ID: 1049377691

View in Genome Browser
Species Human (GRCh38)
Location 8:142296799-142296821
Sequence CCCCACAGGCTCCCCAGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049377686_1049377691 -1 Left 1049377686 8:142296777-142296799 CCTCAGGGTGGGTCTCGGCGGTC 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG No data
1049377682_1049377691 10 Left 1049377682 8:142296766-142296788 CCAGCAGGGGTCCTCAGGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049377691 Original CRISPR CCCCACAGGCTCCCCAGGAC GGG Intronic
No off target data available for this crispr