ID: 1049377753

View in Genome Browser
Species Human (GRCh38)
Location 8:142297054-142297076
Sequence CTGTGAAGTGGGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 472}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049377753_1049377759 0 Left 1049377753 8:142297054-142297076 CCTTCCACCTGCCCACTTCACAG 0: 1
1: 0
2: 8
3: 44
4: 472
Right 1049377759 8:142297077-142297099 ATGAAATGAATGAGGCAAATCGG No data
1049377753_1049377763 28 Left 1049377753 8:142297054-142297076 CCTTCCACCTGCCCACTTCACAG 0: 1
1: 0
2: 8
3: 44
4: 472
Right 1049377763 8:142297105-142297127 AAGGTCACCCAACCAGTGAGCGG No data
1049377753_1049377758 -8 Left 1049377753 8:142297054-142297076 CCTTCCACCTGCCCACTTCACAG 0: 1
1: 0
2: 8
3: 44
4: 472
Right 1049377758 8:142297069-142297091 CTTCACAGATGAAATGAATGAGG No data
1049377753_1049377760 1 Left 1049377753 8:142297054-142297076 CCTTCCACCTGCCCACTTCACAG 0: 1
1: 0
2: 8
3: 44
4: 472
Right 1049377760 8:142297078-142297100 TGAAATGAATGAGGCAAATCGGG No data
1049377753_1049377761 2 Left 1049377753 8:142297054-142297076 CCTTCCACCTGCCCACTTCACAG 0: 1
1: 0
2: 8
3: 44
4: 472
Right 1049377761 8:142297079-142297101 GAAATGAATGAGGCAAATCGGGG No data
1049377753_1049377762 9 Left 1049377753 8:142297054-142297076 CCTTCCACCTGCCCACTTCACAG 0: 1
1: 0
2: 8
3: 44
4: 472
Right 1049377762 8:142297086-142297108 ATGAGGCAAATCGGGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049377753 Original CRISPR CTGTGAAGTGGGCAGGTGGA AGG (reversed) Intronic
900151562 1:1181204-1181226 CTGTGAGATGGACAGGTGGGTGG - Intronic
900780429 1:4614291-4614313 CTTTGAAGAGGGCAAGTGGGAGG + Intergenic
901194629 1:7433489-7433511 CTGAGAAGTGGGTACCTGGAGGG - Intronic
902234222 1:15047430-15047452 ACGTGCAGTGGGGAGGTGGAGGG + Intronic
903181769 1:21608493-21608515 CTGTGGAGTGGCCTGGGGGAAGG - Intronic
903314285 1:22489054-22489076 CTGTGAGGTGGGAAAGTGGCAGG + Intronic
904651278 1:32007733-32007755 TTGGGAAGTGGCCAGGTGGAGGG - Intergenic
904703789 1:32375405-32375427 GTGTGAAGTGTACAGGTGGTGGG + Intronic
904834993 1:33329970-33329992 CGCTGAAGTCGGCAGCTGGAGGG + Intronic
905111197 1:35595673-35595695 CTGGGAATTGGGCAGGGGGTAGG + Intergenic
905228108 1:36493025-36493047 CACTGGGGTGGGCAGGTGGAAGG + Intergenic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905521990 1:38607664-38607686 CTGGGAAGTGGGCAGTGGGGAGG + Intergenic
905794602 1:40808532-40808554 CTCAGAAGTGGGCAGGAGGGTGG - Intronic
906154814 1:43607762-43607784 TTGCCAAGTGGGCAGGGGGAGGG - Intronic
906662352 1:47592290-47592312 CTTTGAAGTGGGCGGCAGGAAGG + Intergenic
906789122 1:48643329-48643351 CAGCTAAGTGGGTAGGTGGAGGG - Intronic
906831148 1:49033203-49033225 TTGTGAAGTGGCCTGCTGGAAGG + Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907941775 1:59095338-59095360 CAGTGGATTGGGCAGTTGGAAGG + Intergenic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909498861 1:76310863-76310885 CTGTCAAGGAGTCAGGTGGAAGG - Intronic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
910530009 1:88225193-88225215 TTGTGCAATGGGCAGATGGATGG + Intergenic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911450539 1:98054824-98054846 CTGTGAATTGGGGAGAGGGAGGG + Intergenic
912467037 1:109881451-109881473 CTGTGACTCGGGCAGGTGGCAGG - Intergenic
912683316 1:111742612-111742634 CTGTGAAGTAGTCAGGAGCAGGG + Intronic
913088493 1:115460072-115460094 CTGTGAAGTAAGTAGGGGGAAGG + Intergenic
915075667 1:153306565-153306587 CTGTGAGGTGGGGAGGAGCAAGG + Intronic
915303821 1:154966551-154966573 ATGTGTGGTGGGCAGGAGGAGGG + Intronic
915635771 1:157185520-157185542 GTGTGTGGTGAGCAGGTGGAAGG - Intergenic
917096525 1:171404096-171404118 CAGTGAAGTTGTCATGTGGAAGG - Intergenic
917298585 1:173548851-173548873 GTGTAAAGTGTACAGGTGGAAGG + Intronic
917337101 1:173936064-173936086 CTGTGAAGTAGGCAGGAGCAGGG - Exonic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
919939837 1:202278611-202278633 CTGTGAAGTGGACAGGAGGCTGG + Intronic
920097460 1:203495942-203495964 CTGGCAAGTGGGCACGAGGAAGG - Intronic
920558086 1:206919081-206919103 TTGTGCTGTGGGCAGGAGGAAGG - Intronic
921307466 1:213811390-213811412 CAGTGAAGTAGGCATGGGGATGG - Intergenic
922663772 1:227451906-227451928 CTCTGCAGTCAGCAGGTGGAGGG + Intergenic
922930099 1:229382180-229382202 CAGTGGAGTGGGCGGCTGGAGGG + Intergenic
