ID: 1049376358

View in Genome Browser
Species Human (GRCh38)
Location 8:142291202-142291224
Sequence CTTTCTGAGATGAGGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049376358_1049376364 -7 Left 1049376358 8:142291202-142291224 CCCACCACCCTCATCTCAGAAAG 0: 1
1: 1
2: 3
3: 27
4: 293
Right 1049376364 8:142291218-142291240 CAGAAAGGCCAAGCAAAAGTCGG No data
1049376358_1049376368 18 Left 1049376358 8:142291202-142291224 CCCACCACCCTCATCTCAGAAAG 0: 1
1: 1
2: 3
3: 27
4: 293
Right 1049376368 8:142291243-142291265 CTCCAGCATCGCGGTGAGGATGG No data
1049376358_1049376366 9 Left 1049376358 8:142291202-142291224 CCCACCACCCTCATCTCAGAAAG 0: 1
1: 1
2: 3
3: 27
4: 293
Right 1049376366 8:142291234-142291256 AAGTCGGCTCTCCAGCATCGCGG No data
1049376358_1049376370 29 Left 1049376358 8:142291202-142291224 CCCACCACCCTCATCTCAGAAAG 0: 1
1: 1
2: 3
3: 27
4: 293
Right 1049376370 8:142291254-142291276 CGGTGAGGATGGCCTTGTGCTGG No data
1049376358_1049376367 14 Left 1049376358 8:142291202-142291224 CCCACCACCCTCATCTCAGAAAG 0: 1
1: 1
2: 3
3: 27
4: 293
Right 1049376367 8:142291239-142291261 GGCTCTCCAGCATCGCGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049376358 Original CRISPR CTTTCTGAGATGAGGGTGGT GGG (reversed) Intronic
900302065 1:1982760-1982782 CTGCCCGAAATGAGGGTGGTGGG + Intronic
900415519 1:2532750-2532772 CTGCCGGAGGTGAGGGTGGTGGG + Intergenic
901688208 1:10956329-10956351 CTCTGTGATCTGAGGGTGGTGGG - Intronic
902890412 1:19439192-19439214 CTTTCTGAGATGGGAGTTTTGGG - Intronic
902985354 1:20151275-20151297 CTTTGTGAGCTGAGTGGGGTGGG + Intergenic
905844138 1:41212658-41212680 GTTTCTGAGCTTGGGGTGGTTGG - Intronic
906774407 1:48515969-48515991 CTTTTTGAGCTGAGGGTGTCTGG + Intergenic
907814651 1:57906473-57906495 CTCTCTGAGATGAAGGTGTGTGG + Intronic
909044132 1:70688916-70688938 CTTTCTAATGTGAGGGTAGTTGG + Intergenic
910196455 1:84645276-84645298 CATTCTGAGATTAGGGTGATTGG + Exonic
910496083 1:87829632-87829654 TTTTCTAAGATTAGTGTGGTTGG - Intergenic
910861000 1:91742259-91742281 CTTTGTCAAATGAGGGTGGCAGG - Intronic
911207612 1:95107979-95108001 GTTTATGGGATGAGGTTGGTTGG + Intergenic
911410245 1:97495135-97495157 CTTTATGGGAAGAGGTTGGTGGG + Intronic
912735456 1:112146082-112146104 CTTCCTGGAATGAGGGTGGAGGG - Intergenic
914333166 1:146691183-146691205 CTTTCTGAGCTGAAGTTGGGTGG - Intergenic
914916109 1:151820170-151820192 CTTTCTGAGGTTTGGGTGGATGG - Intronic
915570134 1:156740878-156740900 ATGTCTGGGATGAGGCTGGTGGG - Intronic
915680471 1:157577172-157577194 CTTTCTGAGGTGAGAGTAGCAGG + Intronic
918528931 1:185496080-185496102 CTGGCTGAGATGAAGGTGGTGGG + Intergenic
919448383 1:197738926-197738948 CTTCCTGAGATGAGGTTGGAAGG + Intronic
920275116 1:204798809-204798831 CTTTCTAAAATGAGGTTGCTGGG - Intergenic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
922979505 1:229813744-229813766 CTCTCTGAGAGGAAGGTGCTAGG - Intergenic
923269001 1:232337872-232337894 GTTTCTGAGCTCAGGGTGGGTGG - Intergenic
