ID: 1049378777

View in Genome Browser
Species Human (GRCh38)
Location 8:142301784-142301806
Sequence CAGGGTTTTCAGGAAGATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049378777_1049378784 -8 Left 1049378777 8:142301784-142301806 CCCCGATCTTCCTGAAAACCCTG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1049378784 8:142301799-142301821 AAACCCTGCAGGGAGGAGCCAGG No data
1049378777_1049378794 30 Left 1049378777 8:142301784-142301806 CCCCGATCTTCCTGAAAACCCTG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1049378794 8:142301837-142301859 GAGGACACTGAGGCAGAGCGAGG No data
1049378777_1049378785 -7 Left 1049378777 8:142301784-142301806 CCCCGATCTTCCTGAAAACCCTG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1049378785 8:142301800-142301822 AACCCTGCAGGGAGGAGCCAGGG No data
1049378777_1049378792 20 Left 1049378777 8:142301784-142301806 CCCCGATCTTCCTGAAAACCCTG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1049378792 8:142301827-142301849 CACAACAGCCGAGGACACTGAGG No data
1049378777_1049378789 11 Left 1049378777 8:142301784-142301806 CCCCGATCTTCCTGAAAACCCTG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1049378789 8:142301818-142301840 CAGGGCCTCCACAACAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049378777 Original CRISPR CAGGGTTTTCAGGAAGATCG GGG (reversed) Intronic
900087715 1:906330-906352 CAGAGTTTCCAGGAAGAGTGGGG + Intergenic
903552169 1:24165408-24165430 CAGGCTTTTCACGATGATTGAGG + Intronic
905645027 1:39619314-39619336 CAGGGCTTTCAGCAAAATCTGGG - Intergenic
905672705 1:39802717-39802739 GAGGGTTGTCAGGGACATCGGGG - Intergenic
906126869 1:43432298-43432320 CAGGGTCTTCAAGAAGAACATGG - Exonic
906603830 1:47151243-47151265 CAGGCTTCTCAGGAAGCTCATGG + Intergenic
911063818 1:93770084-93770106 AAGGCTTTTCAGCAAGATAGTGG + Intronic
916354891 1:163893916-163893938 CAGAGTTTTCAGGAAGAGAAAGG + Intergenic
916679218 1:167089116-167089138 CACGGTTTGGAGGAAGATCTGGG - Intronic
921285673 1:213607099-213607121 CAATGTTTTCAGGAAGAATGAGG + Intergenic
923616861 1:235545387-235545409 CAGGGTTTTCAGGGGGAGTGAGG + Intergenic
1062932149 10:1360468-1360490 CAGGGTTTTGGGGAAGGTTGGGG + Intronic
1063818239 10:9802206-9802228 CAGGGTTTTTATGAAGATGTTGG + Intergenic
1065529454 10:26653580-26653602 CAGAATTTTCAGGAAAATAGAGG + Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1071722773 10:88163984-88164006 CTGGGGGTTCAGGAAGATCTGGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1075048918 10:119167234-119167256 CAGGGTTTTGATGAGCATCGAGG - Intergenic
1075091409 10:119445996-119446018 CAGGGGTTTGGGGAAGATGGAGG - Intronic
1075418878 10:122286177-122286199 CAGGGCTTTCAGGTAGAGCTTGG - Exonic
1075456215 10:122586696-122586718 CAGGTTGTTCATGAAGATAGAGG + Intronic
1078939395 11:15985065-15985087 CAGTGTTTTCGGGAGGAGCGTGG - Intronic
1079785545 11:24666848-24666870 CAGATTTTTCAGCAAGATCCTGG - Intronic
1080430194 11:32190703-32190725 CAGGGTGCTCAGGAAGAACTTGG + Intergenic
1081826322 11:46056792-46056814 CAGGGTTTTCAGGAAGCACAAGG - Intronic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1084063193 11:66688860-66688882 CGGGGGTTGCAGGAAGATGGTGG + Intronic
1085496312 11:76973041-76973063 CAGGGCTCTCAGGATGATCTAGG + Intronic