923211976 1:231811662-231811684 CTGAGGATTGGGCAGGTGAAAGG + Intronic
923542777 1:234900597-234900619 AGGTGAAGTGAGCAGGTAGAGGG + Intergenic
923898500 1:238299921-238299943 CTTTGAAGTGGGCAGAGAGAAGG - Intergenic
1062811527 10:469989-470011 GTGAGAGGTGGGGAGGTGGATGG + Intronic
1063162625 10:3430685-3430707 CTGTGCATTGGGCAGGCTGATGG - Intergenic
1063276365 10:4572698-4572720 CTGCCAAGAGGGCAGGTGAAAGG + Intergenic
1063418315 10:5890513-5890535 CCGGGCCGTGGGCAGGTGGAGGG + Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064273330 10:13884745-13884767 TTGTGAAGATGGCAGGTGGCAGG - Intronic
1064532668 10:16326008-16326030 CTTTAAAGTGGGCAGGTAGCTGG - Intergenic
1065158185 10:22892798-22892820 CTAGAAAGTGGGCAGGGGGAGGG - Intergenic
1065638533 10:27755401-27755423 CTGTGAAGTGAGGAGTCGGAAGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067667266 10:48289056-48289078 CTGACAGGTGGGCAGGCGGAGGG - Intergenic
1067934666 10:50599384-50599406 CTCTGAAGTGGGCTGTTGCAGGG - Intronic
1069781248 10:70957107-70957129 CTGAGAAGGGGGCAGGGGGTGGG - Intergenic
1070499134 10:77053977-77053999 CTGTGCAGTGGGCAGCAGGATGG - Intronic
1070538138 10:77394501-77394523 CGAAGCAGTGGGCAGGTGGATGG + Intronic
1070724294 10:78777832-78777854 CTGGGACGAGGGGAGGTGGATGG - Intergenic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073142068 10:101254728-101254750 CTGGGAGGTGGCCAGGTGGGAGG - Intergenic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1075925146 10:126245501-126245523 CTGGGCAGTGGGCAGGAGGTCGG + Intronic
1076002530 10:126923729-126923751 GTATGAAGTGGGGAGGGGGAGGG - Intronic
1076298031 10:129402799-129402821 CTGTGGAGTGGCCAGAAGGACGG - Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076542623 10:131223841-131223863 ATGTACAGTGGGCAGGGGGAGGG - Intronic
1076699170 10:132261205-132261227 CTGTGGAGTTGCCAGGTGGCTGG + Intronic
1078006592 11:7536955-7536977 ACCTGAAGTGGGCAGGTAGAAGG + Intronic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1080123950 11:28709449-28709471 TTCAGAAGTGGGGAGGTGGAGGG - Intergenic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080686213 11:34517189-34517211 TGGTGAAGTTGGCAGGTTGAGGG - Intergenic
1080809560 11:35689796-35689818 CTGAGGACTGGGCAGGGGGAAGG - Intronic
1080908089 11:36566911-36566933 CTGTCAAGGAGGCAGGTGCAAGG - Intronic
1082778957 11:57271318-57271340 CTGGGATGTGGGCAGGTGAATGG - Intergenic
1083192119 11:61059739-61059761 CTGTGAAGTGGGCAGGGCAGAGG - Intergenic
1083268101 11:61556295-61556317 CAGTGAAGGGGCCAGATGGAGGG - Intronic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083853461 11:65380679-65380701 CTAGGCAGTGGGCAGGTGGAGGG - Intronic
1084209622 11:67615004-67615026 CTGTGATGGGGGGAGCTGGAGGG - Intergenic
1084523351 11:69679668-69679690 ATGTTAAGTGGGCAGGGAGAAGG - Intergenic
1084746762 11:71175411-71175433 CTGTAAAGAGAGCAGGAGGAAGG + Intronic
1084751069 11:71204797-71204819 CTGGGAAGGGGGCAGGAGGCAGG + Intronic
1084893838 11:72251005-72251027 CTGTGCAGTGTCCAGGCGGAAGG + Intergenic
1085235063 11:75008327-75008349 CTGTCAAGTTGGCAGGTGGAGGG + Exonic
1085316537 11:75548524-75548546 CTGTGAGGTTGGCTGTTGGATGG - Intergenic
1085413769 11:76307051-76307073 CTGCTGAGTGGGCAGGTGCAGGG - Intergenic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085647722 11:78238025-78238047 CTGTTAGGTGGGCAGAGGGAGGG + Intronic
1086064307 11:82731014-82731036 GTGGGAAGTGAGCAGCTGGAGGG - Exonic
1086685359 11:89727900-89727922 CTGGGAAGCGGGAAGGGGGATGG + Intergenic
1086870767 11:92033886-92033908 GGGTGAAGTGGGGAGGTGGGGGG - Intergenic
1088100668 11:106152197-106152219 CAGTGATGTGGGCAGGTTGGAGG - Intergenic
1088207819 11:107414559-107414581 ATGTCAAGTAGGCAGTTGGATGG - Intronic
1089643629 11:119863990-119864012 CTGTGATGAGGGCAGGAGGAAGG - Intergenic
1091159508 11:133407111-133407133 TTTTGAAGTGGTCATGTGGATGG - Intronic
1091275045 11:134344475-134344497 CTGTGAACTGGCCAGGGGCAGGG + Intronic
1091330640 11:134728703-134728725 AAGTGAAGTGGGCAGGAGCAGGG - Intergenic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1093542871 12:20308595-20308617 ATGAGAACTAGGCAGGTGGAGGG - Intergenic
1094004727 12:25737412-25737434 CTGTTAAGTGGGAAAGTGAAGGG + Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094493443 12:30975512-30975534 CTGCGGAGTGGTCAGGAGGAGGG - Intronic