1063555137 10:7071671-7071693 CATTTTGAGAATAGGGTGGTTGG - Intergenic
1063672944 10:8114469-8114491 CTTTCTGGGTTGAGGTTGGGAGG + Intergenic
1064668280 10:17680648-17680670 CTTTGGGAGATGAAGGTGGAAGG - Intronic
1065047277 10:21755597-21755619 CTTTTTGGGATGAGGGAGTTGGG + Intergenic
1065809874 10:29431478-29431500 CTTTCAGAGGTCAGGGTGGCAGG - Intergenic
1067214564 10:44291890-44291912 TTTTCAGAGAGGAGGGTGGAAGG - Intergenic
1067399417 10:45957301-45957323 CCTTATGTGATGATGGTGGTTGG - Intergenic
1067841211 10:49680765-49680787 CTTCCTGAGAGGATGGAGGTGGG + Intronic
1067867735 10:49926517-49926539 CCTTATGTGATGATGGTGGTTGG - Intronic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1075615620 10:123889206-123889228 CTTTCTGAGATGTGTTTTGTAGG + Intronic
1076135682 10:128044436-128044458 CTTCCTGAGCAGAGGGTGCTGGG + Intronic
1076450569 10:130554513-130554535 CTGTCAGTGATGAGGGTGGGAGG + Intergenic
1078334943 11:10455832-10455854 CTTTCTGAGAAGAGGCAGGTCGG + Intronic
1080513113 11:32994962-32994984 CTTTGGGAGATCAGGGTGGGAGG - Intergenic
1081024395 11:37992113-37992135 CTCTCTGAGCGGTGGGTGGTGGG - Intergenic
1085291671 11:75404788-75404810 TGTTCTGAGATGGGGGTGGTGGG - Exonic
1087275215 11:96154393-96154415 ATGTCTGAGAGGAGGTTGGTAGG - Intronic
1088627073 11:111737229-111737251 CTTTCTGAGAGGTGGGTCGCCGG - Intronic
1088908616 11:114173383-114173405 GTGTCTGAGATGGGGATGGTGGG + Intronic
1089051979 11:115553604-115553626 TTTTCAGAGGTGGGGGTGGTTGG - Intergenic
1089243296 11:117099167-117099189 TGTTCAGAGATGGGGGTGGTAGG - Intergenic
1089573292 11:119423648-119423670 CTTTCTGAAAGGAAGCTGGTTGG + Exonic
1089606481 11:119644395-119644417 CTGGCTGAGAGGGGGGTGGTCGG - Intronic
1090149524 11:124367696-124367718 CCTTCAGAGATCAAGGTGGTGGG - Intergenic
1091324050 11:134670898-134670920 CAGTCTGAGATGAGGGTGGGTGG + Intergenic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1094299766 12:28949745-28949767 CATTCTGAAAGGTGGGTGGTGGG + Intergenic
1094440473 12:30470516-30470538 CTTGCCGAGCTGTGGGTGGTGGG - Intergenic
1094452677 12:30598959-30598981 CTTTTTTAGAAGAGGGTTGTAGG + Intergenic
1095197638 12:39340461-39340483 TCTTCTGAGATGTGGGTGTTTGG - Intronic
1096131827 12:49165425-49165447 CTTTGTGAGGTCAAGGTGGTAGG - Intergenic
1096195148 12:49644892-49644914 CTTTCTGAGCTTAGGGGGCTAGG - Exonic
1097409575 12:59234682-59234704 CTCGCTGAGATGCGGGTGGTGGG + Intergenic
1098591263 12:72215782-72215804 ATTCCTGGGATGGGGGTGGTTGG + Intronic
1098861737 12:75718450-75718472 CTTTCAGAAATGAGAGTGATAGG - Intergenic
1098968279 12:76819181-76819203 CTTTTTGGGATGAAGGTGATAGG + Intronic
1103331145 12:120154913-120154935 CTTTGTGAGATGTGGCAGGTTGG - Intronic
1103499226 12:121388038-121388060 GGTTGTGAGGTGAGGGTGGTGGG + Intronic
1104223829 12:126812072-126812094 CTTTGGGAGATGGGTGTGGTGGG - Intergenic
1104505401 12:129327318-129327340 TTTACTGAGATGATGGTGGTTGG - Intronic
1107978959 13:45715990-45716012 CTGCAAGAGATGAGGGTGGTTGG + Intergenic
