ID: 1049377020

View in Genome Browser
Species Human (GRCh38)
Location 8:142294127-142294149
Sequence GCATCCTCTGAGGTCCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049377020_1049377027 -4 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377027 8:142294146-142294168 ATGCAGAGTGGCCAGAGGGAAGG No data
1049377020_1049377036 27 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377036 8:142294177-142294199 GGTGTGAGGAAGGGCACCAGAGG No data
1049377020_1049377031 6 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377031 8:142294156-142294178 GCCAGAGGGAAGGTGGAGGGCGG No data
1049377020_1049377028 -1 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG No data
1049377020_1049377035 18 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377035 8:142294168-142294190 GTGGAGGGCGGTGTGAGGAAGGG No data
1049377020_1049377034 17 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377034 8:142294167-142294189 GGTGGAGGGCGGTGTGAGGAAGG No data
1049377020_1049377033 13 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377033 8:142294163-142294185 GGAAGGTGGAGGGCGGTGTGAGG No data
1049377020_1049377026 -8 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377026 8:142294142-142294164 GAGGATGCAGAGTGGCCAGAGGG No data
1049377020_1049377029 2 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377029 8:142294152-142294174 AGTGGCCAGAGGGAAGGTGGAGG No data
1049377020_1049377025 -9 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377025 8:142294141-142294163 AGAGGATGCAGAGTGGCCAGAGG No data
1049377020_1049377030 3 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049377020 Original CRISPR GCATCCTCTGAGGTCCGCAG GGG (reversed) Intronic
901025623 1:6277350-6277372 GCATCCTCCCAGGTTGGCAGCGG - Intronic
901094966 1:6671147-6671169 GCATCCTCTGAGCTATGTAGAGG - Intronic
901443260 1:9292461-9292483 GCCTCCTCTGAAGTGCCCAGCGG - Intergenic
903077950 1:20786797-20786819 GCATGCTCCGAGGCCCGCCGCGG - Intronic
904326989 1:29732982-29733004 GATTCCTCAGAGGTCCCCAGTGG + Intergenic
907150789 1:52285483-52285505 GCCTCCTCTCAGATCAGCAGCGG + Intronic
907330751 1:53669632-53669654 GCAGCCTATAAGGTCCACAGGGG - Intronic
911014790 1:93320720-93320742 GCATCCTATCAGATCAGCAGAGG - Intergenic
920536164 1:206737831-206737853 GCAGCCTCTTAGGGCCCCAGAGG + Intergenic
923618406 1:235556971-235556993 GCCTCCTGTGAGATCAGCAGCGG - Intronic
924202050 1:241670690-241670712 GCCTCCTCTCAGATCAGCAGTGG + Intronic
1071443989 10:85729239-85729261 GCTTCCTCTGAGGACCAGAGGGG - Intronic
1072677685 10:97480454-97480476 GCATGCTTTGAGGTCCTGAGGGG - Intronic
1075393710 10:122112400-122112422 GCACACTCTGAAGTCGGCAGAGG - Intronic
1076522094 10:131087746-131087768 GCATGCTCTGACGTGCGGAGGGG + Intergenic
