ID: 1049377019

View in Genome Browser
Species Human (GRCh38)
Location 8:142294126-142294148
Sequence CATCCTCTGAGGTCCGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049377019_1049377025 -8 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377025 8:142294141-142294163 AGAGGATGCAGAGTGGCCAGAGG No data
1049377019_1049377035 19 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377035 8:142294168-142294190 GTGGAGGGCGGTGTGAGGAAGGG No data
1049377019_1049377030 4 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG No data
1049377019_1049377034 18 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377034 8:142294167-142294189 GGTGGAGGGCGGTGTGAGGAAGG No data
1049377019_1049377031 7 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377031 8:142294156-142294178 GCCAGAGGGAAGGTGGAGGGCGG No data
1049377019_1049377029 3 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377029 8:142294152-142294174 AGTGGCCAGAGGGAAGGTGGAGG No data
1049377019_1049377027 -3 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377027 8:142294146-142294168 ATGCAGAGTGGCCAGAGGGAAGG No data
1049377019_1049377033 14 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377033 8:142294163-142294185 GGAAGGTGGAGGGCGGTGTGAGG No data
1049377019_1049377026 -7 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377026 8:142294142-142294164 GAGGATGCAGAGTGGCCAGAGGG No data
1049377019_1049377028 0 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG No data
1049377019_1049377036 28 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377036 8:142294177-142294199 GGTGTGAGGAAGGGCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049377019 Original CRISPR CATCCTCTGAGGTCCGCAGG GGG (reversed) Intronic
901051389 1:6427464-6427486 CCTGCTCTGAGGTCCCCGGGGGG + Intronic
902612098 1:17603347-17603369 CATCCCCTGAGGGCAGCTGGCGG + Intronic
905316384 1:37084198-37084220 CATGCTCTGAGTTCTGCAGGAGG - Intergenic
905639645 1:39580082-39580104 CATCACCTGAGGTCAGCAGTCGG - Intergenic
907520306 1:55019523-55019545 CAACCACTGAGGTCCCCACGAGG - Intergenic
915664352 1:157431098-157431120 CATCCTCTGAGCTATTCAGGAGG + Intergenic
915933907 1:160078790-160078812 CACCCTGTGAGGCCTGCAGGGGG - Intergenic
918072142 1:181141052-181141074 CACCCCCTGAGGGCCACAGGTGG + Intergenic
918634969 1:186764578-186764600 CATCCCCTAAGGGCCCCAGGAGG + Intergenic
922663769 1:227451902-227451924 TATCCTCTGCAGTCAGCAGGTGG + Intergenic
923109075 1:230876628-230876650 CCGCCTCTGTGGTGCGCAGGTGG - Intergenic
1063510100 10:6636426-6636448 CATCCTGTGAGGATCCCAGGTGG - Intergenic
1070018567 10:72560292-72560314 CAACCTCTGTGGTCTACAGGAGG + Intronic
1071443988 10:85729238-85729260 CTTCCTCTGAGGACCAGAGGGGG - Intronic
1072677684 10:97480453-97480475 CATGCTTTGAGGTCCTGAGGGGG - Intronic
1076533331 10:131159920-131159942 CACCCTCTGAGGTCTGGTGGCGG + Intronic
1078934430 11:15939183-15939205 CATCCCCAAAGGTCAGCAGGAGG - Intergenic
1079299255 11:19262928-19262950 CCTCCTCTGGGCTCTGCAGGGGG - Intergenic
1081695132 11:45104503-45104525 CATCCTGTAAGGTCAGTAGGAGG - Intronic
