736402 2:74257494-74257516 CGGGCTGGGCAGGAGCACCCTGG + Intronic
933615468 2:84478641-84478663 CCCTGTGTGCAAGAGTACCCCGG + Intergenic
934141286 2:89050263-89050285 CCATCTGTGCAGGACCCCACTGG + Intergenic
934637830 2:96007132-96007154 CCCTCTGTCCAGGAGCACCCAGG - Intergenic
934795832 2:97098279-97098301 CCCTCTGTCCAGGAGCACCCAGG + Intergenic
936870819 2:117132663-117132685 CCTTCTGTGGAGGACCCCACTGG + Intergenic
937368375 2:121281309-121281331 GGCTCTGTGCAGGAGCCCCCTGG - Intronic
941935868 2:170981005-170981027 CCATCTGTGCAGGACCCCACTGG - Intergenic
943637203 2:190319504-190319526 TCTTCTTTGCAGCAGCACTCTGG - Intronic
944251058 2:197580457-197580479 CCATCTGTGCAGGACCCCACTGG + Intronic
945443964 2:209913893-209913915 CATGCTGAGCAGGAGCTCCCAGG - Exonic
945694781 2:213089002-213089024 ACTACTCTGCAGGAGCATCCTGG + Intronic
945887447 2:215390675-215390697 GCTTCTGTTCTAGAGCACCCTGG - Intronic
947713217 2:232327392-232327414 CCTCCTGGGCAGGAGCATCCAGG - Intronic
947720292 2:232365860-232365882 CCTCCTGGGCAGGAGCATCCAGG - Intergenic
947732918 2:232440840-232440862 CCTCCTGGGCAGGAGCACCTGGG - Intergenic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
948413423 2:237782622-237782644 CCTTGTGTCCAGGAGCCTCCAGG + Intronic
1170778686 20:19403969-19403991 ACTTCCGTGCAGAAGCACACAGG - Intronic
1171193275 20:23176986-23177008 TCTCCTGTGCATGTGCACCCCGG + Intergenic
1172911083 20:38409345-38409367 CGTTTTGGGCAGGAGCACCACGG - Intergenic
1173800453 20:45891505-45891527 GCTTCCGTGCAGCAGCCCCCGGG - Intronic
1174249415 20:49207330-49207352 CCTTCTGTCCTGGAGGAGCCAGG + Intergenic
1177571354 21:22890860-22890882 CCCTCTGTGCAGAATCACCTGGG + Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1179503624 21:41825230-41825252 AGTTCTGTGCAGAAGCACCTTGG - Intronic
1179775533 21:43659556-43659578 CCTTCTGTGCAGTCGCGGCCCGG + Exonic
1179880228 21:44290544-44290566 CCTGCCCTGCAGGAGCACCCGGG + Intronic
1180226674 21:46397613-46397635 CCTGCTGCACAGGTGCACCCAGG + Intronic
1182037150 22:27207944-27207966 CCTGTTGTGCAGGAGAGCCCGGG - Intergenic
1182338905 22:29603737-29603759 CCTTCGGTGCAGGCGCGACCCGG - Exonic
1183684421 22:39353299-39353321 GCTTCTGTGCAGGCTGACCCAGG - Intronic
1183868651 22:40723889-40723911 CCTGGCGTGCAGGAGCACCTGGG + Intergenic
1184727740 22:46356404-46356426 CCGAGTGTGCAGGAGCTCCCAGG + Intronic
949158099 3:851013-851035 CCTTCTGGGCTGAAGTACCCTGG - Intergenic
949162071 3:894035-894057 CCATCTGTGCAGGAACCCACTGG - Intergenic
949283687 3:2376437-2376459 CCTTTTGGGCAGGAGCAGTCAGG + Intronic
950111603 3:10422205-10422227 CCATGTGTGCAGGAGCATCTGGG - Intronic
950335173 3:12187568-12187590 GCTTCTGTGGTGGAGCAGCCAGG - Exonic
950556834 3:13701129-13701151 CCCTGTAGGCAGGAGCACCCAGG - Intergenic
951888956 3:27551495-27551517 CCATCTGTGCAGGACCCCACTGG - Intergenic
