ID: 1049380739

View in Genome Browser
Species Human (GRCh38)
Location 8:142314562-142314584
Sequence CCAGAAGAGGCTGCCGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 1, 2: 1, 3: 44, 4: 401}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049380739 Original CRISPR CCAGAAGAGGCTGCCGGGGC CGG Intronic
900001625 1:17807-17829 CCAGAGGAGGCTGACTGGGATGG - Intergenic
900021346 1:188331-188353 CCAGAGGAGGCTGACTGGGATGG - Intergenic
900165614 1:1243243-1243265 CCAGGAGTGGCTGCTGGGGCTGG + Intronic
900366773 1:2314827-2314849 GCGGAAGAGGCGGCGGGGGCGGG - Intergenic
900399527 1:2467339-2467361 CCAGCAGAGGCTGCTGGGCCCGG + Intronic
900625393 1:3606207-3606229 CCAGGAGAGGCTGCTGGTCCTGG - Intronic
900698518 1:4028054-4028076 CCAGGACAGGCTGTTGGGGCTGG - Intergenic
901019302 1:6247922-6247944 CCAGAAGAAGCTGCTGGGGTGGG - Exonic
901678739 1:10901381-10901403 CCAGATGAGGGTGAGGGGGCAGG + Intergenic
901778467 1:11576704-11576726 GGAGAAGAAGCTGCAGGGGCCGG - Intergenic
902177132 1:14658936-14658958 TTAAAAGAGGCTGCCAGGGCTGG + Intronic
903186697 1:21633302-21633324 CCAGGACAGGCGGCTGGGGCAGG - Intronic
903750555 1:25617965-25617987 CCAGACCAGGCTGCTGGGTCCGG - Exonic
904585921 1:31580558-31580580 CCAGAGGAGTCTGCAGGGCCGGG - Intronic
906212420 1:44019603-44019625 CCAGAACAGGCAGCCATGGCTGG + Intronic
906318883 1:44804710-44804732 CCAGCTGAGGCTGCAGGGCCCGG - Exonic
907237461 1:53062107-53062129 CCAGCAGATGCTCCCGGGGCGGG + Intronic
907261214 1:53220245-53220267 CCTGAAGGTGCGGCCGGGGCGGG - Exonic
907338371 1:53715670-53715692 CAAGAAGGAGCTGCCGGTGCAGG + Intronic
912511101 1:110190639-110190661 TCAGAAGGGGCAGCCGGGCCAGG + Intronic
912548597 1:110469008-110469030 CCAGATGAGGACGCCGAGGCTGG + Intergenic
915147255 1:153802492-153802514 GCAGAGGAGGCTGCCCGGGTAGG - Intergenic
915894360 1:159800039-159800061 CCAGAAGAGGCTCCAGGCCCAGG - Intergenic
915980148 1:160415398-160415420 CCAGCAAAGGCTCCCAGGGCAGG - Intronic
916556555 1:165898840-165898862 TCTGAACAGGCTGCCTGGGCAGG + Intronic
917111956 1:171557744-171557766 GGGGAAGAGGCTGCTGGGGCTGG - Exonic
917962278 1:180154732-180154754 CCAGGAGCGGCCGGCGGGGCGGG + Intergenic
918000814 1:180493393-180493415 CCACAACAGGCTGCCAGGACAGG + Intronic
918311672 1:183289664-183289686 CCAGGACAGGCTGCTGTGGCTGG - Intronic
919974631 1:202602636-202602658 CCAGAGGAGGCAGTTGGGGCAGG + Intronic
920265334 1:204717258-204717280 CCAGAAGAAGATGTCTGGGCTGG + Intergenic
920665895 1:207962964-207962986 CCAGACGATGCTGGCGGGCCTGG + Intergenic
921196180 1:212760118-212760140 CCAGAAGCAGCTGGCGGGGCAGG - Intronic
922472848 1:225887541-225887563 GCAGCAGCGGCTGCCGGGGCCGG + Exonic
922480860 1:225939503-225939525 GCAGCAGCGGCTGCCGGGGCCGG + Exonic
922593953 1:226799329-226799351 ACAGAAGAGGCTCCCAGGCCTGG - Intergenic
922800294 1:228361975-228361997 CCAGGTGGGGCGGCCGGGGCCGG + Intronic
922950973 1:229558428-229558450 GGAGGAGCGGCTGCCGGGGCGGG - Exonic
