ID: 1049377028

View in Genome Browser
Species Human (GRCh38)
Location 8:142294149-142294171
Sequence CAGAGTGGCCAGAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049377020_1049377028 -1 Left 1049377020 8:142294127-142294149 CCCCTGCGGACCTCAGAGGATGC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG No data
1049377019_1049377028 0 Left 1049377019 8:142294126-142294148 CCCCCTGCGGACCTCAGAGGATG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG No data
1049377021_1049377028 -2 Left 1049377021 8:142294128-142294150 CCCTGCGGACCTCAGAGGATGCA 0: 1
1: 0
2: 3
3: 9
4: 157
Right 1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG No data
1049377022_1049377028 -3 Left 1049377022 8:142294129-142294151 CCTGCGGACCTCAGAGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049377028 Original CRISPR CAGAGTGGCCAGAGGGAAGG TGG Intronic
No off target data available for this crispr