1087408513 11:97760541-97760563 CAGGGACTTCAGGAGGATTGTGG + Intergenic
1087740471 11:101881358-101881380 CAGGGTTGTCTGGAACATTGTGG - Intergenic
1089981748 11:122778311-122778333 AAGGGTTTTGAGAAAGATCCTGG - Intronic
1090496472 11:127217635-127217657 CAGGGATTTCAGGCAGGTCTGGG - Intergenic
1091397250 12:161607-161629 CAGGGTTAGCAGGAACATGGAGG + Intronic
1092595548 12:10000738-10000760 CAGGCTTTTCTGGAAGATTGGGG + Intronic
1094363329 12:29653299-29653321 GAGGGCCTTCAGGAAGATGGTGG + Intronic
1096031612 12:48421188-48421210 CAGGGTTTACAGGAAGCATGAGG + Intergenic
1096861449 12:54531641-54531663 CAGGGTTTTCAGGAATCTGGAGG + Intronic
1097579011 12:61430932-61430954 CAGAGTTTTCAGAAAGTTTGAGG - Intergenic
1098244444 12:68501867-68501889 CAGGGTTTGCAGGTAGACCTTGG - Intergenic
1100928828 12:99582931-99582953 CAGGTATTTCAGGAAAATAGAGG - Intronic
1103344833 12:120242288-120242310 CAGAGTGTTCAGGAAGACCATGG + Intronic
1104016326 12:124964798-124964820 CAGAGTTTTGAGGAATATTGGGG - Intronic
1104888244 12:132124711-132124733 CAGTGCATTCAGGAAGCTCGGGG + Intronic
1107335133 13:39346743-39346765 CAGGGTTTTAAGTAAGAGCATGG - Intronic
1108125407 13:47237334-47237356 CAGGGATCTCAGGAAGAAGGAGG + Intergenic
1112431421 13:99354060-99354082 CAGGGGATGCAGGCAGATCGTGG + Intronic
1112725731 13:102302377-102302399 CAGGGATTTGAGGAAGAACCTGG - Intronic
1116014494 14:39389898-39389920 CATGGTTTTCAGGCATTTCGGGG - Intergenic
1116749550 14:48866150-48866172 CAGGGTGTACAGGAAGAACATGG - Intergenic
1117327907 14:54685792-54685814 CATGATTTTCAGGCAGATTGAGG + Intronic
1117858518 14:60062758-60062780 CAGGGATGCCAGGAAGATGGGGG - Intronic
1119601989 14:75982580-75982602 TGGCGTTTTCCGGAAGATCGAGG + Intronic
1119650686 14:76380900-76380922 CAGGATGTTCAGGAAGATTCCGG - Intronic
1122046429 14:99027270-99027292 CAGGGCTTGGAGGAAGATGGTGG - Intergenic
1125224748 15:37382981-37383003 CTGATTTTTCAGGAAGATTGTGG - Intergenic
1128487525 15:68109577-68109599 GAGGGTTTTCAGGAACTTCTGGG - Intronic
1128630477 15:69260969-69260991 CAGGGTTATCAGGAAGTTGTGGG - Intronic
1128686119 15:69687013-69687035 CTGGGTTTCCAGGAAGCTCTGGG + Intergenic
1128770320 15:70277119-70277141 CAGGGGTTACAGAAAGAGCGTGG - Intergenic
1135511354 16:23086765-23086787 AAGGGTTTTAAGGAAGAATGTGG + Intronic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1140553340 16:75892165-75892187 CAAGGTTTTAAGGGAGATCATGG - Intergenic
1144370619 17:14587317-14587339 GAGGGTTTGCAGGAAGATCTGGG + Intergenic
1147915008 17:43880782-43880804 CAGGGTTTTCCGGCGGAACGGGG + Exonic
1150179353 17:63099602-63099624 CTAGGTTTTCAGGAAGTTCCTGG + Intronic
1150610252 17:66727778-66727800 CTGGGTCTTCAGGAAGACAGAGG + Intronic
1151423022 17:74011045-74011067 CAGGGGGTGCAGGAAGAACGAGG + Intergenic
1152512626 17:80800759-80800781 TAGGGTTTTCAGAAAGCTCCGGG + Intronic
1156477721 18:37416693-37416715 CTGGGTCTTCAGGAAGCTAGGGG + Intronic
1157004426 18:43564944-43564966 CTAGGTTTTCTGGAAGATCAAGG - Intergenic
1158684264 18:59598790-59598812 GAGGGTTTTCAAAAAGATCATGG - Intronic
1159860613 18:73644331-73644353 AAGGGTTGTCAGGAAGGTGGAGG + Intergenic
1161413570 19:4131438-4131460 CAGGGGTTCCAGGAAGACCTGGG + Intergenic
1161504807 19:4638341-4638363 CACGGGATTCAGGAAGACCGAGG - Intergenic