922977841 1:229799825-229799847 CATGAAGAGGCTCCCAGGGCCGG + Intergenic
923676342 1:236083819-236083841 GCTGAAGAGGCTGCCTGGCCAGG - Intergenic
923678817 1:236102672-236102694 CCACCCCAGGCTGCCGGGGCAGG - Intergenic
924616702 1:245617953-245617975 CCAGAAGAGGCAGAAGGGGCAGG - Intronic
924784716 1:247184371-247184393 GAAGAAGGGGCTGGCGGGGCAGG - Intergenic
1062794080 10:329610-329632 AAAGAAGAGGCTGTCAGGGCGGG + Intronic
1062905248 10:1175504-1175526 CCAGAAGTGGCTCCTGGGGTTGG - Intergenic
1063429450 10:5976804-5976826 CCAGCAGAGGCGGTCGGGACCGG - Intronic
1063886367 10:10583581-10583603 TCAGACCAGGTTGCCGGGGCAGG + Intergenic
1064316566 10:14263230-14263252 CCAGACGGGGCTGGCGGGGAGGG - Intronic
1065918031 10:30368432-30368454 GCAGGAGAGGCTGCAGGAGCTGG - Intronic
1067048204 10:42997690-42997712 CCAGATGAGGATGCTGGGACTGG - Intergenic
1067098363 10:43317067-43317089 CCTGCAGAGGCTCCCAGGGCAGG - Intergenic
1069420404 10:68241586-68241608 CCAGTGGTGGGTGCCGGGGCTGG - Intergenic
1069863083 10:71483293-71483315 CCACAAGAGGCTGGTGGGGAGGG + Intronic
1069945324 10:71981547-71981569 CCAGAAATGGCTGCCTGGGGGGG - Intronic
1070201244 10:74207992-74208014 CCAGAGGGGGCTGAGGGGGCAGG + Intronic
1070307418 10:75247954-75247976 CCCAGAGAGGCTGCCAGGGCTGG - Intergenic
1070401444 10:76056589-76056611 CCAGAAGGGGCTGAGGTGGCAGG + Intronic
1071544972 10:86522005-86522027 CTAGAAGTGGCTGCCGAGACCGG - Intergenic
1071567637 10:86680013-86680035 CCAGAAGCTCCTGCCTGGGCAGG - Intronic
1071601134 10:86959252-86959274 CCAGGAGAGGATGCGGGGGAGGG - Intronic
1072565794 10:96615681-96615703 TGAGAAGGGGCTGCCAGGGCTGG + Intronic
1072746048 10:97939815-97939837 CCAGCAGGGGCAGTCGGGGCAGG - Intronic
1073035689 10:100562856-100562878 CGGGAGGAGGCGGCCGGGGCTGG + Intergenic
1073462844 10:103676526-103676548 CTAGAAGGGGCTGCCCTGGCAGG + Intronic
1073945062 10:108740876-108740898 CCAGCAGAGGCTGCAGTAGCAGG - Intergenic
1074363150 10:112838670-112838692 ACAGAAGACGCTGGAGGGGCAGG + Intergenic
1075285632 10:121183468-121183490 CCAGAAGAGGATGCAGCTGCAGG + Intergenic
1075516499 10:123112868-123112890 CCAGCAGAGGCTGCAGAGGCTGG + Intergenic
1075576421 10:123580872-123580894 CCAGGTGAGGCTGGAGGGGCAGG - Intergenic
1076316413 10:129544922-129544944 CCAGAAGAGGCGGCGTGGCCAGG + Intronic
1076351238 10:129816350-129816372 CCAGGAGAGGCTGGAGAGGCTGG + Intergenic
1076639616 10:131905388-131905410 CCAGGAGAGGGAGCAGGGGCTGG - Intronic
1076655967 10:132023586-132023608 CCAGAAGGGGCAGCAGGGCCAGG + Intergenic
1076757156 10:132578629-132578651 CCAGGAGAGTGTGCGGGGGCTGG + Intronic
1076757188 10:132578747-132578769 CCAGGAGAGTGTGCAGGGGCTGG + Intronic
1076781243 10:132725811-132725833 CCAGGTGGGGCTGCCAGGGCAGG - Intronic
1077237034 11:1486771-1486793 CCAGAAGAGGCGGTGGGGGTGGG + Intronic
1077237065 11:1486873-1486895 CCAGAAGAGGCGGTGGGGGTGGG + Intronic
