ID: 1049378286

View in Genome Browser
Species Human (GRCh38)
Location 8:142299439-142299461
Sequence CCTCATCTGCAGAAGGCGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049378286_1049378293 -4 Left 1049378286 8:142299439-142299461 CCTAGCGCCTTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1049378293 8:142299458-142299480 GAGGTGGCCAGAGGAAGGGAAGG No data
1049378286_1049378292 -8 Left 1049378286 8:142299439-142299461 CCTAGCGCCTTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1049378292 8:142299454-142299476 AGATGAGGTGGCCAGAGGAAGGG No data
1049378286_1049378297 24 Left 1049378286 8:142299439-142299461 CCTAGCGCCTTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1049378297 8:142299486-142299508 CAAGGTCACACGCAGAGGCTCGG No data
1049378286_1049378295 6 Left 1049378286 8:142299439-142299461 CCTAGCGCCTTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1049378295 8:142299468-142299490 GAGGAAGGGAAGGACGTTCAAGG No data
1049378286_1049378291 -9 Left 1049378286 8:142299439-142299461 CCTAGCGCCTTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1049378291 8:142299453-142299475 CAGATGAGGTGGCCAGAGGAAGG No data
1049378286_1049378296 19 Left 1049378286 8:142299439-142299461 CCTAGCGCCTTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1049378296 8:142299481-142299503 ACGTTCAAGGTCACACGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049378286 Original CRISPR CCTCATCTGCAGAAGGCGCT AGG (reversed) Intronic
900475014 1:2872044-2872066 CCTCATCCCCAGAAGGCCCCTGG - Intergenic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
905022286 1:34826120-34826142 CCTTATCTGAAGAAGGCCATGGG - Intronic
905199537 1:36306739-36306761 CCTCACCTGCACCAGGCGCTCGG - Exonic
905201553 1:36320124-36320146 CCTCTTCTTCAGAAAGCTCTGGG - Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906836890 1:49093202-49093224 CCTCATCAGCAAAAGATGCTGGG - Intronic
907362711 1:53932678-53932700 CCTCAGCTCCAAAAGGAGCTGGG + Intronic
913461525 1:119091167-119091189 CATAATTTGCAAAAGGCGCTAGG - Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
918265115 1:182835086-182835108 CCTCAGCTTCTGAAGGTGCTGGG - Intergenic
919371867 1:196738644-196738666 CCACATCTGCACAAGGCTGTGGG - Intronic
919755572 1:201064156-201064178 CCTCCTCTGCACCAGGCCCTGGG + Intronic
920712370 1:208307330-208307352 TCTCATCTGTAAAAGGGGCTTGG - Intergenic
924384788 1:243490718-243490740 CCTCATCTTCAGAGGGTCCTGGG + Intronic
1062902984 10:1159627-1159649 CCTCATCTGCATAAAGCGTAGGG - Intergenic
1062983451 10:1744791-1744813 CCCGATCTGCAGAAGGCACCGGG + Intergenic
1066372131 10:34826167-34826189 CCTTATCTGCAGAAGAGCCTGGG - Intergenic
1072282067 10:93875290-93875312 CCTCCTTTGCACAAGGCACTGGG + Intergenic
1074415246 10:113261814-113261836 ACTCATCTGCAGAAGTCGCAAGG - Intergenic
1074559226 10:114520105-114520127 CCTCAGCTGCTGAAGCCTCTGGG + Intronic
1076155237 10:128199497-128199519 CCTCATCAGCAGACAGGGCTAGG + Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1080036337 11:27715791-27715813 CCTCATCTGTAAAAGGTGATTGG + Intronic
1080444869 11:32329065-32329087 CCTCAGCTGCACAAAGTGCTGGG - Intergenic
1082192270 11:49260743-49260765 CCTCATCTTCCTAAAGCGCTGGG - Intergenic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090043778 11:123313413-123313435 CCTCCTCTGTAGAAGGCCCCGGG + Intergenic
1091649746 12:2301145-2301167 CACTATCTGCAGGAGGCGCTTGG + Intronic
1092143448 12:6199689-6199711 CCTCAAGTGCAGGAAGCGCTTGG + Intergenic