1095651945 12:44621334-44621356 ATGTGAAGTGGTTAGGTGAAAGG + Intronic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1100650689 12:96585503-96585525 CTGTGAAGTGGGGGAATGGAAGG - Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102480572 12:113220779-113220801 CCATGAAGTGGGCAGGTAGAAGG + Intronic
1102925792 12:116825200-116825222 CAGTGAAGAGGACATGTGGAAGG - Intronic
1103079355 12:118011083-118011105 CTGTAAAATGGGCAGGGGTAGGG - Intergenic
1103235677 12:119370559-119370581 ATGTGAAGGGGTCACGTGGATGG + Intronic
1103361842 12:120359163-120359185 CTGTGCAGGGAGCAGGTTGAAGG - Intronic
1103413062 12:120726150-120726172 CTGGGAACTGGGCTGGTGGCTGG - Intronic
1103593827 12:122010952-122010974 ATGGGAAGTGGGTAGGTGGCGGG + Intergenic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1104435025 12:128748835-128748857 CTGTGAAGTGGGCAGGACAGTGG + Intergenic
1104496562 12:129246044-129246066 CTGTGAAGTGGGCCGGGGTGGGG - Intronic
1104724336 12:131066734-131066756 CTGAGGAGTGGCCACGTGGATGG + Intronic
1104874973 12:132027330-132027352 CTGTGGAGTGTGCTGGTGGAGGG + Intronic
1105282697 13:18977783-18977805 CTGTAAAGTTGGCAGGTAGAAGG + Intergenic
1105313825 13:19237893-19237915 CTGGGAAGTGGGGAGGGGGTTGG + Intergenic
1105598821 13:21866938-21866960 CAGTGAAGTTGTCATGTGGACGG + Intergenic
1106047334 13:26155449-26155471 CAGTGAAGTGGGGTGGAGGATGG + Intronic
1106385316 13:29279281-29279303 CTGTGCTGTGGTCAAGTGGAAGG + Intronic
1112547609 13:100386813-100386835 CTGTGAGTTGGGGAGCTGGAGGG + Intronic
1112797405 13:103071333-103071355 CTAGGAGGTGGGTAGGTGGATGG + Intergenic
1115804279 14:37033754-37033776 CTGGGAAGAGGGTACGTGGATGG + Intronic
1117143113 14:52810009-52810031 GTCTGAAGTGGGGAGGTGGGGGG - Intergenic
1117868966 14:60177703-60177725 CTGTGAAGTATGCATGTGGGGGG + Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118884972 14:69859015-69859037 AGGTGAAGGGGGCAGGTGGGAGG + Intronic
1119054352 14:71403987-71404009 CTGTGATGTGGGTGGGTGGGTGG - Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119441353 14:74630900-74630922 CTGTGGAGGGGCCAGGTGTAGGG + Intergenic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119617840 14:76110590-76110612 CTGTGAAGTGGGGAGTGGGCCGG + Intergenic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1120204483 14:81573230-81573252 CTGTGATGTGTGCATGGGGATGG + Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120827382 14:88968162-88968184 CTGTGAGCTGGGCAGGAGCAGGG + Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121245918 14:92460770-92460792 CTGATAAGTGGGGAGGTGGGAGG + Intronic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1121920124 14:97872777-97872799 CAGTGAAGAGCTCAGGTGGAAGG + Intergenic
1121940534 14:98066257-98066279 CTGTGAGGTGGGGCGGGGGAAGG - Intergenic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1123796827 15:23781039-23781061 AGGTGAAGAGGGCTGGTGGAGGG + Intergenic
1124108566 15:26764784-26764806 CTGCTGAGTGGGCAGGCGGAAGG + Intronic
1124464139 15:29920961-29920983 ATGTGAAATGGACAGATGGATGG + Intronic
1124998397 15:34746370-34746392 ATGTGAGTTGGGGAGGTGGAAGG - Intergenic
1125608525 15:40955987-40956009 TGGTGTGGTGGGCAGGTGGAGGG + Exonic
1126308505 15:47288798-47288820 CTGTGGAGTGTACAGGTGGAAGG - Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1128562164 15:68676031-68676053 CAGGGGTGTGGGCAGGTGGAGGG + Intronic
1129154422 15:73709108-73709130 TTGTGAGGTAGACAGGTGGAAGG + Intronic
1130084833 15:80769024-80769046 CTGGGAAGTAGGCAGGTGGTAGG + Intergenic
1130677427 15:85965735-85965757 CTCTGATGTGGGCAAGTGGCTGG + Intergenic
1132626452 16:893977-893999 CAGTGGGGTGGACAGGTGGATGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132851947 16:2028772-2028794 CTGGGAAGTGGGCAGGAAGAGGG - Intronic
1133267011 16:4591270-4591292 ATGTAAAGTGGGCAGGTTTATGG - Intronic
1135340593 16:21643975-21643997 GTGAGGTGTGGGCAGGTGGAGGG - Intronic
1136255001 16:29032637-29032659 CTTTGAAGAGGGAAGGTGCAGGG + Intergenic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136751268 16:32637941-32637963 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1137628914 16:49928346-49928368 GTGTGGAGTGGGGATGTGGAGGG - Intergenic
1137758361 16:50920283-50920305 GTGTGAAGAGGGCAGCTGGCAGG + Intergenic
1138453363 16:57106682-57106704 CTGTGAAGTGAGGAGGGGGTAGG + Intronic