1111017017 13:82394428-82394450 CTCACTGAGCTGTGGGTGGTGGG + Intergenic
1111017051 13:82394705-82394727 CTCACTGAGCTGTGGGTGGTGGG + Intergenic
1111854536 13:93621182-93621204 CTTTCTGAGATGAGCCTTGAGGG - Intronic
1111989258 13:95100521-95100543 ATTTCTGAGATCAGGATGATAGG - Intronic
1112784603 13:102938207-102938229 ACTTCTGAGATGAGGTTCGTGGG + Intergenic
1114561002 14:23590407-23590429 CTTTGGGAGATGAAGGTGGAAGG + Intergenic
1115685139 14:35789192-35789214 CTTTCAGATATAAGGGTGATGGG + Intronic
1115977279 14:39011138-39011160 CTATCTGAGATGCAGGTGGGTGG + Intergenic
1116296450 14:43118150-43118172 TTTTCTAAGAGGAGAGTGGTGGG - Intergenic
1116807332 14:49506765-49506787 CTTTCTGAGTTAATTGTGGTTGG - Intergenic
1117903828 14:60564222-60564244 CTTTCTCAGATGAGGAGGGCAGG + Intergenic
1119061089 14:71475428-71475450 CTCTTTGTGATGATGGTGGTGGG + Intronic
1119115772 14:72019945-72019967 CTACCTGAGATGTAGGTGGTTGG + Intronic
1119324430 14:73751410-73751432 TGTTCTGAGATGTGGCTGGTCGG + Intronic
1119469475 14:74885538-74885560 CTTTGTGAGATAAGAGTTGTTGG + Intronic
1120500522 14:85291601-85291623 ATTTCAGAGATGAGGAGGGTAGG - Intergenic
1120501481 14:85302787-85302809 ATTTCTAAGATATGGGTGGTGGG - Intergenic
1121821349 14:96970033-96970055 AAATCTGAGATGATGGTGGTAGG + Intergenic
1121903538 14:97717922-97717944 CTTTCTGAGATGGGGGATTTGGG + Intergenic
1122624884 14:103079461-103079483 CTTTCTGACGTGAGGGTGTCTGG + Intergenic
1123993345 15:25701224-25701246 CTTTCTGAGATGGCCTTGGTGGG - Intronic
1125956853 15:43796425-43796447 CTGTATGAGATGAAGGGGGTGGG - Exonic
1126796425 15:52263702-52263724 CTTTCTGAGAAGGTGGTGGGTGG - Intronic
1127059698 15:55169794-55169816 CTCTCTGCGGTGGGGGTGGTGGG - Intergenic
1128868623 15:71135727-71135749 TTTTCTCAGATGGGGGTGGAGGG + Intronic
1130519017 15:84648085-84648107 ATCTGTGAAATGAGGGTGGTTGG - Intronic
1131051251 15:89349525-89349547 CTTTCAGAAAGGATGGTGGTGGG + Intergenic
1132245908 15:100296059-100296081 GGTTCTTAGATGTGGGTGGTAGG - Intronic
1132676999 16:1125009-1125031 CTTCCTGTGGTGAGGGCGGTGGG - Intergenic
1133531061 16:6655462-6655484 CTATCTGAGATTAAGGGGGTAGG + Intronic
1135661608 16:24301906-24301928 CTTTCTGAGATCTCTGTGGTTGG + Intronic
1139641300 16:68293632-68293654 CTGTGTGAGAAGAGGGTGCTGGG - Intronic
1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG + Intronic
1140053213 16:71501476-71501498 GTTTGGGAGGTGAGGGTGGTTGG + Intronic
1140302898 16:73775389-73775411 TTTTCTCAGCTGAGGGAGGTGGG - Intergenic
1140520818 16:75579957-75579979 CTTTGTGAGCTGAGGCGGGTGGG - Intergenic
1140839501 16:78825929-78825951 TGTTCTGAGATGGGAGTGGTGGG - Intronic
1141359416 16:83381622-83381644 CTTTTTTAGGTGAGAGTGGTTGG - Intronic
1142347379 16:89562450-89562472 GTATCTGAGATGCGGGTGATGGG + Intronic
1143893864 17:10121887-10121909 GTTTCTGAGATGACTGTGGGAGG - Intronic
1144440126 17:15273712-15273734 CTTGCTCAGATGATGGTGGAAGG - Intergenic
1145912221 17:28549385-28549407 CTTACTGAGAGGAGGGGGTTTGG - Intronic
