ID: 1049377022

View in Genome Browser
Species Human (GRCh38)
Location 8:142294129-142294151
Sequence CTGCATCCTCTGAGGTCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 188}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049377022_1049377030 1 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG No data
1049377022_1049377029 0 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377029 8:142294152-142294174 AGTGGCCAGAGGGAAGGTGGAGG No data
1049377022_1049377027 -6 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377027 8:142294146-142294168 ATGCAGAGTGGCCAGAGGGAAGG No data
1049377022_1049377028 -3 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG No data
1049377022_1049377033 11 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377033 8:142294163-142294185 GGAAGGTGGAGGGCGGTGTGAGG No data
1049377022_1049377035 16 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377035 8:142294168-142294190 GTGGAGGGCGGTGTGAGGAAGGG No data
1049377022_1049377036 25 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377036 8:142294177-142294199 GGTGTGAGGAAGGGCACCAGAGG No data
1049377022_1049377034 15 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377034 8:142294167-142294189 GGTGGAGGGCGGTGTGAGGAAGG No data
1049377022_1049377026 -10 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377026 8:142294142-142294164 GAGGATGCAGAGTGGCCAGAGGG No data
1049377022_1049377031 4 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377031 8:142294156-142294178 GCCAGAGGGAAGGTGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049377022 Original CRISPR CTGCATCCTCTGAGGTCCGC AGG (reversed) Intronic
901526452 1:9825681-9825703 CAGCATGCCCTGAGGTCAGCTGG - Intergenic
902043793 1:13510991-13511013 CTGCACCCTGTGAGGTGCCCTGG + Intronic
902612097 1:17603344-17603366 CGGCATCCCCTGAGGGCAGCTGG + Intronic
904377949 1:30093629-30093651 CTGCATTACCTGAGGTCCACAGG - Intergenic
904896543 1:33822304-33822326 CTGCATCCTCACAGGTACCCAGG - Intronic
905257803 1:36696305-36696327 CTGCCTCATCTCAGGTCTGCAGG + Intergenic
905918079 1:41699650-41699672 CTGCATCCTTTCAGGTCCCCGGG - Intronic
907330753 1:53669634-53669656 CTGCAGCCTATAAGGTCCACAGG - Intronic
907827031 1:58027926-58027948 CTGCATGCTTTGAGGACTGCTGG + Intronic
912496406 1:110094837-110094859 CAGCATCATCTGAGGGCCCCAGG - Intergenic
917339605 1:173961717-173961739 CAGCATACTCTGAGGTACGAAGG + Exonic
923419181 1:233795863-233795885 CTGCTTCTTCTGAGGACCTCAGG + Intergenic
1062955702 10:1538942-1538964 CTGCACCCTCTGAGACCCACAGG - Intronic
1064245756 10:13666458-13666480 CTGCACCCACTGAAGTCCCCAGG + Intronic
1064368594 10:14730513-14730535 CTGCATTCTCTCAGCTCCGCTGG - Intronic