1077237095 11:1486975-1486997 CCAGAAGAGGCGGTGGGGGTGGG + Intronic
1077501701 11:2912382-2912404 CCAGAACAGGCTGCAGGCGTTGG - Intronic
1079018378 11:16888274-16888296 CCAGAAGGGGCAGCCGGGCAGGG - Intronic
1080908796 11:36574483-36574505 ACAGAAGATGTTGGCGGGGCCGG - Exonic
1081633887 11:44707845-44707867 ACAGAGGAGGCTGCCAGGGGAGG + Intergenic
1081773832 11:45664989-45665011 CAGGAAGGGGCTGCCGGGGCTGG - Intronic
1081799280 11:45847107-45847129 CTAGAAGAAGCTGCCTGGGCTGG - Intronic
1083232635 11:61332889-61332911 ACCGGTGAGGCTGCCGGGGCCGG - Exonic
1083303870 11:61752925-61752947 CCAAGACAGGCTCCCGGGGCTGG + Intronic
1084151247 11:67289009-67289031 CCGGAAGAGGAAGGCGGGGCCGG - Intronic
1084152752 11:67298894-67298916 CCTGAAGAGGGTGCCTGGACAGG - Intronic
1084172500 11:67407216-67407238 CCAGAGGAGGCAGATGGGGCAGG + Intronic
1084978662 11:72816876-72816898 CCAGCACAGGCAGCAGGGGCAGG - Intronic
1085282529 11:75340542-75340564 CGAGGAGAGGCTGTGGGGGCTGG + Intronic
1086881458 11:92157569-92157591 CCAGACGGGGTTGCCGGGCCGGG - Intergenic
1089493700 11:118898396-118898418 CTAGAAGTCGCTGCCAGGGCTGG - Exonic
1089499287 11:118923119-118923141 GCAGCAGCAGCTGCCGGGGCAGG - Intronic
1089630477 11:119781188-119781210 CCAGATGGGGCTGCCTGGTCTGG + Intergenic
1090198718 11:124839229-124839251 CCAGAAGACGCGGCCTGGGAGGG + Intergenic
1090280411 11:125451514-125451536 CCAGAACAGGCTGCAGTGGGCGG + Intronic
1090465876 11:126932613-126932635 CCTGAAGAGCCTGCTGGGGGTGG - Intronic
1090977192 11:131688215-131688237 GGAGAACAGGCTCCCGGGGCGGG + Intronic
1091079018 11:132648709-132648731 CAAGAAGAGGCTGCCAGTCCTGG - Intronic
1091240118 11:134046484-134046506 CAAGGAGAGGCTGGCAGGGCAGG - Intergenic
1091374712 12:17924-17946 CCAGAGGAGGCTGACTGGGATGG - Intergenic
1091458144 12:623403-623425 ACAGGGCAGGCTGCCGGGGCAGG - Intronic
1091642886 12:2250891-2250913 ACAGAAGAGCCAGCCTGGGCTGG - Intronic
1091837352 12:3595173-3595195 CCTGGGGAGGCTGCTGGGGCAGG + Intergenic
1095910803 12:47424610-47424632 CCAGTAGTGGTAGCCGGGGCTGG - Intergenic
1098006561 12:66003612-66003634 CCCTAAGAGGCTGCCGGAGTTGG - Intergenic
1098369207 12:69739116-69739138 CCAGGAGGGGCGGCCGCGGCAGG + Intronic
1099097035 12:78387396-78387418 ACAGAAGAGGCTGCTGGAGAAGG + Intergenic
1100559560 12:95734433-95734455 CCAGATGAGGCTGATGGTGCTGG + Intronic
1100855913 12:98757116-98757138 CAAGGAGAGGCTGCCTGGACAGG + Intronic
1102178294 12:110892572-110892594 CCAGAAGAGGCTGAGGCGGGCGG + Intronic
1102656263 12:114484858-114484880 CCAGACGGGGCTGCCGGGCGGGG + Intergenic
1103922531 12:124406402-124406424 CCAGGAGAAGCTGCCACGGCTGG + Intronic
1104846694 12:131850613-131850635 CCAGAGGAGCCTGCTGGGGCAGG - Intronic
1104847256 12:131852744-131852766 CAGGATGAGGCTGCCAGGGCCGG + Intergenic
1104966088 12:132509393-132509415 CCAGAAGTGACCGCCGGGGCTGG - Intronic
1104975789 12:132551429-132551451 GCAGAAGCGGATGCCGGGGCAGG + Intronic