1105697323 13:22901201-22901223 CCTCTTCTGCAGTAGTCCCTGGG - Intergenic
1106676270 13:31961833-31961855 CATCCTCTGCAGAAGGCAGTTGG + Intergenic
1107903546 13:45041760-45041782 CCTCATCTGCCCAAGTAGCTGGG - Intergenic
1109778374 13:67074298-67074320 CCTCATCTGGGGAAGGGGCGAGG - Intronic
1111769410 13:92578108-92578130 CCTCTACTGCAAAAGGAGCTAGG - Intronic
1113457482 13:110458759-110458781 CCTCCTCTGCAGGTGACGCTGGG + Exonic
1116617013 14:47153170-47153192 TCTCTTCTCCAGAAGGAGCTAGG - Intronic
1118639154 14:67776298-67776320 CCTCATCTGGTGAAGGTACTTGG - Intronic
1119662910 14:76464323-76464345 CCTTATCTTCAGAGGGCCCTGGG - Intronic
1120803812 14:88723160-88723182 CCTCAGCTGCTGAAAGTGCTGGG - Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1122114011 14:99518708-99518730 CCTCATCTGCACCAGGCCCCTGG + Intronic
1122313134 14:100809943-100809965 CCTGATCTGCAGCTGGGGCTTGG + Intergenic
1123206143 14:106715137-106715159 CCTCCTCTGAAGAAGCCCCTGGG - Intergenic
1125760666 15:42093738-42093760 CCTCATATGCAGACCTCGCTGGG - Intronic
1125806465 15:42497591-42497613 CCTCATCTTCCCAAGGTGCTGGG + Intronic
1128323392 15:66707560-66707582 CCTCACCTCCAGGAGGAGCTAGG - Intronic
1128765196 15:70247106-70247128 CTTCATCTGCAGAGGTCTCTGGG + Intergenic
1129339200 15:74873756-74873778 CTTCTTCTGCAGAACGTGCTCGG + Intergenic
1129568868 15:76656601-76656623 TCTCATCTGCACAAGGCACATGG + Intronic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1136287191 16:29251493-29251515 GCCCTTCTGCAGAAGGAGCTCGG - Intergenic
1138421887 16:56904390-56904412 CCTCACCTGCCGAAGGGACTGGG - Exonic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1141490188 16:84367675-84367697 CTTCATCATCAGAAGGTGCTGGG - Intergenic
1141508777 16:84499079-84499101 CCTCATCTGTTTGAGGCGCTGGG + Intronic
1142092801 16:88224126-88224148 GCCCTTCTGCAGAAGGAGCTCGG - Intergenic
1142185089 16:88691090-88691112 CCTCATCTGCCGCAGGCCCAAGG - Intergenic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1146264769 17:31445118-31445140 CACCATCTGCAGCAGGAGCTTGG - Intronic
1148741135 17:49893459-49893481 CCTCCTCTGTACAAGGTGCTGGG - Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151285153 17:73105595-73105617 CCCCATGTGCAGAAGGAACTGGG - Intergenic
1152198878 17:78933803-78933825 CCACAGCTGCAGAAGCCTCTTGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152997660 18:423151-423173 CCTCATCTTCCCAAGGAGCTAGG - Intronic
1153851235 18:9097050-9097072 CTTCAGCTGCAGAAGCTGCTAGG + Intergenic
1156624040 18:38886990-38887012 CCTCATCTCCACAAGGGGCTGGG - Intergenic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1158904069 18:61994286-61994308 CCTCATTTGCTGAAAGCGCTGGG + Intergenic
1160127211 18:76186668-76186690 CCTGATCCACAGCAGGCGCTAGG + Intergenic
1160817866 19:1044572-1044594 CTGCATCTGCAGGAGCCGCTGGG - Exonic
1161249159 19:3271135-3271157 CCTCATCTGCCCAAGGTGCTGGG + Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163887075 19:19975420-19975442 CCTCATCTGCACAAAGTCCTGGG + Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164790394 19:30972572-30972594 TGTCATCTGCAGAGGGGGCTAGG - Intergenic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167419244 19:49393573-49393595 CCTCAACTGCAGGAGCCACTGGG - Intronic
925912942 2:8584863-8584885 CTTCACCTGCAGGAGGAGCTGGG - Intergenic
927494966 2:23546057-23546079 TCTCAGCTGCAGCAGGCCCTGGG - Intronic
927794014 2:26033249-26033271 CCTCCTCTGCAGAGCGCTCTCGG + Intergenic
929418651 2:41768919-41768941 CCTCAGCTGTAGAAGGCACCGGG - Intergenic
929670250 2:43871746-43871768 CCACATCTGCAGAAGCCTCAGGG - Intronic