1065020163 10:21496401-21496423 CCGCCACCTCTGAGGTCCCCGGG + Intronic
1067085276 10:43234845-43234867 CTGCCTCCTCAGGGGTCCGAGGG + Intronic
1067802861 10:49371264-49371286 CTTCATCCTCTGGGGTTCCCAGG + Intronic
1069870670 10:71530930-71530952 ATGCATATTCTGAGGTCTGCTGG - Intronic
1070162102 10:73873059-73873081 GTGCTTTCTCTGTGGTCCGCAGG - Exonic
1072222173 10:93335723-93335745 CTGCAGCCTCTGAGGGATGCTGG - Intronic
1072222189 10:93335802-93335824 CTGCAGCCTCTGAGGGATGCTGG - Intronic
1072440196 10:95447391-95447413 CTGCAACCTCTGAGGCCTCCTGG - Intronic
1072448619 10:95520805-95520827 CTGCATTCTCTTAGGCCCCCAGG - Intronic
1073564368 10:104522525-104522547 CTGCCTCCTCTGAGGACCAGAGG - Intergenic
1074679158 10:115886122-115886144 CTGCATACTATGAGGTCCTTTGG - Intronic
1074783046 10:116815916-116815938 CTCCTTCCTCTTAGGGCCGCGGG - Intergenic
1075210132 10:120483857-120483879 CTGCATCTGCTGAGGGCCTCAGG - Intronic
1075316629 10:121458556-121458578 CTGCAGCCTGTGGGATCCGCAGG - Intergenic
1075715227 10:124551683-124551705 CTGCAGCCCCTGAGACCCGCGGG + Intronic
1076804767 10:132849848-132849870 CTGCAGCTTCTGAGCTCCCCAGG + Intronic
1077098846 11:812255-812277 CTCCACCCTCAGAGGTCCACTGG - Intronic
1077337653 11:2012603-2012625 CTGGATCCTCCGAGGCCCGCAGG + Intergenic
1077846006 11:6025627-6025649 CCACATCCTCTGAGGTCCTATGG + Intergenic
1078406587 11:11075249-11075271 CTGCATCCTCGGACGTCACCTGG + Intergenic
1079137985 11:17787140-17787162 GTCCATTCTCTGAGGTCCTCCGG + Intergenic
1080646722 11:34193121-34193143 CTCCTTCCTCTGAGGTCTGGAGG - Intronic
1084588555 11:70077645-70077667 CCGCATCCTCTGAGGTGGGGCGG - Intergenic
1084686385 11:70698291-70698313 CTGCCTTCTCTGTGGTCCTCGGG - Intronic
1089463607 11:118668087-118668109 CTGGATCATCTGAGGTCAGAAGG - Intronic
1091312384 11:134583982-134584004 CTGCAGTCTCTGAGGGCAGCAGG + Intergenic
1202820637 11_KI270721v1_random:67785-67807 CTGGATCCTCCGAGGCCCGCAGG + Intergenic
1094552084 12:31462381-31462403 CTGAAACCCCTGAGGTCGGCTGG + Intronic
1096638354 12:52975490-52975512 CTGCATTCTCTGAGGCCCCCAGG + Intergenic
1096687785 12:53300134-53300156 CTGCATCCTGCGAGGTACACAGG - Exonic
1098296930 12:69013251-69013273 CTGCATCTGGTGAGGTCCTCAGG - Intergenic
1102086606 12:110146034-110146056 GTGCATCATCTGAGGTCAGGAGG - Intronic
1103294097 12:119871280-119871302 CTTCATCCTGTGATGTCAGCTGG - Intronic
1103356617 12:120326126-120326148 CTGCCTCCTCTGAAGACCGTTGG + Intronic
1104519624 12:129461323-129461345 CTGCATCCCCTGAGATTCTCAGG - Intronic
1104745332 12:131206975-131206997 GTGCATCCTCTGAAGGCAGCAGG + Intergenic
1104789007 12:131470131-131470153 GTGCATCCTCTGAAGGCAGCAGG - Intergenic
1104931853 12:132343914-132343936 GTGCATCCTCTGGGGTCCTCAGG + Intergenic