1105004098 12:132710565-132710587 CCGGAAGCGCCTGCCGAGGCCGG - Intergenic
1105074288 12:133262042-133262064 CCAGAAGAGGCTGGAGGCCCAGG + Intergenic
1106304131 13:28495179-28495201 CCAGAAGGAGGTGCCGGGGTAGG - Intergenic
1107559687 13:41547872-41547894 CCTAAAGAGGCTGCGGGGACAGG + Intergenic
1111396159 13:87672139-87672161 CCAGAGGAGGCTGGAGGGGGCGG + Intergenic
1112506476 13:99979299-99979321 CCGGGAGAGGCTGCCTGAGCCGG + Intergenic
1113154910 13:107308880-107308902 CCTGAAGAGGCTGCTAAGGCAGG - Intronic
1114634990 14:24182336-24182358 CCAGCCGCGGCTGCCAGGGCAGG + Exonic
1115235627 14:31207069-31207091 CGAGAGGAGGCCGCCGGGCCAGG + Exonic
1117176626 14:53152723-53152745 CCAGCGGAGGCTGCTGCGGCGGG + Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118809974 14:69266112-69266134 CCAGAAGATGCTCCAGGGGAAGG - Intronic
1119362988 14:74067413-74067435 CAAGAAGTGGCTGCCAGAGCTGG - Exonic
1119777690 14:77258794-77258816 CCGGCAGGGGCTGCAGGGGCTGG - Exonic
1121314480 14:92952974-92952996 CAAGGAGGGGCTGCTGGGGCTGG - Intronic
1121492178 14:94368636-94368658 CCAGGACAGGCTCCAGGGGCTGG - Intergenic
1121554905 14:94829128-94829150 CCAGGTGAGGCTGCAGGGGCTGG - Intergenic
1122310649 14:100792140-100792162 CCATAAGAGGCTGGCGAGGGTGG - Intergenic
1122483595 14:102063658-102063680 CCAGGCGTGGCTGCAGGGGCGGG - Intergenic
1122968244 14:105141811-105141833 CGAGGAGGGGCGGCCGGGGCCGG + Exonic
1123728979 15:23129451-23129473 CCAGGTGAGGCTGCAGGAGCTGG - Exonic
1123747143 15:23326916-23326938 CCAGGTGAGGCTGCAGGAGCTGG - Intergenic
1123762156 15:23441436-23441458 GCAGAAGAAGCTGCGGGAGCAGG - Exonic
1124156939 15:27234267-27234289 CCAGAGGAGGCTCCCTGGCCAGG + Intronic
1124355132 15:28989723-28989745 CCAGCAGAGGCGGCCTTGGCGGG + Intronic
1124545912 15:30626364-30626386 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1124779430 15:32615751-32615773 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1127484609 15:59407611-59407633 CCAGATGAGGCGGCTGAGGCTGG + Intronic
1127626251 15:60782951-60782973 CCAGAGAAGGCTGCTGGGTCGGG - Intronic
1127644736 15:60947124-60947146 CCAGAAGGGGCTGGCCGGGTGGG - Intronic
1127774440 15:62254246-62254268 GCAGGAGAGGCTGCTGGAGCTGG - Intergenic
1129029746 15:72609610-72609632 ACAGGAGAGGCTGCGGGAGCAGG + Intergenic
1129188168 15:73922979-73923001 CCAGATGTGGCTGCAGGGGAGGG + Intergenic
1129319809 15:74768203-74768225 CCAGAAGGGGCTTCTGGGGATGG + Intergenic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130259598 15:82344872-82344894 ACAGGAGAAGCTGCCAGGGCAGG - Exonic
1130269084 15:82434314-82434336 ACAGGAGAAGCTGCCAGGGCAGG + Exonic
1130281635 15:82524137-82524159 ACAGGAGAAGCTGCCAGGGCAGG + Intergenic
1130353260 15:83109075-83109097 CCAGAAGAGGCTGTGGAGGCAGG + Intronic
1130473005 15:84240299-84240321 ACAGGAGAAGCTGCCAGGGCAGG + Exonic
1130480419 15:84354364-84354386 ACAGGAGAAGCTGCCAGGGCAGG + Intergenic
1130491292 15:84433395-84433417 ACAGGAGAAGCTGCCAGGGCAGG - Intergenic