929819467 2:45261698-45261720 CCTCATCTGCTGAAGGCTCCCGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931694129 2:64859560-64859582 CCTCATCTGTAGCTGGGGCTGGG - Intergenic
934893312 2:98089215-98089237 CCTCATACGCAGCAGGCACTTGG - Intronic
936037878 2:109127592-109127614 CCTCATCTTCACAAAGTGCTGGG - Intergenic
940059899 2:149553469-149553491 CATCATATGCAGAAGGTCCTGGG + Intergenic
940699606 2:157024290-157024312 CCTCATAGGCAGAAGGGACTTGG + Intergenic
942795497 2:179814148-179814170 CCTCAGGGGCAGAAGGGGCTGGG + Intronic
947399098 2:229714537-229714559 CCGCAGCTGCAGGAGGCGCCCGG - Exonic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1169823735 20:9743115-9743137 CCTCAGCTTCCCAAGGCGCTGGG - Intronic
1170562581 20:17569933-17569955 CCTCATCTGCTGAAGGCTGCGGG - Exonic
1171265749 20:23771174-23771196 CTTCATCTGGAGTAGGGGCTGGG + Intergenic
1172660139 20:36562413-36562435 CCTCAGCTGCAGGAGTAGCTGGG - Intergenic
1173218061 20:41105743-41105765 CCTCAGCTGCACAAAGTGCTGGG + Intronic
1174087250 20:48018180-48018202 CCTCCTGTCCAGAAGGCCCTTGG + Intergenic
1174129033 20:48328788-48328810 CCTCCTATCCAGAAGGCCCTTGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1176064650 20:63188258-63188280 CTCCATCTGCAGCAGGTGCTGGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1179181977 21:39053447-39053469 CCTCAGCAGCAGAGGGGGCTGGG - Intergenic
1179521823 21:41950717-41950739 CCCCTTCTGGAGAAGGGGCTTGG + Intronic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1183781283 22:40000544-40000566 CCTGGTATGGAGAAGGCGCTTGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184645502 22:45892610-45892632 CCTCATGTGCTCAAGGCCCTGGG + Intergenic
1185104696 22:48860752-48860774 GCTCCTCTGGGGAAGGCGCTCGG + Intergenic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
951650160 3:24942407-24942429 CCTCATCTGAAGAGGTGGCTTGG + Intergenic
953326281 3:42014271-42014293 CCGCACCTGCAGGAGGCCCTCGG + Intronic
954358011 3:50098828-50098850 CCTCATCTTCCCAAAGCGCTAGG + Intronic
955867447 3:63400029-63400051 CATCCTCTGCAGAATGGGCTGGG - Intronic
955977502 3:64492392-64492414 CCACATCTGCAAAAGAGGCTGGG + Intergenic
961470310 3:127107239-127107261 CCTCATCGGCAGATGAAGCTGGG - Intergenic
961666125 3:128493962-128493984 CCTCATCCCCAGAAGGCCCCTGG + Intergenic
963779873 3:149476290-149476312 CCTCATCTGCAAAGGGGACTTGG + Intronic
966777464 3:183555563-183555585 GCTCATCTGTAGAAGGTGCCAGG + Exonic
967023607 3:185544603-185544625 CCTCAGCTGCCCAAGGTGCTGGG + Intronic
967214527 3:187199236-187199258 CCTCATGGGCAAAATGCGCTTGG - Intronic
968816347 4:2823743-2823765 CCTCATAGGCAGGAGGGGCTGGG - Intronic
968926311 4:3550234-3550256 GCTCATCTGCAAAGGGGGCTGGG + Intergenic
969185606 4:5471998-5472020 CCTCAGCTACAGAAAGCTCTTGG + Intronic
969957254 4:10903604-10903626 CCTCAGCTGCACAAAGTGCTGGG - Intergenic
973777803 4:54259191-54259213 CCTCAGCTGCTCAAGGGGCTGGG - Intronic
975321936 4:73018717-73018739 CTACCTCTGCAGAAGGCGCTGGG + Intergenic
975579331 4:75892476-75892498 CCTCATCTGGAAAAGGGGCGGGG + Intronic
975724832 4:77281809-77281831 TCTCATCTGCTGAAGGCTCAGGG - Intronic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
982018211 4:151176844-151176866 CATCATCTGCAGCAGGCTCTTGG - Exonic
982829458 4:160042657-160042679 GCTCATCGGCAGAAGGGACTTGG - Intergenic
984923042 4:184782719-184782741 CCTCCCCTGTAGAAGGAGCTAGG - Intronic
987741976 5:21920948-21920970 CCTCCTCTGCAGCAGATGCTTGG + Intronic
995107563 5:108392056-108392078 CCTCATCTCCACAAGGTACTGGG + Intergenic