1105639520 13:22247934-22247956 CTGCATCCCCTGTGCTCCTCTGG + Intergenic
1105805318 13:23948788-23948810 CTGCATCCTCTGTGAGCCTCAGG - Intergenic
1106332235 13:28749770-28749792 CTGCATCTGGTGAGGCCCGCAGG - Intergenic
1108324224 13:49314133-49314155 CTGCAGGCTCTGAGGTGGGCGGG + Intronic
1110068639 13:71143549-71143571 CTGCATCTGGTGAGGTCCTCTGG - Intergenic
1110546093 13:76757051-76757073 CTGCATAGTCTGAGGTACACAGG + Intergenic
1113917071 13:113880826-113880848 CTGGATGCTCTGTGGTCCGGGGG + Intergenic
1119599059 14:75962489-75962511 CGGCATCCTCTGAGGCCAGATGG + Intronic
1121122295 14:91383525-91383547 CTGCCTCCTCGGAGGTCGCCAGG + Intronic
1123138100 14:106049255-106049277 CTGCAGCCTCTAAGTTCCACAGG + Intergenic
1123154274 14:106209464-106209486 CTGCAGGCTCTGAGGTGCACAGG + Intergenic
1123192565 14:106585371-106585393 CTGCAGGCTCTGAGGTGTGCAGG + Intergenic
1123215800 14:106808236-106808258 CTGCAGCCTCTGAGGTGTGCAGG + Intergenic
1123631431 15:22262851-22262873 GAGCATCCTCTGTGGACCGCTGG + Intergenic
1123811884 15:23935245-23935267 CTGCATCTTTTGAGGGCCTCAGG - Intergenic
1127242557 15:57133457-57133479 CTGCCCCCTCCGAGGTCCTCAGG + Intronic
1129346672 15:74925223-74925245 CTGCAACCTCCGAGGTCTCCTGG - Intronic
1129798648 15:78397017-78397039 CTGCCTCCTCTGAGGAACCCGGG - Intergenic
1130168216 15:81484868-81484890 TTGCATCACCTGAGGTCAGCGGG + Intergenic
1131801279 15:96071804-96071826 TTGCATCCTCTGGGCTCCGTAGG - Intergenic
1131997630 15:98147426-98147448 CTCTATCCTCTGAGGTCTGAAGG + Intergenic
1132346287 15:101111085-101111107 CAGCATCCTGTGGGGTCAGCTGG - Intergenic
1132546393 16:535277-535299 CTGCGGCCACTGAGGTCTGCTGG - Intronic
1132733122 16:1372711-1372733 CTGCAGCCGCTGCGGTCCTCTGG - Intronic
1132737236 16:1392994-1393016 CAGCAGACTCTGAGGGCCGCTGG + Intronic
1132903530 16:2270963-2270985 CTCCATCCTCTGTGGCCCGGTGG + Intergenic
1132945096 16:2528076-2528098 CAGCATCCTCTGCCGCCCGCAGG - Exonic
1134750968 16:16624721-16624743 CTGGCTCCTCTGAGGTCCCCAGG - Intergenic
1134994486 16:18728870-18728892 CTGGCTCCTCTGAGGTCCCCAGG + Intergenic
1135023809 16:18984033-18984055 CGGCAGCCTCTGAGGAGCGCGGG + Exonic
1135396846 16:22138250-22138272 CTGGAACCTCTGATGTCCCCTGG - Intronic
1136045894 16:27614704-27614726 CTGCAACCTCTGAGTTTCACTGG - Intronic
1136268934 16:29137148-29137170 GTGCACCCTCTGAGGGCCCCGGG - Intergenic
1136353404 16:29727281-29727303 CTGAATCCTCTGAAGTCCTCTGG + Intergenic
1138228853 16:55323696-55323718 CTGCAGCCCCTGCGCTCCGCTGG - Intergenic
1138545471 16:57716778-57716800 CTGCAGCCTCTGATTTCCTCTGG + Intronic
1140037733 16:71383843-71383865 ATGCTTCCTCTGAGGTCCGTAGG - Intronic
1141082597 16:81065532-81065554 CTGCAGCCTGTGGGGTCCACAGG - Intronic