952343537 3:32464776-32464798 CCATCTGTGCAGGACCCCACTGG - Intronic
953177215 3:40563323-40563345 CCATCTGTGCAGGACCCCACTGG + Intronic
953181295 3:40597491-40597513 CTTTCTCTGCAGGATCACCATGG - Intergenic
953606797 3:44417732-44417754 CCTCCTGTCCAGGGGCATCCAGG - Intergenic
953770925 3:45778129-45778151 CCTTCTCAGCAGGAGCACCTGGG - Intronic
954626284 3:52023718-52023740 CCTGCTGGCCAGGGGCACCCTGG + Intergenic
955429354 3:58826722-58826744 CCTTCTGTGTTGGAGCACAAAGG - Intronic
956233477 3:67042047-67042069 CCATCTGTGCAGGACCCCACTGG - Intergenic
956548968 3:70438229-70438251 CCATCTGTGCAGGACCCCACTGG - Intergenic
962022166 3:131512474-131512496 CCATCTGTGCAGGACCCCACTGG - Intergenic
962144785 3:132829500-132829522 CACTCTGTGCACGCGCACCCTGG + Intergenic
965336351 3:167433558-167433580 CCATCTGTGCAGGACCCCACTGG + Intergenic
965861947 3:173159275-173159297 CCATCTGTGCAGGACCCCACTGG - Intergenic
967643809 3:191898736-191898758 CCATCTGTGCAGGACCCCACTGG - Intergenic
967980434 3:195062082-195062104 GCTTCTGTGCAAGGCCACCCTGG + Intergenic
968193941 3:196691456-196691478 CCTTCTGTGGAGCAGCATCCTGG - Intronic
968829856 4:2927559-2927581 CCATCTGTGAAGGAGCACAGCGG - Intronic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969607529 4:8210038-8210060 CCGTTTGTGCAGGTGCACACAGG - Intronic
970087566 4:12366105-12366127 CCATCTGTGCAGGACCCCACTGG + Intergenic
970180241 4:13384178-13384200 CCCTCTGTGCATGATCACTCAGG - Intronic
971144679 4:23963786-23963808 CCAGCTTTCCAGGAGCACCCAGG - Intergenic
972263087 4:37430841-37430863 TTTTCTGTGCAGCACCACCCCGG - Intronic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
972413027 4:38811695-38811717 CCTGCTCTGCAGGAGCAGTCAGG + Intronic
976712148 4:88084158-88084180 CCTTGTGTGCAGGTGTAGCCTGG - Intergenic
979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG + Exonic
979895139 4:126148507-126148529 CCATCTGTGCAGGACCCCACTGG - Intergenic
980284970 4:130769700-130769722 CCATCTGTGCAGGACCCCACTGG + Intergenic
980903959 4:138930211-138930233 CCATCTGTGCAGGACCCCACTGG + Intergenic
983659593 4:170118794-170118816 CCATCTGTGCAGGACCCCACTGG + Intergenic
983707695 4:170679832-170679854 CCATCTGTGCAGGACCCCACTGG + Intergenic
984162359 4:176269173-176269195 CCAGCTGTTCAGGAGCATCCCGG - Exonic
986555020 5:9001916-9001938 CCATCTGTGCAGGACCCCACTGG - Intergenic
993328154 5:86567143-86567165 CCTTCTGAGCTGAAGTACCCTGG + Intergenic
993836726 5:92826315-92826337 CCATCTGTGCAGGACCCCACTGG + Intergenic
994324897 5:98436906-98436928 CCATCTGTGCAGGACCCCACTGG + Intergenic
994970579 5:106731386-106731408 CCAGCTGTCCAGGAGCACCTTGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997286104 5:132679797-132679819 ACTGCTGTGCAGTCGCACCCAGG - Exonic
999200380 5:149812113-149812135 CTTTCTGTGCGGAAGCATCCGGG - Intronic