1081853631 11:46290600-46290622 CAGCCCCTGGGGTCTGCAGGAGG + Intronic
1083331404 11:61900087-61900109 CATCGGCTGAGGTCTACAGGAGG - Intronic
1083804893 11:65067683-65067705 TCTCCTTTGAGGTCCGCTGGGGG + Intronic
1084366756 11:68706453-68706475 CTTCCTCTGGGCTCCGCGGGTGG + Intergenic
1084589758 11:70083925-70083947 CATCCTCTGGGATCTGAAGGTGG - Intronic
1087643771 11:100784051-100784073 CATCTTCTGATGTCCCCAGCTGG - Intronic
1089151291 11:116366423-116366445 CAGCCTTTGAGGGCCCCAGGCGG + Intergenic
1089890322 11:121874281-121874303 CATCCTCTTAGCTCTGCAAGAGG - Intergenic
1090183364 11:124719705-124719727 CAGCATATGAGGTCCCCAGGGGG - Intergenic
1093892055 12:24533966-24533988 CATCCTATGGGGTCCAAAGGAGG + Intergenic
1096376843 12:51119527-51119549 GATCACCTGAGGTCCGGAGGTGG + Intronic
1097311464 12:58123421-58123443 CATGCACTGAGGTCCAGAGGCGG + Intergenic
1100362239 12:93889576-93889598 CTTCCTCTGAGACCCGCTGGGGG - Intronic
1100710860 12:97255200-97255222 CATCATCTTAGGCCCTCAGGTGG + Intergenic
1102208152 12:111104869-111104891 CATTCTCTGAGGGCCACAGCTGG - Intronic
1102521901 12:113482989-113483011 CATCTTCTGAGGTCTGCAAATGG + Intergenic
1104319645 12:127738609-127738631 CACCCACTGAGATCTGCAGGAGG - Intergenic
1113684642 13:112274366-112274388 CATCGTCTCAGCTCTGCAGGCGG - Intergenic
1113753446 13:112792012-112792034 CAACCTCTGAGGACAGAAGGGGG + Intronic
1113890188 13:113731538-113731560 CAGCCCCTGAGGCCTGCAGGTGG + Intronic
1114560769 14:23589018-23589040 CCTCAGCTGAGGTCCCCAGGAGG - Intergenic
1118737041 14:68708566-68708588 CAGCCTCTGAGGCCACCAGGCGG + Intronic
1120922000 14:89763865-89763887 CATCTTCAGAGGTCCCCATGGGG + Intergenic
1121267799 14:92615618-92615640 CATCCTCTGTGGTTCCCAGAGGG - Intronic
1123492706 15:20795351-20795373 CATCCTGTGAGGTAGACAGGGGG - Intergenic
1126680633 15:51198877-51198899 CCTCCTCTGAGGTCTGGACGTGG - Intergenic
1132737237 16:1392997-1393019 CAGACTCTGAGGGCCGCTGGTGG + Intronic
1135137948 16:19898580-19898602 GAACCACTGAGGTCAGCAGGGGG - Intergenic
1140926637 16:79590055-79590077 CACCCTCTGAGGTCCCCCGAGGG - Intronic
1141082596 16:81065529-81065551 CAGCCTGTGGGGTCCACAGGAGG - Intronic
1142115912 16:88355998-88356020 CCTCCTCAGAGGGCCTCAGGGGG - Intergenic
1142375835 16:89706746-89706768 CATGCTCTGAGGTGCACAGAAGG - Intergenic
1142561243 17:810666-810688 GATCCCCTGAGGTCAGGAGGTGG + Intronic
1148195646 17:45710800-45710822 CATCCCCTGAGATGGGCAGGGGG + Intergenic
1149313313 17:55417139-55417161 CAGCCTCTGAGATCTGCTGGTGG - Intronic
1152392713 17:80012243-80012265 CATCCTTTGAGATCGGCAAGAGG + Intronic
1152629202 17:81402195-81402217 CGTTCTCTTCGGTCCGCAGGGGG - Intronic
1154450250 18:14469889-14469911 CATCCTGTGAGGTAGACAGGGGG - Intergenic
1155819975 18:30362480-30362502 CAGCCGCAGAGGTCCTCAGGTGG + Intergenic
1157666542 18:49492246-49492268 CGGCCTCTGAGGTCCGCAGAGGG - Intronic
1161280131 19:3441534-3441556 CAGCCTCTGAAGTCCCAAGGGGG + Intronic
1161420866 19:4175306-4175328 CCTCCTCTGCGGTCCGTTGGCGG + Intronic
1162605920 19:11707970-11707992 CAACCCCTGAGGTTAGCAGGAGG - Intergenic