1141533887 16:84665720-84665742 GTCCATCCTCTGAGGTCCAGGGG + Intronic
1141971580 16:87487620-87487642 GCGCATCCTCTGTGGACCGCTGG - Intronic
1142149592 16:88506743-88506765 CTGGACCCTCTGAGGGGCGCTGG + Intronic
1143515710 17:7418289-7418311 CTCCATCCTCTGTGGTCTGGTGG - Exonic
1143962061 17:10729508-10729530 CCGCTTCTTCTGAGGTCCCCTGG + Intronic
1144603720 17:16644131-16644153 CTGCATCTTGTGAGGGCCTCAGG - Intronic
1146173162 17:30648275-30648297 CTGCAGCCTGTGGGGTCCTCTGG + Intergenic
1146346624 17:32064307-32064329 CTGCAGCCTGTGGGGTCCTCTGG + Intergenic
1149984234 17:61335180-61335202 CTGCTTCCACTAAAGTCCGCAGG + Intronic
1151170206 17:72239371-72239393 CTGCAGCCTGTGAGGTTCACAGG - Intergenic
1151787063 17:76280175-76280197 CTGCTTCCTTAGAGGTCCCCTGG - Intronic
1157841769 18:50965941-50965963 CTGCCTCCTGTCAGGTCAGCTGG + Intergenic
1158202985 18:54960371-54960393 CTGCATCCTCTCAGGGACGATGG + Intergenic
1160198144 18:76774066-76774088 CTGCTTCCTCTGAAGGCTGCAGG + Intergenic
1160516003 18:79479685-79479707 CTGCATCCTCATAGGCCAGCGGG + Intronic
1161441853 19:4296458-4296480 TTGCAGCCTCTGAGGTTGGCAGG + Intronic
1162989256 19:14291786-14291808 CTGCAGCCTGTGGGGTCCTCTGG - Intergenic
1163493344 19:17630264-17630286 GGGCATGCTCTGAGGTCTGCTGG + Exonic
1163589719 19:18185669-18185691 CTGCTCCCTCTGGGGTCTGCAGG - Intergenic
1163777210 19:19225527-19225549 CTGTATCTCCTGAGGTCCGGAGG + Intronic
1165160550 19:33813221-33813243 CAGCATCCTCTGAGGCCCCGGGG + Exonic
1166108155 19:40607652-40607674 CAGCAGCCTCTGAGACCCGCAGG + Intronic
925169945 2:1744242-1744264 CTCCATCCTGTGAGTGCCGCGGG - Exonic
925434649 2:3826634-3826656 CTGCATCTTCTGAGGTTCGAAGG + Intronic
926060520 2:9801929-9801951 CTGCGGGCTCTGAGGTCTGCGGG - Intergenic
927878486 2:26674410-26674432 CAGCACCCACTGAGGTTCGCCGG - Intergenic
928413366 2:31071363-31071385 CTGGATGCTCTGATGTCCTCCGG - Intronic
928483223 2:31704692-31704714 CTGCCTCCTCTGATGTCCTGAGG + Intergenic
931789825 2:65654787-65654809 CTGCATGCTCTGAGTTACCCAGG - Intergenic
933835219 2:86240472-86240494 CTGCATCCTCTGAAGCGGGCGGG + Intronic
934974553 2:98791594-98791616 CTGCATCCTATGAGGGCCTAGGG - Intergenic
938696452 2:133839701-133839723 CTGCAACCTCTGAGGCCTCCCGG - Intergenic
939381310 2:141440407-141440429 ATGGCTCCTCTGCGGTCCGCAGG - Intronic
942090403 2:172484308-172484330 CTGCATCCTCACAGGCCCTCAGG + Intronic
948371353 2:237491427-237491449 CTGCAGCATCTGAGGGCCGAGGG + Intronic
1170481467 20:16769261-16769283 CTGCATCTGCTGAGGGCCTCAGG + Intronic
1172596858 20:36155734-36155756 ATGCATCCTCAGAGCTCCGAGGG - Intronic
1175490794 20:59380053-59380075 CTTCATCCTCAGAGCTCTGCAGG + Intergenic