1147930446 17:43977299-43977321 CTATCAGAGAGGAGGGTGGAAGG + Intronic
1148113673 17:45162165-45162187 CTTTCTGAGAGGAAGGAGGGAGG + Intronic
1148385953 17:47235199-47235221 CTTTGGGAGATCAGGGTGGGAGG + Intergenic
1148799077 17:50211722-50211744 CTTTCTGAGTTTTGGGTGGGAGG + Intergenic
1149299982 17:55296157-55296179 ATTCCTGAGGTGTGGGTGGTTGG + Intronic
1149411064 17:56407639-56407661 AGTTCTGAGATGGGAGTGGTCGG - Intronic
1149925981 17:60702832-60702854 CTTTGGGAGATGAAGGTGGGCGG - Intronic
1150353057 17:64460587-64460609 CTTTCGGAGATCAAGGTGGGAGG - Intronic
1151254109 17:72862240-72862262 CTTTCTGAGATGGAAGTGTTGGG + Intronic
1151740672 17:75979629-75979651 CTCTCCGAAATGAGAGTGGTCGG + Intronic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1153490767 18:5645740-5645762 CTTTGTGAGATGTAGGCGGTGGG - Intergenic
1154010181 18:10567592-10567614 TTTTCTGTGATGAGGGGGCTGGG + Intergenic
1155314199 18:24555358-24555380 GTTTCTGAGAGGTGGCTGGTGGG - Intergenic
1156735629 18:40255193-40255215 CTTTCACAGCTGAGTGTGGTTGG + Intergenic
1157593729 18:48851320-48851342 CTTTCTGTGATGGGGCTGCTTGG - Intronic
1158170412 18:54592834-54592856 CTTTCAGAGAGGAAGGTGATGGG - Intronic
1159665296 18:71151535-71151557 CTTTCTAAGAGGAGGGTGATAGG + Intergenic
1160196522 18:76759739-76759761 TCTTCTGAGATGGGGGTGGTGGG + Intergenic
1161652327 19:5492933-5492955 CTCTCTGAGATGCGGGAGGAAGG + Intergenic
1164789106 19:30960876-30960898 GTTCCAGGGATGAGGGTGGTAGG + Intergenic
1164873769 19:31668557-31668579 CTTGATGGGATGAGGGTGTTGGG + Intergenic
1166622500 19:44314450-44314472 CATCCTGAGATGGGGCTGGTTGG - Intergenic
1167082219 19:47284565-47284587 CTTCCAGAGATGTGGGAGGTAGG + Intergenic
1167725166 19:51207032-51207054 TCTTCTGAGAGTAGGGTGGTGGG - Intergenic
1168378345 19:55899473-55899495 CTTTTTGGGATGGGGGGGGTGGG - Intronic
925818431 2:7776074-7776096 CTTAGGAAGATGAGGGTGGTCGG + Intergenic
926155494 2:10451353-10451375 CTTTCTGAAAATGGGGTGGTTGG + Intergenic
927014270 2:18940838-18940860 CTTTCAGGGATGAGGGAGGGAGG + Intergenic
927293661 2:21428711-21428733 CTTTCTGAGATACGGGGGTTGGG - Intergenic
927459666 2:23287112-23287134 GGTTTTGAGATGGGGGTGGTGGG + Intergenic
928376965 2:30783280-30783302 CTTGCTGAGACCAGGGTTGTAGG + Intronic
930400166 2:50874262-50874284 CTATCTGAGATAACGGTGCTAGG - Intronic
932304654 2:70693457-70693479 CTTTCTGGGGTGGGGGTGATGGG - Intronic
932365030 2:71145678-71145700 CTTACTGAGATGAAGGACGTGGG + Intronic
932824556 2:74927542-74927564 GTTTCTGAGATCAGGGTCCTCGG - Intergenic
933245204 2:79967260-79967282 CACACTGAGATGAGGATGGTTGG - Intronic
933606696 2:84391083-84391105 CTTTTGCACATGAGGGTGGTGGG - Intergenic
933749292 2:85592862-85592884 CTTACTGAGATGGGGTTGGGAGG + Intronic
935600308 2:104915643-104915665 CTTACAGACATAAGGGTGGTAGG + Intergenic
935635513 2:105246919-105246941 ATTTCAGAGATGAGGCAGGTGGG - Intergenic
935963179 2:108447487-108447509 TTTTCTGAGATGATGGAGGCAGG - Intergenic
936933897 2:117819184-117819206 CTATCAGGGATGAGGGTGGGAGG - Intronic