1162676952 19:12306325-12306347 CCACCTCTGAGGTTAGCAGGAGG - Intergenic
1163753491 19:19092603-19092625 CTTGCTCTGAGCTCCTCAGGAGG - Intronic
1163897092 19:20068760-20068782 CATCCTCTGAGCTATACAGGAGG + Intergenic
1163949247 19:20568760-20568782 CATCCTCTGAGCTATTCAGGAGG + Intronic
1164828490 19:31301865-31301887 CACCCCATGAGGTCCACAGGTGG + Intronic
1164923479 19:32107556-32107578 CATCCTCTTGTGGCCGCAGGTGG - Intergenic
926285987 2:11488567-11488589 GATCATCTGAGGTCAGCAGTTGG + Intergenic
928105697 2:28469338-28469360 GATCCTCTGAGGTCAGCTGGTGG + Intronic
931381113 2:61754428-61754450 CATCCTCTGAGGTAGGCAGGTGG + Intergenic
937092334 2:119214720-119214742 CTCCCTGTGAGGTCCTCAGGGGG + Intergenic
938500807 2:131830569-131830591 CACCCTCTGGTGTCCGCAGCTGG + Intergenic
947291997 2:228585791-228585813 CATCATCTGAGGTCAGGAGATGG + Intergenic
948530498 2:238600639-238600661 CATTCTCTGAGGTCGTCATGAGG - Intergenic
1170177596 20:13489562-13489584 CATCTGCTGAGGACGGCAGGAGG + Intronic
1170562565 20:17569869-17569891 CGTCCTCTCTGGTCTGCAGGAGG - Exonic
1172043168 20:32060462-32060484 GATCACCTGAGGTCAGCAGGCGG - Intronic
1172124078 20:32614712-32614734 CATTCTCTGAGGGCAGTAGGAGG + Intergenic
1174077858 20:47951055-47951077 CGTGCTCTGCGGTCCGCACGGGG + Intergenic
1174480832 20:50830208-50830230 CAACCTCTGAGGCAGGCAGGAGG + Intronic
1175037137 20:56010367-56010389 CGTTCTCTGAGGCCCGCATGAGG + Intergenic
1175347801 20:58294765-58294787 CATCGTCTGATGTCCCCTGGGGG + Intergenic
1175606632 20:60316749-60316771 CATCCTCAGAGGTCTGGACGTGG - Intergenic
1175964220 20:62652378-62652400 CAACCTCAGAGGCCCGGAGGAGG - Intronic
1176445935 21:6820472-6820494 CATCCTGTGAGGTAAACAGGGGG + Intergenic
1176824103 21:13685505-13685527 CATCCTGTGAGGTAAACAGGGGG + Intergenic
1178122453 21:29482831-29482853 CTTCCTCTGAGGTCAAAAGGCGG - Intronic
1180001140 21:44996065-44996087 CCCCCTCTGAGGTCCTCGGGAGG + Intergenic
1181768320 22:25108249-25108271 AATCCACTGGGGTCCTCAGGAGG - Intronic
1184207379 22:43014135-43014157 CATCCTGAGAGGTCCGCAATTGG - Intronic
1185017299 22:48352229-48352251 CTTTGTCTGAGGTCAGCAGGTGG - Intergenic
950053156 3:10007345-10007367 CATGCTGAGAGGTCCCCAGGAGG + Intronic
950074497 3:10177683-10177705 CATTAGCTGAGGTCCACAGGTGG - Intronic
950472049 3:13192573-13192595 CAGCCTCTGGGGACGGCAGGTGG - Intergenic
954634405 3:52063754-52063776 CATCCTCTGAGGGCCACAGTGGG + Intergenic
957043685 3:75357393-75357415 GATCCTCTGAGATTCCCAGGAGG + Intergenic
961156414 3:124683455-124683477 CATCCTGTGATGTAGGCAGGTGG - Intronic
961564795 3:127755624-127755646 CATTCTCTGGGGCCCGCAGTGGG - Intronic
967190124 3:186977655-186977677 CGTCCTCTGAGCGCCTCAGGAGG + Intronic
967479027 3:189953282-189953304 CAGCCTCGGAGGTCAGCAGTGGG + Intergenic
968723135 4:2222448-2222470 AATCACCTGAGGTCCGGAGGCGG + Intronic
970387509 4:15570631-15570653 CATCATCTGAGGTCAGGAGTTGG + Intronic
972391491 4:38617901-38617923 TATCCTCTCAGCTCCTCAGGAGG - Intergenic
972718997 4:41676939-41676961 CATCATCTGAGGTCAGGAGTTGG + Intronic
982270267 4:153578877-153578899 GATCATCTGAGGTCAGCAGTTGG - Intronic