1175754695 20:61522169-61522191 CTCCGTCCTCTGAGGTCCTCAGG + Intronic
1176057341 20:63155678-63155700 CTTCCTCCTCTGAGGCCTGCAGG - Intergenic
1176187498 20:63789246-63789268 CTGTAACCTCTCAGGTCCCCAGG + Intronic
1178598468 21:33975862-33975884 CTGCATCCTCTGGGGTTCTCAGG + Intergenic
1178912818 21:36689968-36689990 ATGCATCTTCTGAAGTCCTCGGG - Intergenic
1179286919 21:39985364-39985386 CTGCATCATCTGGGGCCCACAGG + Intergenic
1179346000 21:40557709-40557731 CTGCATCCAGTGAGGGCCTCAGG - Intronic
1179732758 21:43376600-43376622 CTGCCTCCTCTGAGCTCTGCAGG + Intergenic
1181086133 22:20440248-20440270 CAGAAACCTCTGAGGTCTGCAGG + Intronic
1182608755 22:31528755-31528777 CTGCATCCTTTGGGATCCGGAGG + Exonic
1183315044 22:37132395-37132417 CTCCATGCTCTGAGCTCAGCTGG + Exonic
1183439162 22:37813465-37813487 CTGCGTCCTCTGGGGTCAGCAGG - Exonic
1184271705 22:43388203-43388225 CTGCAGGCTCTGAGGACCGGCGG - Intergenic
1184521308 22:44995875-44995897 CTGCATCGTCTGGGGCCCGGCGG - Intronic
1184929431 22:47670072-47670094 CTGTGTGCTCTGAGGTCCTCAGG + Intergenic
1185130223 22:49034804-49034826 CAGCAACCCCTGAGGTCTGCAGG - Intergenic
949462278 3:4305424-4305446 CTGCTCCCTCTGAAGTCAGCTGG - Intronic
949705689 3:6814131-6814153 CTGCATCTTGTGAGGGCCTCAGG + Intronic
952731667 3:36643415-36643437 CTGCTTCCGATGAGGGCCGCAGG + Intergenic
954976951 3:54704974-54704996 CTGCATTCTCTGAGCTCTGCTGG + Intronic
955551302 3:60088019-60088041 CTGCATCTGCTGAGGGCCCCTGG + Intronic
957043684 3:75357390-75357412 CTGGATCCTCTGAGATTCCCAGG + Intergenic
965544289 3:169899565-169899587 CTGCTTCCTCTCAGTTCCTCTGG - Intergenic
966600089 3:181766352-181766374 ATGCATCCTGTGAGGTCCCATGG - Intergenic
966920218 3:184606221-184606243 CTGCTTCCTGTGGGGTCCTCTGG + Intronic
968939230 4:3629421-3629443 CTGCAGCCTCTGAGCTCATCTGG + Intergenic
969363017 4:6677142-6677164 CTGAATCCTCTCATGTCCACAGG - Intergenic
969603367 4:8189776-8189798 CTGCTTTCACTGAGGTCCCCAGG - Intronic
969940249 4:10724851-10724873 AAGCCTCCTCTGAGGTCTGCTGG - Intergenic
970438390 4:16057817-16057839 CTGTTTCCTCTTAGGTCCCCGGG - Intronic
971575136 4:28263280-28263302 CTGCATCTTCTGAGGGCCTCAGG - Intergenic
972391492 4:38617904-38617926 CTGTATCCTCTCAGCTCCTCAGG - Intergenic
975885829 4:78963573-78963595 CTTCTCCCTCAGAGGTCCGCCGG - Intergenic
976332804 4:83851561-83851583 CTGCTTTCTCAGAGGTCGGCTGG + Intergenic
984081490 4:175253910-175253932 CTGCAACCTTTGAGGTCCAGTGG - Intergenic
984524366 4:180840357-180840379 CTGCTTTCTCAGAGGTCTGCAGG + Intergenic
987205875 5:15625012-15625034 CTGCATCCGGTGAGGACCTCTGG - Intronic
992492146 5:77255630-77255652 TTGCAGCCACTGAGGTCCTCTGG + Intronic
992740710 5:79770612-79770634 CTGCATCCACTGAGATGAGCTGG + Intronic