937431690 2:121844077-121844099 CCTGCTGTGACGAGGGTGGTTGG + Intergenic
937536852 2:122899499-122899521 TTTTGTGAGGTGGGGGTGGTGGG + Intergenic
937930554 2:127201721-127201743 CTTCCTGAGAGGAGGGTGTTGGG - Intronic
938860070 2:135359015-135359037 CTTTCTGGGATGAGGAGGGCAGG - Intronic
939665000 2:144940932-144940954 CTTTCTGGAATGAGGTGGGTAGG + Intergenic
941471670 2:165896146-165896168 CAGCCTGAGATGAAGGTGGTGGG + Intronic
941918905 2:170830089-170830111 CCTCCTGAGATGAGTGTTGTGGG - Intronic
942665101 2:178309108-178309130 CTGGTTGAGAGGAGGGTGGTGGG - Intronic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
943173431 2:184434212-184434234 CTTTCTGAGATGATTTTGTTTGG + Intergenic
943982682 2:194574972-194574994 ATTTCTGAGATGTGGGTAGCAGG - Intergenic
944803167 2:203256210-203256232 CTTTGCGAGATGAAGGTGGGAGG - Intronic
944862262 2:203826297-203826319 CTTACTTAGATGGGGGTGGTTGG - Intergenic
945068455 2:205967224-205967246 CTTTGGGAGATCAAGGTGGTAGG - Intergenic
946602964 2:221371874-221371896 CTTTCTCAGGTGAGGGTTGAGGG + Intergenic
947033325 2:225822997-225823019 CTTTCTGATATGAGAAGGGTGGG + Intergenic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
1169016286 20:2295415-2295437 CTTTGTGAGTTGAGAGGGGTGGG + Intergenic
1170080006 20:12464269-12464291 CTTTCTGAGATAAGGGTGCTGGG + Intergenic
1171084937 20:22229452-22229474 CTTTGTGAGTTAAGGGTGGGTGG + Intergenic
1171313941 20:24169537-24169559 ATTTCTAAGATGAGGGTGTCAGG - Intergenic
1172564074 20:35914719-35914741 CTTTGTGAGGTGAGGCAGGTGGG + Intronic
1172788305 20:37485018-37485040 AAGTCTGAGAAGAGGGTGGTGGG + Intergenic
1174180654 20:48672364-48672386 CTGGCTGAGAACAGGGTGGTGGG - Intronic
1175072907 20:56349696-56349718 CATTCTGAGAAGAGTGTGGAAGG - Intergenic
1175765684 20:61590922-61590944 CTTCCTGACATGAGGGCAGTTGG + Intronic
1175862174 20:62156406-62156428 CATCCTGAGATGGGGGTGGGGGG - Intronic
1177319497 21:19501703-19501725 CTTTCTAAGAAAAGGTTGGTAGG - Intergenic
1178580044 21:33830883-33830905 CTTGCAGAGAAGAGGGTGGGGGG + Intronic
1179332688 21:40420590-40420612 CATTCTGAGATACTGGTGGTAGG - Intronic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1181368261 22:22396857-22396879 CTTTTTGAGGAGCGGGTGGTTGG - Intergenic
1182315912 22:29447139-29447161 CTTTCTGGGGTGAAGGTGGGTGG - Intergenic
1182440826 22:30362860-30362882 TTTTCTGAGATGAGGGTGGTTGG + Intronic
1183235763 22:36616041-36616063 GTTTCTGAGTTGAGGGTCTTTGG - Intronic
1183450831 22:37894030-37894052 CTGTCTGAGATGGGGGTTGGTGG + Intergenic
1184413264 22:44337981-44338003 CTTTCTGAGAGGGTGGTGCTTGG + Intergenic
1185337858 22:50278751-50278773 CTTTCTCATATGGGAGTGGTGGG - Intronic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
950316520 3:12005604-12005626 TTTTCTGAAATGTGCGTGGTGGG + Intronic
952672707 3:35990002-35990024 CTATCTGAGATGTATGTGGTGGG + Intergenic
953510957 3:43538680-43538702 CTTTTGGACTTGAGGGTGGTTGG + Intronic
954559080 3:51540593-51540615 CCTTCTGAGTTTAGAGTGGTAGG + Intergenic