1076978986 11:195399-195421 GCAGCCTCTGAGGTCAGCCAGGG + Intronic
1077296850 11:1830407-1830429 GCTTCCTCTGAGGTCGCCTGGGG - Intronic
1077449692 11:2631756-2631778 CCATCAGCTGAGGTCAGCAGTGG + Intronic
1078903440 11:15662634-15662656 GAATTCTCTGATGTCCCCAGTGG + Intergenic
1078959718 11:16250131-16250153 GCCTCCTGTGAGATCAGCAGTGG + Intronic
1079263807 11:18910771-18910793 GCATCTTCTGGGATCCACAGAGG + Intergenic
1080840682 11:35980979-35981001 GCCTCCCCTGGGGTCAGCAGTGG - Intronic
1083945560 11:65920866-65920888 TCATCCTGTGAGCACCGCAGAGG - Exonic
1084071050 11:66735108-66735130 GCATCACCTGAGGTCAGGAGTGG + Intergenic
1084091561 11:66882369-66882391 GCAGCCTCAGAGGGCAGCAGTGG + Intronic
1084588553 11:70077643-70077665 GCATCCTCTGAGGTGGGGCGGGG - Intergenic
1084955995 11:72691982-72692004 GCCTCCTGTTAGGTCAGCAGCGG - Intronic
1085030957 11:73270625-73270647 GCTTCCTCTGTGGTCCAGAGAGG - Intronic
1085591331 11:77764107-77764129 GCTTCCTCTGAGATCAGCTGCGG - Intronic
1086863763 11:91955133-91955155 AAATCCTCTGAGTTCCCCAGCGG + Intergenic
1090667861 11:128926849-128926871 GGTGCCTCTCAGGTCCGCAGGGG - Intergenic
1092147981 12:6227953-6227975 GAATCCTGTGAGGTTCCCAGAGG - Intronic
1092619826 12:10251824-10251846 GCTTCCTGTCAGGTCCGCAGAGG - Intergenic
1096687783 12:53300132-53300154 GCATCCTGCGAGGTACACAGGGG - Exonic
1100980297 12:100157815-100157837 GCATCCTCTGAGGCCCCCCAAGG - Intergenic
1101675776 12:106914868-106914890 GCCTTCTCTGAGATCCACAGGGG - Intergenic
1103427895 12:120854191-120854213 GCCTCCTGTGAGGTGGGCAGAGG + Intronic
1112133821 13:96553292-96553314 ACATCCTCTGAGGGCTCCAGTGG + Intronic
1114373279 14:22113571-22113593 GCCTCCTGTGAGATCAGCAGTGG - Intergenic
1116238847 14:42314687-42314709 GCTTCCTATGAGATCAGCAGTGG + Intergenic
1120671575 14:87368386-87368408 GCCTCCTGTCAGGTCAGCAGTGG - Intergenic
1121267800 14:92615619-92615641 ACATCCTCTGTGGTTCCCAGAGG - Intronic
1122071698 14:99209337-99209359 GCCTCCACTGACATCCGCAGGGG + Intronic
1123980168 15:25594966-25594988 GCATCCTGTCAGATCAGCAGAGG + Intergenic
1124070752 15:26391014-26391036 GCCTGCTCTGAGGTCCACGGTGG + Intergenic
1125809373 15:42524462-42524484 GCCTCCTCTCAGATCAGCAGTGG + Intronic
1128669287 15:69562374-69562396 GAATCCTCTGAGGTGGGCAGGGG + Intergenic
1131997632 15:98147428-98147450 CTATCCTCTGAGGTCTGAAGGGG + Intergenic
1133728433 16:8558301-8558323 GCACCCTCTGAGGACTCCAGTGG + Intergenic
1136353406 16:29727283-29727305 GAATCCTCTGAAGTCCTCTGGGG + Intergenic
1137332412 16:47512025-47512047 GCCTCCTCTCAGATCAGCAGTGG - Intronic
1140037731 16:71383841-71383863 GCTTCCTCTGAGGTCCGTAGGGG - Intronic
1140926638 16:79590056-79590078 CCACCCTCTGAGGTCCCCCGAGG - Intronic