993596579 5:89864096-89864118 CTCCATGCTCTTAGGTCCTCTGG - Intergenic
993916915 5:93755484-93755506 CTGCATCCTCTCAGGATTGCTGG - Intronic
1000318417 5:160115060-160115082 CTGCATCCTCTGCGCCCCACCGG - Intronic
1002056466 5:176600507-176600529 CTGCAAGCTCTGATGTCCGGGGG + Intronic
1002863385 6:1099924-1099946 TGGCATCCTCTGAGGACTGCAGG + Intergenic
1004359162 6:14955697-14955719 CTTCCTCCTTTGAGGTCCTCAGG - Intergenic
1005622936 6:27636786-27636808 CTGCCTCCTGTCAGGTCAGCCGG + Intergenic
1010124704 6:72418743-72418765 CTGCACCCTCTGAGGCGAGCAGG - Intergenic
1013780974 6:113727983-113728005 CTGCATCCTGTGATGTCCTTGGG + Intergenic
1014398734 6:120960441-120960463 CTGGATTCTCTGAAGTCCTCTGG - Intergenic
1018396984 6:163385773-163385795 GTGGATCATCTGAGGTCCGGAGG + Intergenic
1019069553 6:169332262-169332284 CTGCATCATCTTATGTCTGCAGG - Intergenic
1019362747 7:613905-613927 CTGCACCCTCTTGGCTCCGCAGG - Intronic
1019598041 7:1867434-1867456 CAGCTTCCTCTGGGGGCCGCAGG + Intronic
1020058754 7:5136574-5136596 CTTCAGCCTCTGAGGTTCTCGGG + Intergenic
1022813332 7:33890260-33890282 CTGCATCCTTTGACTTCAGCTGG - Intergenic
1024563916 7:50666060-50666082 CTGCATGCTCTGGGATCCCCAGG + Intronic
1026545546 7:71318765-71318787 CTGCATCCTAAGAGGTCCTAAGG - Intronic
1027145167 7:75688890-75688912 CTTTGTCCTCTGAGGTCCCCTGG + Intronic
1028972192 7:96871578-96871600 CTACATCCTGTGAGGGCCTCAGG + Intergenic
1031075983 7:117213112-117213134 CAGCTCCCTCTCAGGTCCGCTGG + Intronic
1032080388 7:128855733-128855755 CTGCATCCTCTTCAGGCCGCTGG + Intronic
1032259606 7:130324449-130324471 CTGCCTCATCTGAGGTCTGTAGG - Intergenic
1037110636 8:15160782-15160804 CTGCATCCTCCCAGGTGCTCAGG + Intronic
1038485764 8:27934194-27934216 CTGCACCCTGGGAGGTCCCCAGG - Intronic
1038616542 8:29100929-29100951 TGGCATTCTCTGAGGTGCGCAGG - Intronic
1042490211 8:69389224-69389246 CTGCATCCGGTGAGGGCCTCAGG + Intergenic
1049377022 8:142294129-142294151 CTGCATCCTCTGAGGTCCGCAGG - Intronic
1052868494 9:33481235-33481257 CTGCCTCCTGTGAGATCAGCAGG + Intergenic
1053104311 9:35397169-35397191 GTGCATGCTCTGATGTCTGCTGG - Exonic
1054451523 9:65405900-65405922 CTGCAGCCTCTGAGCTCATCTGG - Intergenic
1056643243 9:88388517-88388539 CTGCAGCCTCGGCGGTCAGCAGG + Exonic
1056943093 9:90971950-90971972 CCGCATCCTCTGAGGTGTGATGG + Intergenic
1060992682 9:127857792-127857814 CTGCCTCCTCTGACCTCTGCAGG - Intergenic
1187880040 X:23838278-23838300 CTGCAGCCTCTGAGGCCTCCCGG - Intronic
1188508643 X:30910574-30910596 CTGCATCCGTTCAGGTCCTCTGG - Intronic
1190265067 X:48823288-48823310 CAGCATCCTCTGAGGTGGTCTGG - Exonic
1195761477 X:108250768-108250790 CAGCAACCTCTGAGGTCTGGGGG + Intronic
1197848787 X:130834231-130834253 CTGCCTCCTCTCAGGTACTCAGG + Intronic