955467227 3:59249875-59249897 CATGCTGAAATGAGGGTGGATGG + Intergenic
955981410 3:64531253-64531275 CTTTCTCAGGTGAGGGAGGCAGG + Intronic
957310246 3:78509824-78509846 CTTTTTGAGAGTGGGGTGGTGGG - Intergenic
958465613 3:94453949-94453971 CTCACTGAGCTGAGGGTGGTGGG + Intergenic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960254700 3:115499487-115499509 TTTCTTGAGATGAGAGTGGTTGG + Intergenic
960837233 3:121919288-121919310 CTTGCTGAGCTGTGGGTGATGGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963227350 3:142875881-142875903 GTTCCTGTGGTGAGGGTGGTAGG - Intronic
964492606 3:157253090-157253112 CTTTCTGAGAGCAGGGGGGATGG - Intergenic
964743092 3:159988059-159988081 CTTTCTGTGCTGAGAGTAGTGGG - Intergenic
966848659 3:184150358-184150380 TGTTCTGAGATGGGGGTGGTGGG - Intronic
969346262 4:6572128-6572150 CTTTGTGAGATGGTGGTGGGAGG + Intergenic
969509802 4:7611334-7611356 CTGGCTGAGATGAGTGGGGTTGG + Intronic
970407607 4:15778634-15778656 CATCCTGAGATGAGGTGGGTTGG + Exonic
971854584 4:32026891-32026913 CTTTCTACGATGAGGGGGGCAGG - Intergenic
974025040 4:56725993-56726015 CTTACTGTGATGAGTGTGATAGG + Intergenic
975621945 4:76305343-76305365 CTTCCTGAGATGGGGAAGGTGGG + Intronic
977235356 4:94501764-94501786 ATCTCTGAGAAGAGGGAGGTTGG - Intronic
978573431 4:110164988-110165010 CTTTCTTAGTTGGGTGTGGTGGG - Intronic
980457145 4:133059202-133059224 CTTGCTGAGCTGGGGATGGTGGG + Intergenic
981384610 4:144114600-144114622 CTTTCTGATTTGAGGGAGGAGGG - Intronic
981557653 4:146012803-146012825 CTTTCTGAGGTCAAGGTGGGTGG - Intergenic
983456594 4:167972564-167972586 CTTGCTGAGCTGTGGGTGGTGGG + Intergenic
986754052 5:10817926-10817948 CTGTCAGAGATGGGGGTAGTGGG + Intergenic
990455280 5:55980145-55980167 ATTTGAGAGATCAGGGTGGTAGG + Intronic
991165547 5:63562726-63562748 TTCGTTGAGATGAGGGTGGTGGG + Intergenic
992185686 5:74242131-74242153 CTTTCTTAGATCATGGTGGTGGG - Intergenic
992791563 5:80218825-80218847 CTTTCTGTGATGTGGTTTGTGGG - Intronic
993380003 5:87196035-87196057 CCTTCTGAGATGAGGAAGCTGGG + Intergenic
993785534 5:92130293-92130315 ATTTGTGAGATGAGGGTTGTGGG + Intergenic
994355753 5:98792488-98792510 CTTTGGGAGATGATGGTGGGAGG + Intronic
994600833 5:101902507-101902529 GTTTCTGAGATGAGTGTTGGGGG - Intergenic
995162480 5:108997870-108997892 CTTGCTGAGCTGTGTGTGGTAGG + Intronic
995374032 5:111453469-111453491 CTTTCTGAGAATAAGTTGGTGGG + Intronic
998855789 5:146394067-146394089 CATTCTAAGAAGAGAGTGGTGGG + Intergenic
999049849 5:148510560-148510582 CTTTCAGGGATGAGAGTGGAGGG - Intronic
999303943 5:150507951-150507973 CTTTCTGAGGTTAAGGAGGTAGG + Intronic
999308961 5:150539172-150539194 CCTTCTGGCATGAGGGTGGTGGG - Intronic
999606450 5:153322047-153322069 GTTTATGTGAAGAGGGTGGTTGG - Intergenic
999821524 5:155233615-155233637 CTTTCTGAGTTGAGGGTGCTGGG + Intergenic
1001411477 5:171515491-171515513 CTTTCCGAGGTGAGGGAGGGTGG - Intergenic
1002274823 5:178097271-178097293 CTCTCTAAAATGGGGGTGGTAGG - Intergenic