1161877972 19:6926613-6926635 CAGGGTCTTCAGGAAGAGAGAGG - Intronic
1162156375 19:8680891-8680913 TAGTGTTTTGAGGAAGATTGAGG + Intergenic
1165131500 19:33635237-33635259 CAGCGTTTTCATGAAGACCGTGG + Intronic
1165406166 19:35632672-35632694 CAGGGTTCTCAGGGAGCTCCTGG - Intronic
1165622796 19:37262545-37262567 CAGGGATTCCAGGAGGATCCAGG - Intergenic
1165634490 19:37329175-37329197 CAGGGATTCCAGGAGGATCCAGG - Intronic
1166756877 19:45197927-45197949 CAGAGTTTGCAGGAAAATCTGGG + Intronic
1168653319 19:58107968-58107990 CAAACTTTTCAGGAACATCGCGG - Intronic
925224069 2:2167399-2167421 CAGGGTCTCCAGGAAGACAGAGG - Intronic
925299176 2:2798065-2798087 CAGGGTTTTCAGCTAGTTAGTGG - Intergenic
925680874 2:6420222-6420244 CAGTTTTCTCAGGAAGATCCTGG + Intergenic
926389898 2:12378831-12378853 CAGGTTTTTCAGAATGATCAGGG + Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
929883293 2:45855938-45855960 CAGGGTTTTCATGATGATGATGG + Intronic
933139457 2:78776180-78776202 CATGCTTTTCAGGGAGATGGTGG + Intergenic
934649913 2:96084870-96084892 CAGGGGCTTCATGAAGAACGAGG + Intergenic
938615835 2:132997283-132997305 TTGGGTTTTCAGGAAGATGGTGG + Intronic
939964339 2:148595706-148595728 CAGGGTTTTGAGGAGGACAGTGG + Intergenic
947105424 2:226663430-226663452 CAGAGTTTCCAGGAAGTTGGGGG - Intergenic
947500133 2:230665560-230665582 CAGAGCGTTCAGGAAGATCATGG - Intergenic
947751257 2:232533926-232533948 CAGGGTCTCCAGGAAGAGCTGGG - Exonic
948321231 2:237071507-237071529 AAGGGTTATCAGGAAGAACATGG + Intergenic
1170805620 20:19628302-19628324 CAGTGATTTCAGCAAGATGGTGG + Intronic
1174150968 20:48486166-48486188 CATGGTTATCATGAAGCTCGGGG - Intergenic
1180324376 22:11355786-11355808 GAGAGTTTTCAGGAAAAACGAGG + Intergenic
1181931190 22:26402914-26402936 CAGAGTTCCCAGGGAGATCGGGG + Intergenic
1185163541 22:49244044-49244066 GTGGGTTTTCAGGAAGATTTTGG - Intergenic
1203278528 22_KI270734v1_random:109645-109667 GTTGGTTTTCAGGAAGATCACGG + Intergenic
952835490 3:37598544-37598566 CAGGGGGGTCAGGAAGATCTTGG + Intronic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954573989 3:51664718-51664740 ATGGCTTTTCAGGAAGATCAGGG + Exonic
956573457 3:70724052-70724074 CAGGGCTTATAGGAAGATGGTGG + Intergenic
957508861 3:81161121-81161143 TAGGGTTTTCAGAAAGATTATGG - Intergenic
960052550 3:113252315-113252337 CAGGGCTTTCAGGGATAACGGGG - Intronic
961033158 3:123623981-123624003 TAGGGTTTTCTGGAAGGGCGGGG - Intronic
961450123 3:126998904-126998926 CAGGATTTGCAGGAAGCCCGAGG - Intronic
963434026 3:145244957-145244979 CAGTGTGTACAGGAAGATGGAGG + Intergenic
963607256 3:147421732-147421754 CAGGGTAGTCAGGAATGTCGCGG + Intronic
964907312 3:161733261-161733283 CAGGGTTGTCAGGAATATTATGG - Intergenic
964919921 3:161884227-161884249 CAGGCTTTTCAGGAAGCTTGGGG - Intergenic
965396319 3:168164037-168164059 CGGGGTTTTCTGGAAGAGTGTGG + Intergenic
967364327 3:188668881-188668903 AAGGATTTCCAGGAAAATCGTGG - Intronic
968080927 3:195846595-195846617 CAAGGTTTGCAGGAAGCCCGTGG - Intergenic
970473810 4:16402155-16402177 CAGGCTTTCCAGGAAGAGTGAGG - Intergenic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
972583574 4:40416562-40416584 CAGGATTGTCATGAAGATCAGGG + Intergenic
978259707 4:106740649-106740671 TAGGTTTTTCTGGAAGATGGAGG + Intergenic