1138537276 16:57666770-57666792 CTGGGAAGTGGGCAGAGGGCAGG - Intergenic
1138836846 16:60447841-60447863 CAGTGAAGTTGGTATGTGGAAGG + Intergenic
1139126783 16:64088227-64088249 CTGTCATGGGGGCAGGTGGTGGG - Intergenic
1139587509 16:67913584-67913606 CTGTGAAGTGAGTGGCTGGAAGG + Intronic
1139587825 16:67915688-67915710 CTGTGAAGTGAGTGGCTGGAAGG - Intronic
1139661255 16:68422395-68422417 CTGTGATCTGGGCAGGTGCTTGG + Intronic
1139946840 16:70647627-70647649 CTCTGCAGTGGGCACGTGGGAGG - Intronic
1140249754 16:73285780-73285802 TTGTAAAGTTGGCAGGTAGAAGG + Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1140803790 16:78513798-78513820 GTGTAAAGTATGCAGGTGGATGG - Intronic
1141103666 16:81215813-81215835 CAGGAAGGTGGGCAGGTGGATGG + Intergenic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1142358653 16:89615899-89615921 CTGTGAAATGGGCCTGTGAAAGG - Intronic
1203053402 16_KI270728v1_random:897196-897218 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1142475119 17:184112-184134 CTTTGAAGAAGTCAGGTGGAGGG + Intergenic
1142734124 17:1883978-1884000 CTGTAAAGTGTGCAGAAGGATGG + Intronic
1142950937 17:3479585-3479607 TGGTGCAGTGGGAAGGTGGAAGG - Intronic
1143346990 17:6257089-6257111 CTGTGAAATGGGCATGATGAGGG - Intergenic
1144763244 17:17719142-17719164 CTGTGAAGAGGGCAGATGTGGGG - Intronic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146097661 17:29947408-29947430 CTCAGAAGTGGGAGGGTGGAAGG + Intronic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1147037378 17:37691865-37691887 CTGACAAGGGGGCAGGTGGGTGG - Intronic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147249234 17:39143354-39143376 CTGGGGAGTGGGCTGGGGGAAGG - Intronic
1147426846 17:40349900-40349922 CTTTGAAGTGGGCATGTCCAAGG + Exonic
1147715795 17:42507445-42507467 CTGTGAGGTGGGAAGGGCGATGG - Intronic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148206394 17:45783010-45783032 CTGAGAAGAGGGCAGGAGGGAGG + Intergenic
1148747691 17:49927654-49927676 CTTTGAAGTGGGTTGGAGGAGGG - Intergenic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152386404 17:79977414-79977436 CTGGGAAGGGGCCAGGTGGAGGG - Intronic
1153641703 18:7163191-7163213 CTGTAATGGGGGCATGTGGAAGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1153930165 18:9871355-9871377 GTGTGATGTGGGCAGGAGCAGGG - Intergenic
1154025867 18:10706477-10706499 GGGTGGAGTGGGCAGCTGGAAGG - Intronic
1154107383 18:11534272-11534294 CTGGGCAGTGGCCAGGTGGTAGG + Intergenic
1155261001 18:24042398-24042420 CTGTGAACTGTGCACGTGGGGGG - Intronic
1155364572 18:25036825-25036847 CTGTGGTGTGGGGAGGTGGCAGG + Intergenic
1155697688 18:28702160-28702182 CAGGTAAGTGGGTAGGTGGAGGG + Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156284222 18:35675125-35675147 GTTTGAAGTGGGTAGGGGGATGG - Intronic
1156824863 18:41418853-41418875 ATGTGATGTGGGCAGCTGTAAGG - Intergenic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1158547472 18:58408363-58408385 TTGGGACGTGGGCAGGGGGATGG + Intergenic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159965096 18:74587431-74587453 ATGTGAAATGGGCAGGAAGATGG - Intergenic
1160555045 18:79719309-79719331 CTGGGATGTGGGCAGGTGCAGGG + Intronic
1160577187 18:79863490-79863512 GTGGGAAGTGGGCGGGCGGAGGG + Intergenic
1160719654 19:591594-591616 GTGTGGAGGGTGCAGGTGGAGGG + Intronic
1160802041 19:974664-974686 CTCCGAGGTGGGCAGGTGCACGG - Exonic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1162565141 19:11441806-11441828 CTGTGTACTGGGCAGGAGGCTGG + Intronic
1162767774 19:12930391-12930413 CTGGTCAGGGGGCAGGTGGACGG - Intronic
1163042589 19:14613593-14613615 CTGTGAGGAGAGCAGGTGGTGGG + Intergenic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163365227 19:16872331-16872353 ATTTGAAGGGGGCAGATGGATGG + Intronic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1164212779 19:23114888-23114910 CTGTGACTAGGGCAGGAGGATGG - Intronic
1164646009 19:29859055-29859077 CTGGGAAGATGGCAGGTCGAGGG + Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165683974 19:37802148-37802170 CTGTGAACTGTGCATGTGGGGGG - Intronic
1165895710 19:39139689-39139711 TTGGGGAGTGGGCAGGAGGATGG - Intronic
1166391031 19:42409020-42409042 CTGTGAGGTGGGGAGTAGGATGG + Intronic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925422647 2:3725147-3725169 GTGTGAAGTAGGCAGTAGGAAGG + Intronic