1130502875 15:84512195-84512217 ACAGGAGAAGCTGCCAGGGCAGG - Intergenic
1130595303 15:85244977-85244999 ACAGGAGAAGCTGCCAGGGCAGG + Intergenic
1132451884 15:101973133-101973155 CCAGAGGAGGCTGACTGGGATGG + Intergenic
1132455011 16:17492-17514 CCAGAGGAGGCTGACTGGGATGG - Intronic
1132518108 16:375278-375300 CCATCAGAGGAGGCCGGGGCGGG + Intronic
1132569814 16:639122-639144 CAAGAGGAGGCTGCCTGTGCCGG - Intronic
1132652338 16:1027208-1027230 CCTGGAGATGCTGCCTGGGCAGG + Intergenic
1132700243 16:1219151-1219173 GCAGCAGAGGCTGGCGGGGATGG + Intronic
1132904971 16:2277849-2277871 CCAGTGGGGGCTGCCGGGGCCGG + Intronic
1132925015 16:2424775-2424797 CCAGTGGGGGCTGCCGGGGCCGG - Intergenic
1132975729 16:2710214-2710236 GCAGAAGAGGAGGCAGGGGCGGG + Intergenic
1133138408 16:3728209-3728231 CCAGATGGGGCAGCCGGGGCTGG - Exonic
1134267058 16:12701574-12701596 CCAGAAGAGGCTGGAGGGGAAGG + Intronic
1136143750 16:28303221-28303243 CCAGTAGAGGCTGCTGAGCCTGG + Intronic
1136460964 16:30409754-30409776 CCAGAAGAGGCAGGCAGAGCTGG - Intronic
1137030551 16:35519907-35519929 CCTGGAAAGGCTGCCGGGGATGG - Intergenic
1137236542 16:46623111-46623133 CCCTAAGAGGCTGCCGGAGTTGG - Intergenic
1138008525 16:53358070-53358092 GCAGAGGAGACTGCTGGGGCAGG - Intergenic
1138429845 16:56961816-56961838 CTAGAGGAGGCCGCAGGGGCTGG + Intergenic
1141675988 16:85517642-85517664 GGAGAAAAGGCTGCCGGGGCTGG - Intergenic
1141827841 16:86493565-86493587 TCTGAACAGGCTGCCAGGGCAGG + Intergenic
1141866197 16:86751772-86751794 CCAACAGAGGGTGCCGGGGGAGG - Intergenic
1141880329 16:86854233-86854255 CCAGAAGAGTCTGCTGCTGCCGG - Intergenic
1142132328 16:88436744-88436766 ACAGAGGAGGCTGCAGGGGCAGG + Exonic
1142190323 16:88714436-88714458 GCAGAGGAGGCAGCGGGGGCCGG - Exonic
1142201211 16:88761977-88761999 TCTGGAGAGGCTGCGGGGGCTGG - Intronic
1142374572 16:89700534-89700556 GCAGAGGAGGCCGCCGAGGCTGG - Intronic
1142415045 16:89936646-89936668 CAGGAAGGGGCTGCCGGGGGCGG - Intergenic
1142504179 17:352429-352451 AAAGAAGAGGCAGCCGGGGCTGG - Intronic
1142504189 17:352486-352508 AAAGAAGAGGCAGCCGGGGCTGG - Intronic
1142521462 17:507710-507732 ACAGAAGAGGCTGCTGGGGCCGG - Intergenic
1142619174 17:1154188-1154210 CCAGAAGTGGCAGCCGCGGCAGG - Intronic
1142746806 17:1963471-1963493 CCAGCAGAGGCAGCCTGGACAGG - Intronic
1143090695 17:4447739-4447761 CTAGGAGAGGATGCCAGGGCAGG + Intronic
1143108069 17:4539257-4539279 CCAGAGCAGGATGCCCGGGCAGG + Intronic
1143108509 17:4541165-4541187 CGAGAAGGGGCTGGCAGGGCTGG - Intronic
1143697864 17:8633354-8633376 TCAGAGGAGGCTGCCTGGGATGG - Intergenic
1144677017 17:17168264-17168286 CCAGACGGGGTTCCCGGGGCAGG - Intronic
1144738974 17:17570680-17570702 CCAGAAGGGCCTCCCGGGACAGG + Intronic
1145281134 17:21467902-21467924 CCACAAGAGGGGGCAGGGGCAGG - Intergenic
1146594147 17:34155204-34155226 CCAGACAAGGCAGCCGGGACTGG + Intronic
1146912978 17:36659910-36659932 CCAGAGGAGGCTGTCAGGGGCGG + Intergenic