1141763612 16:86044707-86044729 TCATTCTCTGAGGTCGTCAGTGG + Intergenic
1142466476 17:140217-140239 GCAGCCTCTGAGGTCAGCCAGGG + Intergenic
1143379854 17:6489237-6489259 CCAACCTCTGGGGTCCACAGGGG + Intronic
1144231168 17:13205476-13205498 GAATTCTTTGAGGTCTGCAGTGG + Intergenic
1146921355 17:36714753-36714775 TCATCCTCTGAGGTCCTTTGAGG - Intergenic
1150368552 17:64614047-64614069 GCCTCCTCTCAGATCAGCAGCGG - Intronic
1151170204 17:72239369-72239391 GCAGCCTGTGAGGTTCACAGGGG - Intergenic
1151239022 17:72743466-72743488 CCTTCCTCTCAGGTCTGCAGTGG + Intronic
1152629203 17:81402196-81402218 GCGTTCTCTTCGGTCCGCAGGGG - Intronic
1154410759 18:14140997-14141019 TCATTCTCTGAGGGCCCCAGAGG + Intergenic
1155668768 18:28344156-28344178 GCCTCCTGTGAGATCAGCAGTGG - Intergenic
1156432853 18:37094176-37094198 GCCTCCTGTGAGATCAGCAGTGG - Intronic
1157666543 18:49492247-49492269 TCGGCCTCTGAGGTCCGCAGAGG - Intronic
1160048017 18:75405924-75405946 GCCTCCACTAAGGTCCTCAGAGG - Intergenic
1161280130 19:3441533-3441555 GCAGCCTCTGAAGTCCCAAGGGG + Intronic
1161441855 19:4296460-4296482 GCAGCCTCTGAGGTTGGCAGGGG + Intronic
1161627514 19:5335871-5335893 GCACCCTCTGCGCCCCGCAGAGG - Intronic
1162478758 19:10915951-10915973 GCCTCAACTGAGGTCCCCAGCGG + Intronic
1163589717 19:18185667-18185689 GCTCCCTCTGGGGTCTGCAGGGG - Intergenic
927577614 2:24212586-24212608 GGATGCGCTGAGGTCCACAGAGG - Intronic
929060248 2:37916634-37916656 TCAACCTCTGAGGTAGGCAGAGG - Intergenic
929111134 2:38406110-38406132 GCCTCCTGTTAGGTCAGCAGTGG - Intergenic
931515104 2:63046093-63046115 CCATCCTCTGAGGAAAGCAGAGG - Exonic
932351680 2:71037771-71037793 GGATCCTCTGAGGTTCTCGGAGG - Intergenic
933157887 2:78994235-78994257 GCATCCCCTGAGGCCGGAAGAGG - Intergenic
935019011 2:99212580-99212602 GCATCCTGTCAGATCAGCAGCGG - Intronic
935591814 2:104852141-104852163 GCAACCTTTGGGGGCCGCAGAGG + Intergenic
936125963 2:109789492-109789514 ACATGCTCTGAGGTCAACAGTGG - Intergenic
936218730 2:110581976-110581998 ACATGCTCTGAGGTCAACAGTGG + Intergenic
938332804 2:130460782-130460804 GCATCTTCTGAGGGCAGCAAGGG + Exonic
938357004 2:130659889-130659911 GCATCTTCTGAGGGCAGCAAGGG - Intergenic
944100148 2:196016571-196016593 CCATTCTCTGAAGTCAGCAGAGG + Intronic
946958396 2:224957184-224957206 GCAACTTCTGAGGACCTCAGTGG - Intronic
948911170 2:241003370-241003392 GCATCCTCTGGCCTCAGCAGGGG - Intronic
1168974894 20:1957349-1957371 GCATCCTCTAAGTTTAGCAGAGG - Intergenic
1172826470 20:37791682-37791704 GCCTCCTATAAGGTCAGCAGTGG + Intronic
1174165586 20:48581458-48581480 GAATCCTGTGAAGTCCTCAGGGG + Intergenic
1174177207 20:48652621-48652643 GCCTCCACTGAGGACCCCAGTGG - Exonic
1174298933 20:49568261-49568283 GGGCCCTCCGAGGTCCGCAGGGG + Intergenic