987033108 5:13993976-13993998 CCTCCTCAGAGGTCGGAAGGAGG + Intergenic
987370465 5:17188111-17188133 CATCCTCTGTGTGCCACAGGTGG - Intronic
995588886 5:113677537-113677559 CATCCTCCTAGGTCTGCAGAAGG + Intergenic
997655829 5:135553725-135553747 CATCTGCTGAGGTCCTCAAGAGG - Intergenic
997717572 5:136053412-136053434 CATGCTCTGAGGTCAGCAAGTGG - Intronic
998625434 5:143840725-143840747 CGTCCTCTGAGGTCCACATGAGG - Intergenic
999168232 5:149569840-149569862 CATCATCTGAGGTCAGGAGTTGG - Intronic
999760043 5:154692728-154692750 CTTCCTTTGAGGTTGGCAGGAGG - Intergenic
1000294466 5:159901240-159901262 TATCCTCTGAGGAAGGCAGGAGG - Intergenic
1002002095 5:176202020-176202042 CATCATCTGAGGTCAGGAGTTGG + Intergenic
1003293831 6:4806132-4806154 AGTCCTCTGAGGTCAGCAGGAGG + Intronic
1003347802 6:5286999-5287021 CATGCTCTGTGCTCCACAGGCGG - Intronic
1005094911 6:22104182-22104204 CACCCTCTCAGGTCTGCATGAGG - Intergenic
1010124703 6:72418740-72418762 CACCCTCTGAGGCGAGCAGGCGG - Intergenic
1018092171 6:160354974-160354996 CATCCTCCGGGGACTGCAGGAGG - Intronic
1018903837 6:168064000-168064022 CCTCCTCAGACGTCTGCAGGTGG + Intronic
1019178929 6:170175444-170175466 CAGCCGCTGAGGTGAGCAGGTGG - Intergenic
1022499557 7:30873949-30873971 CCTCCTCTGATGGCCGCAGAGGG - Intronic
1023817466 7:43961780-43961802 GATGCTCTGAGGTCCTCAGAGGG - Intergenic
1024967072 7:55033423-55033445 CATCCCCTGCAGTCCCCAGGGGG - Intronic
1029742091 7:102496654-102496676 GATGCTCTGAGGTCCTCAGAGGG - Intronic
1029760080 7:102595819-102595841 GATGCTCTGAGGTCCTCAGAGGG - Intronic
1033469481 7:141632005-141632027 GATCATCTGAGGTCAGCAGTTGG + Intronic
1034786458 7:153930408-153930430 CATCCTCTGATGTTCTCAGCAGG + Intronic
1035276715 7:157752345-157752367 CATCCTCTGAGAGCCCCAGAGGG + Intronic
1036552785 8:9829651-9829673 CACCCTCTGAGGTCCGCGGCTGG - Intergenic
1036597454 8:10226843-10226865 CTTGCTCTCAGGTCCTCAGGAGG + Intronic
1037047243 8:14322455-14322477 CATCCTCTATGGTCCATAGGTGG + Intronic
1042815246 8:72871136-72871158 AATCCTGTGAGGTTGGCAGGTGG - Intronic
1043509583 8:80936471-80936493 TATCTTCTGAGGTTCCCAGGTGG + Intergenic
1045489297 8:102656493-102656515 CATCCTCTGGGTTGCCCAGGAGG - Intergenic
1045928774 8:107600169-107600191 GATCCTCTAAGTTCCTCAGGAGG + Intergenic
1048044169 8:130757536-130757558 CATCCCCTGAGGTTTCCAGGTGG - Intergenic
1049377019 8:142294126-142294148 CATCCTCTGAGGTCCGCAGGGGG - Intronic
1050092225 9:2026478-2026500 CATTCTCTGAGATTCCCAGGTGG + Intronic
1056725273 9:89109014-89109036 CATTCTCTGAGGTTCCAAGGAGG + Intronic
1059320926 9:113468820-113468842 CATGTTCTGAGGTCTGCAGGTGG + Intronic
1060545314 9:124455923-124455945 TGTCCTCTGAGGCCCACAGGGGG - Intronic
1061495727 9:130973278-130973300 CAGCCTCCGAGGTCTGCTGGAGG - Intergenic
1061743863 9:132725855-132725877 CATCCTTTGGGTTCTGCAGGAGG + Exonic
1062087561 9:134656810-134656832 CATCCTCTGAGGTCCCTGGCTGG - Intronic
1062430865 9:136526354-136526376 CAGCCGCTGAAGTCGGCAGGGGG + Intronic
1203523258 Un_GL000213v1:64053-64075 CATCCTGTGAGGTAAACAGGGGG - Intergenic
1197854704 X:130902729-130902751 CCTCCTCAGAGGTCCGAAGTTGG - Intronic