926007665 2:9385083-9385105 CTGTGAAGTAGGCAGAGGGGCGG + Intronic
926046610 2:9714725-9714747 ATGTTAAGTGGGCAGCTGGGTGG + Intergenic
926148755 2:10412831-10412853 GTGGGAAGTGGGCAGGGAGATGG - Intronic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
926767204 2:16331962-16331984 CTGGAATGTGGGCAGGTGCATGG - Intergenic
927172225 2:20379767-20379789 TTGTGGGGTGGGCAGGGGGAGGG - Intergenic
927321723 2:21755106-21755128 TTGTGAAGTGGTAAGGTAGAAGG + Intergenic
927425363 2:22975422-22975444 CCTTGATGTGGGCAGCTGGAGGG - Intergenic
927482857 2:23468259-23468281 CTGTGTAGTGGTCAGGAGCATGG - Intronic
927670656 2:25066110-25066132 GTGTGACGTGGGGAGGTGGGGGG - Intronic
927767286 2:25822447-25822469 TTGTGAACAGGGCAGGGGGACGG - Intronic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
931183095 2:59923318-59923340 TTGTAAAGTGAGCATGTGGATGG - Intergenic
932481514 2:72042221-72042243 GTGTGAGGTGGGCAGGGGGATGG + Intergenic
932716020 2:74101225-74101247 CTGTGAAGTGGGAAGGGGCCAGG - Exonic
934765619 2:96878553-96878575 GTGGGGAGTGTGCAGGTGGAGGG - Intronic
934898918 2:98141700-98141722 GTGTGAAGTGGCCAGCAGGAAGG - Intronic
934915095 2:98295184-98295206 CCGAGGAGTGGGCAGCTGGAGGG + Intronic
934950179 2:98570694-98570716 CCCTGGAGTGGGCAGGCGGAGGG + Intronic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
936288637 2:111200703-111200725 CTGTGAAGTGGGCGTCTGGATGG + Intergenic
937064228 2:119005229-119005251 CGGGGGAGTGAGCAGGTGGAGGG + Intergenic
937217611 2:120322621-120322643 ATGAGAAGTGCTCAGGTGGAGGG - Intergenic
938255538 2:129857449-129857471 CTGGGAATTGGAGAGGTGGAAGG + Intergenic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
940233084 2:151479112-151479134 CTGTGAACTGCGCTGGTAGATGG + Exonic
940763153 2:157760889-157760911 GTGGGAAGTGGCCAGGCGGATGG - Exonic
942579413 2:177401421-177401443 CTGTGAAATGGGCAGTTGTGAGG - Intronic
942603099 2:177661269-177661291 GTGGGAAGTGTGCAGGTGGCAGG - Intronic
944390701 2:199216335-199216357 ATGTGAAGACGGCAGATGGAAGG + Intergenic
944898390 2:204189058-204189080 AGGTGAACTGGGCAGGTGGCAGG + Intergenic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946759848 2:222982734-222982756 CTGTTAAGGGAGCAGGTAGAGGG - Intergenic
947206971 2:227669722-227669744 GTGTCTAGTGGGCAGGTGCAGGG + Intergenic
948444661 2:238022988-238023010 GTGTGAAGGGGACAGGAGGAAGG + Intronic
948576136 2:238950764-238950786 CTGTGAGGCGGGCACCTGGAGGG + Intergenic
948677842 2:239609554-239609576 CTAAGAAGAGGGGAGGTGGATGG - Intergenic
949057205 2:241934618-241934640 CTGTGAAGTTGGCGGGGGGATGG + Intergenic
1169117439 20:3074903-3074925 CAGTGACATGGGCAGGGGGATGG - Intergenic
1169659430 20:7961967-7961989 CTGGGCAGTGGGCATGTGGTGGG - Intergenic
1170134823 20:13061383-13061405 TGGTGGAGGGGGCAGGTGGATGG - Intronic
1171258266 20:23708523-23708545 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171275489 20:23853566-23853588 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171452573 20:25246905-25246927 CTCTGAAGTCTGCAGCTGGAAGG + Intergenic
1171975705 20:31593543-31593565 CTGTGAGGTGGGCAGGGAGCTGG + Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172285903 20:33740248-33740270 CTGGGAAGTGGAAAGGAGGATGG + Intronic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173766533 20:45615365-45615387 CAGTCAAGTGGGCAGGAGGCAGG + Intronic
1173900095 20:46581344-46581366 CTGTGAAGTAGCCTTGTGGAAGG + Intronic
1173972762 20:47165397-47165419 CTGGGAAGTGGGGGAGTGGAAGG - Intronic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1174222870 20:48971502-48971524 CTCAGAAGTGGGCAGGGGCAGGG + Intronic
1174565728 20:51463217-51463239 CTGGGAAGTGGGAGAGTGGAGGG + Intronic
1175366084 20:58457127-58457149 GTGTCAGGTGGGCAGGAGGAGGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175654763 20:60760533-60760555 CTCTGTAGTGGGGAGGTGGGTGG - Intergenic
1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG + Intronic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1175788237 20:61725240-61725262 CTGCGGTGTGTGCAGGTGGACGG - Intronic
1175943627 20:62549026-62549048 CTCTGCACTGGGCAGGTGCAGGG + Intergenic
1175967590 20:62667220-62667242 CTGTGAAGTGGGAAAAAGGAAGG + Intronic
1177662561 21:24105115-24105137 CTGTGAGGTGGGCAGTGGGGAGG + Intergenic
1178808300 21:35857939-35857961 TTGTGAAGTGTGCAGGTGCCTGG - Intronic