1000606954 5:163336364-163336386 CCATCTGTGCAGGACCCCACTGG + Intergenic
1001453892 5:171846383-171846405 CCATTTGTGCAGGAGTGCCCGGG - Intergenic
1002304227 5:178273919-178273941 CCCTCTGGGCCGGAGGACCCTGG + Intronic
1002925745 6:1604907-1604929 CCTTCTGGGCAGGAGCCCCGGGG - Intergenic
1003071504 6:2948730-2948752 CCTGCTGGGCAGCAGCACCCTGG - Intronic
1004548687 6:16625472-16625494 GCTTCTGAGCAGGAACACCATGG - Intronic
1004837025 6:19541244-19541266 CCATCTGTGCAGGACCCCACTGG + Intergenic
1005755208 6:28920006-28920028 CCTTACCTGCAGGAGCTCCCTGG + Exonic
1006295916 6:33170046-33170068 CCTTCTCTCCAGGGGGACCCAGG + Exonic
1006626232 6:35400048-35400070 CGGTCTGTCCAGGAGAACCCAGG - Intronic
1010370514 6:75101643-75101665 CCTTCTGTGCAGGGAACCCCAGG - Exonic
1012611711 6:101227275-101227297 CCTTCTGGGCTGAAGTACCCTGG + Intergenic
1014396086 6:120927529-120927551 CCATCTGTGCAGGACCCCACTGG + Intergenic
1014612107 6:123558981-123559003 CCATCTGTGCAGGACCCCACTGG + Intronic
1015165239 6:130194683-130194705 CCATCTGTGCAGGACCCCACTGG + Intronic
1016204558 6:141455169-141455191 CCATCTGTGCAGGACCCCACTGG + Intergenic
1018077618 6:160230833-160230855 CCATCTGTGCAGGACCCCACTGG + Intronic
1018521448 6:164655522-164655544 CCATCTGTGCAGGAACCCACTGG - Intergenic
1019155263 6:170034278-170034300 CCTTCTCTCCAGGAGCCCTCGGG - Intergenic
1019592632 7:1843341-1843363 ACGTCTGCGCAGGAGCTCCCCGG - Intronic
1019634060 7:2066227-2066249 CCTTCTCTCAAGGCGCACCCAGG - Intronic
1021660646 7:22915458-22915480 CCATCTGTGCAGGACCCCACTGG + Intergenic
1022447424 7:30481571-30481593 CCATCTGTGCAGGACCCCACTGG + Intergenic
1023347715 7:39288492-39288514 CCTTCTGTTCACGAACACCTTGG + Intronic
1024084641 7:45883208-45883230 CCTTCTGTCCAGCACCACACAGG - Intergenic
1025035769 7:55591716-55591738 CCTTCTCTCCAGGGGGACCCAGG - Intergenic
1029274506 7:99396246-99396268 CCCTCTCTGAATGAGCACCCAGG + Exonic
1029460808 7:100693336-100693358 CCCTCCGTGCAGCAGCTCCCTGG - Intergenic
1029852601 7:103479901-103479923 GCTTCTGTGCATGTGCACCAAGG - Intronic
1030163588 7:106531772-106531794 CCATCTGTGCAGGACCCCACTGG - Intergenic
1030445760 7:109645489-109645511 CCATCTGTGCAGGACCCCACTGG - Intergenic
1031063354 7:117076630-117076652 CCTTGTGGGAGGGAGCACCCAGG + Intronic
1033625608 7:143107161-143107183 CCATCTGTGCAGGACCCCACTGG + Intergenic
1035250426 7:157593610-157593632 CCTGCTGTGCACGCTCACCCCGG - Intronic
1035397340 7:158543889-158543911 CCTTGTGGGCAGGGGCAGCCTGG - Intronic
1035702422 8:1646828-1646850 CCTTCTGGAAAGGAGAACCCAGG + Intronic
1035951054 8:4021545-4021567 CCTTCTGAGCAGGTGCACCTGGG + Intronic
1036285475 8:7441332-7441354 CCCTCTCTCCAGGAGCACACAGG - Intergenic
1036335999 8:7870197-7870219 CCCTCTCTCCAGGAGCACACAGG + Intergenic