995401449 5:111746930-111746952 CCTCTGATGCAGAAGGCACTAGG + Intronic
996776803 5:127141441-127141463 CCTCATCCTCAGAAAGTGCTGGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
1000761558 5:165231696-165231718 CCTGTTCTGGATAAGGCGCTGGG + Intergenic
1001058551 5:168468990-168469012 CGTCATCTGCAGAGAGAGCTGGG - Exonic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001565666 5:172697627-172697649 GCTCCTCGGCAGAAGGCGCGGGG + Intergenic
1002151460 5:177235638-177235660 TCTCATATGCAAAAGGAGCTGGG - Intronic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1004955776 6:20726166-20726188 CCTCATCTGCAGAATAACCTTGG + Intronic
1007521742 6:42455237-42455259 CCTCATCCGCCCAAAGCGCTGGG - Intergenic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1010977691 6:82334714-82334736 CCTCAGCTTCAGAAGTAGCTGGG + Intergenic
1011728491 6:90235138-90235160 CCTAATTTGCAGAAGTTGCTAGG + Intronic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1016859832 6:148706381-148706403 CTTCATCTGCAGACTGTGCTGGG + Intergenic
1018808736 6:167281809-167281831 CCACATCTGCAGGTGGAGCTTGG + Intronic
1020035850 7:4962753-4962775 CCTCATCGGCAGGAGGGGATAGG - Intergenic
1024283848 7:47740134-47740156 CCTCCTCTGCAGAGGGGGCCTGG + Intronic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1029682477 7:102121281-102121303 CCTCAGCTGCTGGAGGAGCTGGG + Intronic
1031965539 7:128025648-128025670 CCTCCTCTGTAGCAGGCACTTGG - Intronic
1031999712 7:128256842-128256864 CCTCTTTTCCAGAAAGCGCTCGG - Exonic
1032197086 7:129795545-129795567 CTTCAGCTGCAGAGGGCACTTGG - Intergenic
1033137595 7:138798028-138798050 ACTCACCTGCAGCAGGCACTCGG + Exonic
1034830074 7:154301308-154301330 CCTCTTCTGTGCAAGGCGCTTGG + Intronic
1037913731 8:22759425-22759447 CCCGATATGCAGAAGGCACTTGG - Intronic
1038260531 8:25989562-25989584 CCTCATATGCCGGAGGCGCTTGG + Intronic
1039822507 8:41146368-41146390 CCTTATCTGCAGAAAGCACAAGG - Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1048207190 8:132424549-132424571 CCTCATCAGGAGAAGGTCCTAGG + Intronic
1049201778 8:141343856-141343878 CCTCACCTGGAAAAGGGGCTTGG + Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1050366905 9:4881225-4881247 CCTCATCTTCCGAAAGTGCTGGG - Intronic
1052964935 9:34333047-34333069 CCTCATCTGGAGGAGGGTCTGGG + Intronic
1053801238 9:41765640-41765662 GCTCATCTGCAAAGGGGGCTGGG + Intergenic
1054143963 9:61549197-61549219 GCTCATCTGCAAAGGGGGCTGGG - Intergenic
1054189667 9:61977790-61977812 GCTCATCTGCAAAGGGGGCTGGG + Intergenic
1054463742 9:65480553-65480575 GCTCATCTGCAAAGGGGGCTGGG - Intergenic
1054648848 9:67610819-67610841 GCTCATCTGCAAAGGGGGCTGGG - Intergenic
1055027269 9:71735665-71735687 CCTCAGCTGCCCAAGGAGCTGGG - Intronic
1057042257 9:91856238-91856260 CCTCAGCTGCACAAGTAGCTGGG - Intronic
1059441064 9:114307150-114307172 CCTCCTCTGCACAAGCGGCTGGG + Intronic
1059651475 9:116319679-116319701 TCTCATCTGCAGAATGGACTGGG + Intronic
1059997344 9:119924939-119924961 CCTCACCTGCAGAGGGCTTTAGG + Intergenic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062412755 9:136433244-136433266 ACTCGTCTGCAGGAGACGCTGGG - Exonic
1203785017 EBV:122772-122794 CCTCATCTACATAAGGGCCTAGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1191782855 X:64886912-64886934 CCTCAGCTGCAGGAGATGCTGGG + Intergenic
1193944928 X:87723300-87723322 CCTACTCTTCAGAAGGCCCTAGG - Intergenic
1196722196 X:118864847-118864869 CCTCATCTGCTGGAGGGGCAAGG + Intergenic
1198040003 X:132841354-132841376 CCTCCTCTGTAGAAGACCCTTGG + Intronic