1179355310 21:40653322-40653344 CTTTGATGTGCCCAGGTGGATGG + Intronic
1180031644 21:45213048-45213070 CTCTGATGAGGGCAGGGGGATGG + Intronic
1180188986 21:46153835-46153857 TTGACGAGTGGGCAGGTGGACGG + Intronic
1180901312 22:19375429-19375451 CCTTGAAGTGGGAAGGTGGCTGG - Intronic
1181013605 22:20056163-20056185 CTCTGAAGTGTCCAGGTGCAGGG - Intronic
1181753220 22:25004548-25004570 CAGGGAAATGGGCAGATGGAGGG - Intronic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1183404420 22:37623490-37623512 CTGTGGAGTGGGCAGGGAGTGGG - Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1183645629 22:39124372-39124394 CAGTGAAGCTGGGAGGTGGACGG + Intronic
1184243321 22:43222880-43222902 CAGGGAAGTGGCCAGGAGGAAGG + Intronic
1184246330 22:43237519-43237541 CAGGCAAGTGGGCAGGTGGGTGG - Intronic
1184273479 22:43397759-43397781 TTGTGCAGGGGGCAGGTGGCAGG + Intergenic
1184309766 22:43633720-43633742 CGGTGTGGTGGGCAGATGGATGG + Intronic
1184355379 22:43976080-43976102 CTGTCAAGTGGGAAGGCGTATGG + Exonic
1184681511 22:46074715-46074737 CTATGGTGTGGGCTGGTGGAAGG + Intronic
1184777919 22:46632567-46632589 CTGAGAAGGGGTCAGCTGGAGGG + Intronic
1185417232 22:50716840-50716862 CGGTCAAGTGGGCAGGTGTGTGG - Intergenic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
950085551 3:10254991-10255013 GTGGGAAGTGGGAAGGAGGAAGG - Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950476988 3:13220902-13220924 CTGTGAAGTGGCCCGGTGGCTGG - Intergenic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950559113 3:13711795-13711817 CTGTGATGGGAGCATGTGGAGGG + Intergenic
950559126 3:13711856-13711878 CTGTGATGGGAGCATGTGGAGGG + Intergenic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
950872210 3:16239320-16239342 GTGGGAAGTTGGCAGATGGATGG + Intergenic
951509772 3:23487436-23487458 CTGTGAAGCTGGCAGGGGCAGGG - Intronic
951787015 3:26432936-26432958 TTGTGAACTAGTCAGGTGGAAGG + Intergenic
952179384 3:30902005-30902027 ATGTGAAGTGGTCCGGTGGAAGG + Intergenic
953185971 3:40638816-40638838 CTGATAAGTGGGCAGGACGAAGG - Intergenic
954326168 3:49865341-49865363 CCGTGTACTGGGCAGGAGGATGG + Intronic
954906505 3:54067706-54067728 CTGTGAAGTGGAGGGGTGGCAGG + Intergenic
956403943 3:68908539-68908561 CTGTGAATTGGGCACCTTGATGG - Intronic
957457617 3:80472674-80472696 CTGGGAGGTGGGGAGGTGGCTGG - Intergenic
957459086 3:80494267-80494289 CTGGGACGTGGACAGGTGGCTGG + Intergenic
958192758 3:90204594-90204616 CTGTGAACTGGGCGGTTGGATGG - Intergenic
959083504 3:101827514-101827536 GGGTGCAGTGGGCGGGTGGAGGG - Exonic
960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG + Intronic
960750226 3:120941754-120941776 CAGTGAAGGGGGCAAATGGAAGG + Intronic
960945855 3:122966116-122966138 ATGGGAAGTGGGGAGGAGGAGGG - Intronic
961327019 3:126114885-126114907 GTGTGGAGTGGGCAGCAGGAAGG - Intronic
961459378 3:127040522-127040544 TGGAGAAGTGCGCAGGTGGAGGG + Intergenic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
964270987 3:154956659-154956681 CAGTGAAGTGGGGAAGTGGGTGG + Intergenic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
966121107 3:176521627-176521649 TTGTGAAGTGAGCAACTGGAAGG - Intergenic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967707883 3:192673535-192673557 CTGTCAGGGGGGCAGGAGGAGGG - Intronic
967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG + Intergenic
967963388 3:194942443-194942465 CTGGGCAGTGAGCTGGTGGAGGG - Intergenic
968598652 4:1498580-1498602 ATGAGGGGTGGGCAGGTGGATGG + Intergenic
968691277 4:1991743-1991765 CTTGGAAGTGGGCAGGGGCATGG - Intronic
968909997 4:3472818-3472840 CTGGGCAGTGGCCGGGTGGATGG + Intronic
968914037 4:3489420-3489442 CTGGTGAGTGGGCAGGTGGCAGG + Intronic
969310052 4:6347795-6347817 CTGTGCATTGGGCAGGCGGGCGG - Intronic
969445975 4:7244942-7244964 CTGAGAAGTGGGCAGTTGGAAGG + Intronic
969497375 4:7533820-7533842 CTGTAAAGCGGGCAGGTGGAAGG + Intronic
969719964 4:8888205-8888227 CTGTGGGGTGCGGAGGTGGAGGG - Intergenic
969851892 4:9963971-9963993 CTGTGAGGTGGAGGGGTGGATGG + Intronic
969901438 4:10354242-10354264 CAGTGAAGTTGTCATGTGGACGG + Intergenic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
974047820 4:56912081-56912103 TTGTTAAGTGGGCATGTGCAAGG - Intronic
974521532 4:62987186-62987208 CTGTGCTGTGGGCAGTGGGAAGG - Intergenic
976203947 4:82606838-82606860 CTGTGAAGTGGCCAAGTCCAGGG + Intergenic