1175189150 20:57199530-57199552 GCATCCTCTGAGATCCCCCACGG + Intronic
1175491936 20:59385241-59385263 GCATCCTCTGTATTCTGCAGAGG + Intergenic
1175754698 20:61522171-61522193 CCGTCCTCTGAGGTCCTCAGGGG + Intronic
1175926630 20:62474475-62474497 GGCTCCTCTGAGCTCCGCAGGGG - Intronic
1175953747 20:62597480-62597502 GCATCCTCTGAGGGCCCCTTCGG - Intergenic
1177278053 21:18941795-18941817 GCCTCCTGTGAGATCAGCAGTGG + Intergenic
1180055449 21:45356691-45356713 GCACACGCTGAGGTCCACAGTGG + Intergenic
1180183933 21:46130284-46130306 ACAACCTCTGCGGTCCTCAGAGG + Intronic
1180183934 21:46130288-46130310 CAGTCCTCTGAGGACCGCAGAGG - Intronic
1181378173 22:22477206-22477228 GCATCCCATGAGGCCAGCAGTGG + Intergenic
1182440912 22:30363284-30363306 GCATTCTGTGTGGGCCGCAGGGG + Intronic
1183183560 22:36278132-36278154 GCCTCCTATGGGGTCCCCAGGGG - Intergenic
1183452713 22:37905769-37905791 GGGTGCTCTGAGGTCTGCAGGGG + Intronic
1184310145 22:43636006-43636028 GAATACTCTGAGATCAGCAGAGG - Intronic
1184544999 22:45161891-45161913 GCATCACCTGAGGTCAGGAGTGG - Intergenic
1185085345 22:48737848-48737870 GCAGCCTCTGAGGTCAGAGGTGG + Intronic
952834631 3:37592531-37592553 GCCTCCTCTGAGGCCGGCTGTGG - Intronic
953238787 3:41129420-41129442 TCATTCTCTGAGGTCCACAGTGG - Intergenic
954634404 3:52063753-52063775 TCATCCTCTGAGGGCCACAGTGG + Intergenic
961564796 3:127755625-127755647 GCATTCTCTGGGGCCCGCAGTGG - Intronic
963007671 3:140741113-140741135 GCTGTCTCTGAGGTCAGCAGAGG - Intergenic
963113575 3:141706935-141706957 GCAGCCTCAGAGGTACCCAGAGG + Intergenic
966252285 3:177879478-177879500 GCATCCTCTAAGGAACACAGTGG + Intergenic
966600087 3:181766350-181766372 GCATCCTGTGAGGTCCCATGGGG - Intergenic
967479026 3:189953281-189953303 CCAGCCTCGGAGGTCAGCAGTGG + Intergenic
968054622 3:195681868-195681890 GCATCCACTGATGCCAGCAGTGG + Intergenic
968101269 3:195967290-195967312 GCATCCACTGATGCCAGCAGTGG - Intergenic
968844780 4:3034732-3034754 GCCTCATCTGAGGTCCTTAGTGG + Intronic
973927120 4:55749604-55749626 CCACACTCTGAGGTCAGCAGGGG - Intergenic
979095669 4:116546927-116546949 GCATCCTGTCAGATCAGCAGTGG - Intergenic
984951289 4:185009593-185009615 GCTTCCTCTGAGGTCTTTAGGGG - Intergenic
985501683 5:251671-251693 GCATCCACTGATGCCAGCAGTGG + Intronic
985735194 5:1575955-1575977 GCATCCACTGATGCCAGCAGTGG - Intergenic
994643502 5:102440314-102440336 GCATCCTGTTAGATCAGCAGCGG + Intronic
995767015 5:115629614-115629636 TCATCCTCAGAGGTCCACTGGGG + Intronic
999171453 5:149598905-149598927 GCATCCTCTGAGGTGCCCCTTGG + Intronic
1004491259 6:16118624-16118646 GCCTCCTGTGAGATCAGCAGTGG - Intergenic
1005862648 6:29913344-29913366 GCATCCTCTCAGCTCAGCACGGG - Intergenic
1007783530 6:44267467-44267489 GCAGCCTTTGAGGACCGGAGAGG - Intergenic