1036756050 8:11471783-11471805 CCATCTGAGCAGGAGATCCCTGG - Intronic
1037298390 8:17425553-17425575 CATTGTTTGCAGGAGGACCCAGG - Intergenic
1037322137 8:17654205-17654227 ACTGCTGTGCAGGAGCACTTGGG + Intronic
1039733490 8:40305300-40305322 GCTCCTGTTCAGCAGCACCCAGG + Intergenic
1040829931 8:51664990-51665012 CCTCCTGTGCGGGTGCTCCCAGG - Intronic
1040860137 8:51990531-51990553 CCTTCTGGGGGAGAGCACCCAGG + Intergenic
1041030919 8:53734439-53734461 CCTTCTGGGCTGAAGTACCCTGG - Intronic
1043721529 8:83550701-83550723 CCTCTTCTGCAGGAGTACCCTGG - Intergenic
1044058884 8:87607976-87607998 TCTTCTGTTCAGGAGGCCCCAGG + Intronic
1044258594 8:90093575-90093597 CCATCTGTGCGGGACCACACTGG - Intronic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1047805939 8:128359988-128360010 CCCTCTGTGCCATAGCACCCCGG - Intergenic
1048717296 8:137283786-137283808 CCTTCTGTGGAGGACCCCACTGG + Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049375808 8:142288534-142288556 CCTTCTGCCCAGGAGGACCCGGG - Intronic
1049551037 8:143259938-143259960 CCTTCTGTGCAGCAGGCTCCTGG + Intronic
1054807466 9:69408123-69408145 CCATCTGTGCAGGACCCCACTGG - Intergenic
1055881768 9:81011347-81011369 CCATCTGTGCAGGACCCCACTGG + Intergenic
1056922206 9:90801336-90801358 GCTACTGTGCTGGAGCACTCGGG - Intergenic
1057378012 9:94542167-94542189 CCATCTGTGCAGGACCCCACTGG + Intergenic
1057422901 9:94926665-94926687 CCTGCTGGCCAGGAGCACCTGGG - Intronic
1057438456 9:95063791-95063813 CCTCCAGTGAAGCAGCACCCCGG - Intronic
1057962845 9:99473555-99473577 CCCTCTGAGAAGGAGCACCACGG + Intergenic
1059574641 9:115475699-115475721 CCATCTGTGCAGGACCCCACTGG + Intergenic
1060888744 9:127174969-127174991 CCCTCTGTGCCGGGGCTCCCTGG + Intronic
1061296425 9:129679298-129679320 CCGACTCTGCAGCAGCACCCCGG - Intronic
1062104161 9:134743678-134743700 CATTATGTGCAGAAGCAGCCTGG + Intronic
1062213967 9:135379072-135379094 ACTTCTGAGCAGGGGCTCCCGGG - Intergenic
1186505743 X:10090575-10090597 CCCTTTGCTCAGGAGCACCCTGG - Intronic
1188224765 X:27583598-27583620 CCTGCTGTGCAGGTGCAGCCTGG - Intergenic
1188463354 X:30452464-30452486 CCATCTGTGCAGGACCCCACTGG - Intergenic
1189974210 X:46446314-46446336 CCTTCTGTGCTGGAGCCAACTGG - Intergenic
1191014172 X:55791676-55791698 CCATCTGTGCAGGACCCCACTGG - Intergenic
1192454615 X:71266523-71266545 CCATCTGTGCAGGACCCCACTGG + Intergenic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1194308521 X:92276428-92276450 CCATCTGTGCAGGACCCCACTGG - Intronic
1194367127 X:93025274-93025296 CCATCTGTGCAGGACCCCACTGG + Intergenic
1197520075 X:127486408-127486430 CCTTCTGGGGGAGAGCACCCAGG + Intergenic
1199944304 X:152653138-152653160 CCTTCAGTGAAGGAGCACCCAGG - Exonic
1200675340 Y:6141530-6141552 CCATCTGTGCAGGACCCCACTGG + Intergenic
1201307484 Y:12563297-12563319 CCATCTGTGCAGGACCCCACTGG - Intergenic