1003580777 6:7338891-7338913 TGTTCTGAGATGGGGGTGGTGGG + Intronic
1003863124 6:10340067-10340089 TTTTCTGAGATGAAGATGATCGG - Intergenic
1004322983 6:14647608-14647630 CCTTCAGAGATGAGAGTGGCAGG - Intergenic
1004585223 6:16992981-16993003 CTTTTTGAGATGAGTTTAGTTGG + Intergenic
1005008462 6:21313276-21313298 CTATTTAAAATGAGGGTGGTGGG - Intergenic
1005629139 6:27690989-27691011 CTTTCAGAGGTAATGGTGGTGGG + Intergenic
1006370965 6:33643337-33643359 CTTCCCGAGGTGGGGGTGGTGGG - Intronic
1007050060 6:38818083-38818105 ATTTCTGAGATTATGGTGTTTGG + Intronic
1007168302 6:39844275-39844297 CTATTTGAAATCAGGGTGGTAGG - Intronic
1010656598 6:78518594-78518616 CTTTCTCAGCAGAGGGTGATGGG - Intergenic
1010726213 6:79336743-79336765 CTTTGGGAGATGAAGGTGGGAGG - Intergenic
1011184660 6:84660961-84660983 ATTTTTGAGAGGAGGGTGGGAGG + Intergenic
1011345606 6:86366727-86366749 CTGGCTGAGATGAGACTGGTGGG + Intergenic
1011438890 6:87367242-87367264 CTTCCTGACATTAGGATGGTGGG - Intronic
1013392588 6:109701677-109701699 CTTTCTGTGATGGGGGTGGGAGG - Intronic
1013669382 6:112382650-112382672 CTTTCTGAGATCTGGGTTGAAGG + Intergenic
1014652436 6:124056491-124056513 ATTTCTGAGTTGAAGGAGGTAGG - Intronic
1016123412 6:140371755-140371777 CATTCTGATCTGATGGTGGTGGG + Intergenic
1016636695 6:146300817-146300839 CTTTCTTAGATGGTGGTGGCAGG - Intronic
1017492797 6:154958954-154958976 CTGTCAGAGATGAGGATGGCGGG - Intronic
1017728879 6:157296741-157296763 ATGTCTTAGATGAGGATGGTGGG - Intronic
1019289802 7:244939-244961 CTTTCTGAGAACAGCGTGGGAGG + Intronic
1020637941 7:10718908-10718930 CATTTTGAGATGAGGCTGGTTGG + Intergenic
1021507039 7:21397284-21397306 GTTTCTGAGCTGAGTGTGATGGG - Intergenic
1021820073 7:24488081-24488103 CTGTATGAGATGAGGTTGGTGGG - Intergenic
1023847360 7:44129940-44129962 CCTTCTGAGTGGAGGGTGCTGGG - Intergenic
1024828728 7:53422528-53422550 CTTGCTGAGCTGCTGGTGGTGGG + Intergenic
1025197721 7:56945460-56945482 CTTCCCGCCATGAGGGTGGTTGG - Intergenic
1026459212 7:70598688-70598710 CTTTCTGACAAGTGGGTGTTTGG + Intronic
1026543412 7:71300315-71300337 CTTTCTAAGAGGAGGCTTGTTGG + Intronic
1027227700 7:76254812-76254834 CTTGATGAGCTGAGGGTGCTGGG + Intronic
1027513318 7:79110289-79110311 AGTTGTGAGAAGAGGGTGGTGGG + Intronic
1027641309 7:80736715-80736737 CTTGATGGGATGAGGGTGTTAGG - Intergenic
1028496363 7:91465119-91465141 TTTTCAGAGATGAGGGTGTGAGG - Intergenic
1029369115 7:100136527-100136549 CTTTCTGGGCTGGGCGTGGTGGG - Intergenic
1029670487 7:102027139-102027161 CTTTGGGAGATGAAGGTGGGCGG + Intronic
1030026830 7:105332518-105332540 CTTTGTGAGGTCAAGGTGGTTGG + Intronic
1030556793 7:111035429-111035451 CTTTCAGAGATGAGGTTACTTGG + Intronic
1031084594 7:117289995-117290017 TTTTCTGAGATGAGGAGGGCTGG + Intronic
1031925238 7:127632547-127632569 CATCCTGAGATGGGGCTGGTTGG + Intergenic
1032391655 7:131558784-131558806 CTTTCTGGAATGAGGCTGGCTGG + Intergenic
1033476805 7:141700856-141700878 CTTTCTGGGATGAGGTGGGATGG - Intronic
1033516369 7:142110814-142110836 CTTGCTAAGATGGGGGAGGTGGG - Intergenic