977836389 4:101650217-101650239 CTGTGAAGTGAGCAGAGGAAGGG - Intronic
979768926 4:124498387-124498409 TGGTGAAGTGGGTGGGTGGATGG + Intergenic
981578486 4:146229102-146229124 CTGTGAAGTGGGCTTGTGACTGG + Intergenic
983651393 4:170040253-170040275 CTGCGAAGTGGGTAGGAGCAAGG - Intergenic
984530415 4:180909389-180909411 GTGTGATGAGGGCAGGTGCATGG - Intergenic
984713282 4:182903683-182903705 CTGGGCTGTGGGCAGGCGGATGG - Intronic
986970040 5:13322759-13322781 AGGTGAAGGGGGCTGGTGGATGG - Intergenic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
991596448 5:68311538-68311560 CTGGGAAGTGGGCAGGGGGAAGG + Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
993401788 5:87462355-87462377 CTGTGAAGTGGGTGGGTGTGGGG - Intergenic
993505915 5:88708347-88708369 CTGTGAGGTTGGGAGGTGCAGGG + Intergenic
993794367 5:92248931-92248953 CCATGGAGTGGGCAGGTGGCTGG - Intergenic
994028914 5:95118014-95118036 CTGTCAAGGGGTGAGGTGGAGGG + Intronic
996759940 5:126976810-126976832 CTGCCACGTGAGCAGGTGGAGGG - Intronic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
998463597 5:142326071-142326093 CCGAGAACTGGCCAGGTGGATGG + Intronic
999409156 5:151335295-151335317 CAGTGGAGTGGGCAGGTGCATGG + Intronic
999639338 5:153655952-153655974 ATGTGAACTGAGTAGGTGGAAGG + Intronic
1001234078 5:170014739-170014761 GTGGGCAGTAGGCAGGTGGAGGG + Intronic
1001688487 5:173614457-173614479 CTGATAAGTGAACAGGTGGAGGG - Intronic
1001892767 5:175352989-175353011 GAGTGAAGTGGGCCAGTGGAGGG + Intergenic
1001946924 5:175786900-175786922 CTGTGAAGAGTGTAGGTGGCTGG - Intergenic
1002135864 5:177107202-177107224 GTGTGACGTGGGCAGCAGGATGG - Intergenic
1003020403 6:2504728-2504750 CTGAGAAGTGGGGAGGGGTAAGG - Intergenic
1003115567 6:3281647-3281669 CTGTGAAGTGGGGGGATGGTAGG + Intronic
1003257467 6:4487130-4487152 CTGTGATTTTGGCAGGTTGAAGG - Intergenic
1003265665 6:4563330-4563352 CTGAGGAGCGGGCAGCTGGAGGG - Intergenic
1004017392 6:11744580-11744602 CTGAGATGGGGCCAGGTGGAAGG + Intronic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1004667268 6:17760014-17760036 ATGTCAAGTCAGCAGGTGGAGGG + Intronic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1006194086 6:32227234-32227256 CAGAGAAGTGGTTAGGTGGAAGG + Intergenic
1006272316 6:32973703-32973725 TTGTGTAGTGGGTGGGTGGAAGG + Intronic
1006812013 6:36826224-36826246 CTGGGAAGTGGGCAGGACCAGGG - Intronic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007407849 6:41645081-41645103 TTGGGGAGGGGGCAGGTGGAAGG + Intronic
1008464411 6:51814695-51814717 CTGTCAACTGCTCAGGTGGAAGG + Intronic
1009029382 6:58038224-58038246 CTGTCCAGTGGCCAGGTGGATGG - Intergenic
1010433742 6:75807437-75807459 TTGGGGAGTGGGCATGTGGAGGG + Intronic
1011254020 6:85402863-85402885 CTGTGCAGTGGACAGGGTGATGG - Intergenic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013961749 6:115909168-115909190 CTTGCAAGTGGGCAGGTGGTGGG - Intergenic
1014928957 6:127310095-127310117 GTGTGGAGTTGGCAGGGGGATGG + Intronic
1015562341 6:134530116-134530138 CTGTGATGTGGGTAGGTTGATGG - Intergenic
1015620471 6:135126788-135126810 CAGTGAAGTTGTCATGTGGATGG - Intergenic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1016472594 6:144390219-144390241 CTGGGACGTGGTGAGGTGGATGG - Intronic
1016606595 6:145936136-145936158 ATGTTAAGTGGGCAGGTGGAGGG - Intronic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018671034 6:166177687-166177709 CAGTGAGGTGGGCAGGGAGAAGG + Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019623122 7:2002247-2002269 CTGGGAAGTGGGCAGCCAGAGGG + Intronic
1020439913 7:8206346-8206368 ATGTCAAGTGGGCAGCTGGATGG - Intronic
1021420154 7:20437775-20437797 CTGTGATGTGGGCAGTCGTAGGG + Intergenic
1022811135 7:33870038-33870060 CTGTGAAGTGGGCAGCAGAGTGG - Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023891325 7:44393961-44393983 CTTGGAGGTGGGAAGGTGGAAGG - Intronic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026481366 7:70782408-70782430 CTGTCAAGTGTGCGTGTGGAAGG + Intronic
1027235086 7:76293273-76293295 CTAGAAAGTGGGTAGGTGGAGGG - Intergenic
1028216381 7:88138949-88138971 CTCTGCAGTGGGCAGGAGGGTGG + Intronic
1028344413 7:89761628-89761650 CTGGGAAGTGGGCAGGTTTTGGG - Intergenic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029148484 7:98463569-98463591 TTGGGGAGGGGGCAGGTGGAGGG + Intergenic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1030161404 7:106512155-106512177 TGGGGAAGTGGGCAGGTGGCTGG - Intergenic