1010570081 6:77464563-77464585 GCAAGCTCTGATGTCCGTAGAGG - Intergenic
1016685435 6:146876688-146876710 GGAGGCTCTGAGGTCAGCAGAGG - Intergenic
1018596268 6:165484419-165484441 GCCTCCTGTCAGGTCAGCAGTGG + Intronic
1022499559 7:30873950-30873972 GCCTCCTCTGATGGCCGCAGAGG - Intronic
1023668654 7:42553180-42553202 GCATCCTATCAGATCAGCAGTGG - Intergenic
1023817467 7:43961781-43961803 GGATGCTCTGAGGTCCTCAGAGG - Intergenic
1024967073 7:55033424-55033446 GCATCCCCTGCAGTCCCCAGGGG - Intronic
1026928758 7:74211153-74211175 GGACCCTCTGAGGCCCCCAGGGG - Intronic
1028102567 7:86839178-86839200 GCATCCAGTTAGGTCTGCAGTGG - Exonic
1028700943 7:93778542-93778564 GCAACCGCTGAGGTCAGCACAGG - Intronic
1029116917 7:98242312-98242334 GCAGCCCCTGAGGGCAGCAGAGG - Intronic
1029495618 7:100894499-100894521 GCACCCTCTCTGCTCCGCAGGGG + Intronic
1029742092 7:102496655-102496677 GGATGCTCTGAGGTCCTCAGAGG - Intronic
1029760081 7:102595820-102595842 GGATGCTCTGAGGTCCTCAGAGG - Intronic
1031759370 7:125692441-125692463 GCCTCCTCTCAGGTCAGCAGTGG + Intergenic
1033221436 7:139528822-139528844 GCTTCCTCTGACCTCTGCAGGGG - Intronic
1033941664 7:146662357-146662379 GGATCAACTGAGGTCCGGAGTGG - Intronic
1035081477 7:156219845-156219867 GCATCCTCAGAGGCCCAGAGGGG - Intergenic
1035171329 7:157019012-157019034 GCCTCCCCCGAGGTTCGCAGAGG + Intergenic
1035276714 7:157752344-157752366 CCATCCTCTGAGAGCCCCAGAGG + Intronic
1037253462 8:16924084-16924106 GCCTCCTGTGAGATCAGCAGTGG - Intergenic
1037909302 8:22734189-22734211 CCAGGCTCTGAGGTCCCCAGGGG + Intronic
1039776903 8:40746137-40746159 CTCTCCTCTGAGCTCCGCAGAGG + Intronic
1040570137 8:48601014-48601036 GGATCTTCTGAGGTCAGGAGTGG - Intergenic
1042177107 8:66047760-66047782 CCATACTCTGAGCTCCTCAGGGG - Intronic
1045413268 8:101941363-101941385 GCCTCCTGTCAGATCCGCAGTGG - Intronic
1049377020 8:142294127-142294149 GCATCCTCTGAGGTCCGCAGGGG - Intronic
1052325231 9:27210530-27210552 GCATTCTCTTAGATCTGCAGTGG - Intronic
1053153070 9:35755044-35755066 GCATCCTCTGAGTTTCCCACAGG + Exonic
1053550976 9:39078914-39078936 GCAGCCTCTGAGGACAGAAGGGG + Exonic
1053815085 9:41898993-41899015 GCAGCCTCTGAGGACAGAAGGGG + Exonic
1054615511 9:67288448-67288470 GCAGCCTCTGAGGACAGAAGGGG - Intergenic
1057497862 9:95574706-95574728 GCATCGTCTGCGGGACGCAGAGG - Intergenic
1058167209 9:101633591-101633613 GCCTCCTGTAAGGTCAGCAGCGG + Intronic
1060992680 9:127857790-127857812 GCCTCCTCTGACCTCTGCAGGGG - Intergenic
1187887788 X:23905576-23905598 GCCTTCTCTGAAGTCCCCAGGGG + Intronic
1190876162 X:54461739-54461761 GGATTCTCTGAGTTCCCCAGAGG - Intronic
1194786248 X:98087481-98087503 GCATCCTGTGAGATCAGCGGTGG - Intergenic
1199619422 X:149686132-149686154 ACATCCTCTGAAGTAGGCAGAGG - Intergenic