1034673905 7:152877953-152877975 CTTTCTGAGGTGGAGGAGGTTGG + Intergenic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1035863900 8:3060430-3060452 CTTTGTGAGACGAAGGTGGGTGG - Intronic
1036803366 8:11809095-11809117 CTTTCAGAGAAGAGGGGGGAGGG + Intronic
1038236709 8:25765765-25765787 GGTACTGAGATGTGGGTGGTTGG + Intergenic
1038523899 8:28257054-28257076 CTATGTGAGAGCAGGGTGGTGGG + Intergenic
1039132518 8:34283369-34283391 TTTTCTAGGAAGAGGGTGGTAGG + Intergenic
1039656710 8:39417477-39417499 CTTTATGAGATGAGGGTCTTAGG - Intergenic
1039816973 8:41102746-41102768 CTTTAGGAGATCAGGGTGGGAGG + Intergenic
1042616006 8:70650089-70650111 CTTTGGGAGATGAAGGTGGGAGG - Intronic
1043099729 8:76027459-76027481 ATTTCTGAGATGCTGGTGCTCGG + Intergenic
1043618741 8:82160845-82160867 CTTGCTGAGCAGCGGGTGGTGGG + Intergenic
1044979226 8:97698512-97698534 TTTTCTCAGGTGAGGGTAGTAGG - Intronic
1046186856 8:110733631-110733653 CTTTCTCAGAAGTGGGTGTTGGG + Intergenic
1047907154 8:129484391-129484413 CTTTATGAGATGAGGGTGGGGGG + Intergenic
1048712085 8:137223760-137223782 TCTTCAGAGAGGAGGGTGGTGGG - Intergenic
1049356185 8:142189616-142189638 CTATCTCAGATGAGGGCGTTAGG + Intergenic
1049376358 8:142291202-142291224 CTTTCTGAGATGAGGGTGGTGGG - Intronic
1052680212 9:31681636-31681658 CTTTCTGAGATGACTGTTTTAGG - Intergenic
1055934054 9:81588717-81588739 CATGCTGAGAGGAAGGTGGTGGG + Intronic
1056191689 9:84190541-84190563 CAGTATGAGATGAGGGTGGAAGG - Intergenic
1056210760 9:84362763-84362785 CATTCTGAGAAGAGGGCTGTAGG - Intergenic
1056343186 9:85659542-85659564 CTTTTTCAAATGAGGGTGGTGGG - Intronic
1056598989 9:88031269-88031291 CATTCTGAGACGCTGGTGGTTGG + Intergenic
1056955230 9:91075834-91075856 ATCTCTGAGAAGATGGTGGTGGG - Intergenic
1057142677 9:92737067-92737089 TTCCCTGAGATGGGGGTGGTGGG - Intronic
1057820671 9:98328139-98328161 GTTTGTGAGATGAGGCTGGAGGG - Intronic
1058503831 9:105649031-105649053 TTTTCTTAGTTGAGGGAGGTTGG + Intergenic
1059134880 9:111795308-111795330 CTTTCAGAGGTAAGGGTGGGAGG + Intergenic
1060101138 9:120842166-120842188 CTTCCCGAGATGTGGCTGGTTGG - Intronic
1062045035 9:134421027-134421049 CCATCAGAGATGAAGGTGGTTGG + Intronic
1185992015 X:4901799-4901821 CTTTGGGAGATGAAGGTGGGTGG + Intergenic
1186464442 X:9774122-9774144 CTTTAAGAGATGAGGATGGGAGG - Intronic
1187698441 X:21942562-21942584 ATTTCTTAGGTGAGGATGGTAGG + Intronic
1188115994 X:26243585-26243607 CTTGCTGAGATCAGCTTGGTTGG + Intergenic
1189065708 X:37806065-37806087 CTTTCTGAGAAGAGGTTCGAAGG + Intronic
1190187865 X:48251638-48251660 CATTCTGAGAGGAGGGCGATGGG + Intronic
1190359193 X:49633524-49633546 GTTGCTGAGATGAGGTTTGTTGG + Intergenic
1191129153 X:56989791-56989813 CTGTCCCAAATGAGGGTGGTGGG - Intronic
1197401507 X:125997374-125997396 CTTTCTGAGAAGAAAGTAGTTGG + Intergenic
1197871440 X:131066081-131066103 GTTTCTCAGATGAGGCTGCTTGG + Intronic
1199684904 X:150257296-150257318 TTCTCTGAGATGATGGTGGTGGG - Intergenic