1031382629 7:121106643-121106665 CTGTGAACAGGACAGGTGAAGGG - Intronic
1031543477 7:123024475-123024497 CGGTGAAGTGGGAATGAGGAGGG - Intergenic
1031709881 7:125032245-125032267 GTGGGAGGTGGGCAGGGGGAAGG - Intergenic
1031999185 7:128253875-128253897 CAGTGCTGTGGGCAGATGGATGG + Intronic
1033679383 7:143579011-143579033 CACTGACGTTGGCAGGTGGAGGG - Intergenic
1033692454 7:143750433-143750455 CACTGACGTTGGCAGGTGGAGGG + Intergenic
1034462419 7:151205189-151205211 CAGTGATCTGGGCTGGTGGATGG + Intronic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1034896870 7:154881804-154881826 AGGTGAAGTGGTCAGGAGGAGGG + Intronic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1036773160 8:11592629-11592651 TGGTGTGGTGGGCAGGTGGAGGG - Intergenic
1038330240 8:26602492-26602514 CAGTGATGTGGGCTGATGGAGGG + Intronic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1039888594 8:41669714-41669736 CTGAGAGGTGGGCGGGTGCAGGG - Intronic
1040334438 8:46408890-46408912 GAGTGAAGTGGGCGGGTGGCAGG + Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1047681360 8:127257642-127257664 GTGTGAAGTGGGCTTGAGGATGG + Intergenic
1047851014 8:128858122-128858144 CTGTTAAGGGGGCAGCTGGCAGG - Intergenic
1048437409 8:134431429-134431451 CATGGAAGTGGGCAGGTGGCTGG + Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049349593 8:142157458-142157480 CTGGAAGGAGGGCAGGTGGAGGG - Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1049805594 8:144537372-144537394 CAGGGAAGTTTGCAGGTGGAGGG - Intronic
1050310110 9:4344146-4344168 CAGAGAAGTGGGCTGGTAGATGG - Intronic
1052749222 9:32472032-32472054 CTGTGAGGTGGTCAGGATGAGGG + Intronic
1054813561 9:69453995-69454017 CAGTGTGGTGGGCAGGAGGATGG - Intronic
1055646521 9:78366821-78366843 CTCTGCAGAGGGCAGGGGGAGGG + Intergenic
1056788632 9:89610939-89610961 CTTTGAGGTGGGCTTGTGGATGG + Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1057249886 9:93492658-93492680 CTGCGAAGTGGGGTGGTGGAGGG + Intronic
1057301920 9:93891477-93891499 CTGGGGTGAGGGCAGGTGGATGG + Intergenic
1057761126 9:97875197-97875219 ATGTGGAGTGGGCTGGTAGATGG - Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1057930044 9:99185255-99185277 CTGTACAGCGGGCAGGTGGTGGG + Intergenic
1058190945 9:101914984-101915006 TTGTGAACTGGGCATGTGAAGGG - Intergenic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1060693391 9:125684977-125684999 CAGTGAAATGGGCACATGGAGGG - Intronic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1062196887 9:135279378-135279400 CTGTAAAGTGGGCATGACGATGG - Intergenic
1062267975 9:135696068-135696090 GTGGGAAGTGGGGAGGTAGAGGG - Intronic
1062489657 9:136799084-136799106 CTGCTCTGTGGGCAGGTGGAGGG - Exonic
1185784175 X:2875875-2875897 CTGTGAAGTCTGCAGGCTGAGGG - Exonic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1186812893 X:13207628-13207650 CTGGAAAGTGGGGGGGTGGATGG - Intergenic
1186816209 X:13240470-13240492 CTGGGAACTGGGCAGGTAGGAGG - Intergenic
1187379487 X:18787355-18787377 TTGTAAGGTGGGCAGGTTGAGGG + Intronic
1188285022 X:28316135-28316157 CAGTGAGGTGGACAGGTGGCTGG - Intergenic
1188694692 X:33176158-33176180 GGTTGAAGTGGGCATGTGGAAGG - Intronic
1188828512 X:34867112-34867134 ATGTAAATTGGGCATGTGGATGG - Intergenic
1190026724 X:46930738-46930760 CTGTGATGGGGGCAAATGGATGG - Intronic
1190252518 X:48737832-48737854 CTGGAACGTGGGCAGGAGGAAGG - Intergenic
1194463715 X:94205563-94205585 CTGCTAAGTGGGCAGGAGCAAGG - Intergenic
1194602096 X:95934723-95934745 CTGTGAAGAGGACAGGTTGTAGG - Intergenic
1196844327 X:119886670-119886692 CTGTAAAGTGCGCAGGTGGCAGG - Intergenic
1198448201 X:136739723-136739745 CTGTGAAGTAGGCAAGTGAGTGG + Intronic
1199281065 X:145999812-145999834 CTGAGAAGTTGGCAGGAGAATGG - Intergenic
1199283200 X:146026454-146026476 CTGAGAAGTTGGCAGGAGAATGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199754707 X:150853391-150853413 CAGTGAAGTGGGTGGGTGGGGGG - Intronic
1199808256 X:151323885-151323907 CTGTTAAGGGGATAGGTGGATGG - Intergenic
1200081810 X:153580696-153580718 CTGTGTGGTGGGCAGGGGGCTGG + Exonic
1201370236 Y:13255043-13255065 GTTTGAACTGGGCACGTGGATGG - Intronic
1201554369 Y:15253556-15253578 CTGTGTTGTGGGCTGGTGGTGGG - Intergenic