978836654 4:113158571-113158593 CAGGGTTTTAAGGTAGACCCAGG + Intronic
982786333 4:159541359-159541381 CAGTGTTGTCAGAAAGATCTAGG + Intergenic
985374652 4:189322295-189322317 CAGAGTTTTCAGTAAAGTCGAGG + Intergenic
987064814 5:14279526-14279548 CGGGGTTGTCAGGAAAATAGAGG - Intronic
991911428 5:71566153-71566175 CAGGATTTTCATGAGGATAGGGG + Exonic
995045897 5:107646604-107646626 CAGTGTTTACAGGGAGATCCAGG - Intronic
997417173 5:133738021-133738043 CAGGGTTATCAGGTAGCTCTTGG + Intergenic
1001699851 5:173698941-173698963 CAGTGTTCTCAGGAAGCTAGGGG + Intergenic
1003120390 6:3314496-3314518 CAGGGTCTTCAGGAAGATTTAGG + Intronic
1005498951 6:26413254-26413276 CAGGGTTGTCTGGCAGATCCTGG - Exonic
1006978196 6:38123491-38123513 CAGGGTTTTCTGGTGGATCTAGG - Intronic
1007198369 6:40083390-40083412 TAGGGTTTTCAGTAAAATCCTGG - Intergenic
1009516902 6:64631443-64631465 GAGGATTTTCAGGAAGGTCTTGG - Intronic
1013308605 6:108872734-108872756 AAGGGTTTTCAGCAAGAGGGTGG - Intronic
1014329787 6:120048549-120048571 CCAGGTTTTCAGGATGATAGGGG - Intergenic
1014831199 6:126104794-126104816 AAGGGTTTTCATGAAGATTAAGG - Intergenic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1015455529 6:133423129-133423151 GAGGGTTTGCAGGAGGATCAGGG + Intronic
1016394032 6:143603633-143603655 TAGTGTTTCCAGGAAGATCTGGG - Intronic
1019436341 7:1024196-1024218 CAGGGTTTTTAGGAAGAAAGTGG - Intronic
1021281817 7:18728992-18729014 CTGGGTTTTCCGGAATATCTGGG - Intronic
1024474036 7:49791871-49791893 CAGGCTTTCCAGGAAGACAGTGG - Intronic
1024595993 7:50938097-50938119 CAGGGTTTTCAGGGATACCTGGG + Intergenic
1026178321 7:68017045-68017067 CAGGGTTTTCAGCACCATAGTGG - Intergenic
1026192906 7:68145944-68145966 CAGTGCTTTCAGGGAGATCTGGG + Intergenic
1026257155 7:68722297-68722319 CAGCGTTTACAGGAAGAAGGAGG + Intergenic
1028852173 7:95550102-95550124 CATGGTTTACAGGAACATCCAGG + Intergenic
1037686606 8:21144891-21144913 GAAGGTTTTCAGGAAGCTGGAGG - Intergenic
1038437637 8:27547221-27547243 TAGGTTTTTCAAGAAGATAGTGG + Intergenic
1040418602 8:47218757-47218779 CAGGGTTTTCATGAGGCTAGGGG + Intergenic
1045306787 8:100964473-100964495 CAGAGTTTACAAGAAGATAGAGG + Intergenic
1045557916 8:103232622-103232644 CAGGGTTTTTGGCAAGATAGGGG + Intergenic
1046019674 8:108649708-108649730 TAGGGTTTTCAGGGAGATAAAGG - Intronic
1049216851 8:141412266-141412288 CAGGGTGTCCAGGAAGCTTGTGG - Intronic
1049238962 8:141526932-141526954 CAGGGTTTTCAGGAGGTCAGTGG + Intergenic
1049378777 8:142301784-142301806 CAGGGTTTTCAGGAAGATCGGGG - Intronic
1051678983 9:19587965-19587987 CCTGGTTTTCAGGAAGACTGTGG + Intronic
1055982233 9:82015508-82015530 CAGGTTTTTCAGGAAGCATGGGG - Intergenic
1059235539 9:112757871-112757893 CAGGGTTCTCAGGAAGCTCAAGG + Intronic
1060733365 9:126051496-126051518 CAGGGTTTGTAGGAGGATCTGGG + Intergenic
1185554541 X:1010080-1010102 CATGGTGTTCAGGGAGTTCGTGG - Intergenic
1188425976 X:30047261-30047283 TAGTGTTTTTAGGAAGATCTGGG - Intergenic
1193295100 X:79824303-79824325 TGGGGTTTACAGGAAGATTGAGG + Intergenic
1193753439 X:85376223-85376245 TAAGGTTTTCATGAAGTTCGAGG - Intronic
1195770352 X:108344440-108344462 CAGAGTTTTCAGAAAGATTTTGG + Intronic
1200983080 Y:9279827-9279849 CAGGGATTTCAGGAAGGACAAGG - Intergenic
1202127298 Y:21579871-21579893 CAGGGATTTCAGGAAGGACAAGG + Intergenic