1147238318 17:39073994-39074016 CCAGAGGGGCCTGCCTGGGCAGG - Intronic
1147320391 17:39642419-39642441 CCAGGAGAGGCAGCCTGGGCAGG + Intronic
1147658622 17:42105230-42105252 CCAGAAGAGGCTACTCTGGCAGG - Intronic
1147914526 17:43878636-43878658 CCAGGAGAGGCTGTCTAGGCTGG - Intronic
1147995797 17:44359787-44359809 CCAGCAGCTGCTGCCTGGGCTGG - Intronic
1148842870 17:50510022-50510044 CCAGAAGAGGCTGCACAGGTGGG + Intronic
1151576415 17:74954503-74954525 CCAAGAGAGGGTGCTGGGGCAGG + Intronic
1151930768 17:77230223-77230245 GCAGCAGATGCTGCCCGGGCCGG + Intergenic
1152200494 17:78943121-78943143 CAAGAAGAGGCTGATGGTGCAGG + Intergenic
1152287769 17:79422493-79422515 ACAGAGGAGGCAGCCTGGGCCGG - Intronic
1152433270 17:80260914-80260936 CCTGGAGAGTCTCCCGGGGCGGG + Intronic
1152521210 17:80858056-80858078 CCAGAGGTGGCTGCCGAGGCGGG - Intronic
1152895531 17:82908965-82908987 GCACAAGAGGCTGCCTGGGTGGG + Intronic
1153052169 18:909407-909429 CGGGAAGAGGGTGGCGGGGCGGG - Intronic
1153759404 18:8316206-8316228 CCAGTAGAGACTGCAGGAGCTGG - Intronic
1154167540 18:12027303-12027325 GCAGGCGAGGCTGCCAGGGCTGG - Intronic
1155473590 18:26215648-26215670 GTAGAAGAGGCTGCAGCGGCGGG - Intergenic
1156396822 18:36706544-36706566 CCTGATTAGGCTGCCTGGGCAGG - Intronic
1157812125 18:50704763-50704785 ACAGAAGAGGATGCAGAGGCAGG - Intronic
1158978551 18:62736205-62736227 CCAGGAGAGGCTGATGGTGCTGG - Intronic
1159860425 18:73642101-73642123 CCAGAAAAGGCTGCATGAGCTGG + Intergenic
1160429762 18:78803418-78803440 GCAGAAGGGGCTCCCAGGGCGGG + Intergenic
1160437390 18:78862199-78862221 ACAGAAGAGGCTGCAGGGTGAGG + Intergenic
1160759379 19:775354-775376 CCAGAAGTGGATCCCGGGGAGGG - Intergenic
1160837555 19:1131920-1131942 CCAGAAGAGACGGACGGGGCGGG + Intronic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1161293150 19:3506471-3506493 CCAGGTGAGGCGGCCGGGGTCGG + Intronic
1161314093 19:3609850-3609872 TCAGGACAGGCTGCTGGGGCAGG - Intergenic
1161476394 19:4488265-4488287 CCAGAAATGGCTGCCCTGGCCGG - Intronic
1162087118 19:8255603-8255625 CCAGGAGAGACAGCTGGGGCTGG - Exonic
1162573754 19:11486970-11486992 TGAGAAGTGGGTGCCGGGGCGGG - Exonic
1163159777 19:15457670-15457692 CCAGAAGAGCTGGCCTGGGCCGG + Exonic
1163321339 19:16576767-16576789 CCACCAGCGGCTGGCGGGGCCGG - Exonic
1163664142 19:18595190-18595212 CCAGCAGGGGCGGCGGGGGCCGG - Intronic
1165130671 19:33629862-33629884 CCAGATGAGCCTTCCTGGGCTGG + Intronic
1165366757 19:35372016-35372038 GCAGAGGAGGGTGGCGGGGCTGG + Exonic
1166045298 19:40226446-40226468 CCTGGCGAGGCCGCCGGGGCTGG - Exonic
1167293684 19:48637523-48637545 CCCATAGAGGCTGGCGGGGCTGG - Intergenic
1167311312 19:48739401-48739423 CGAGAAGAAGCTGCCGGAGCTGG - Exonic
1167466142 19:49651902-49651924 CCAGCAGCGGCGGCCGGGGCGGG - Exonic
1168080218 19:54004676-54004698 ACAGCAGAGGCTGGCGTGGCCGG - Intronic
1168567204 19:57435238-57435260 CCAGAAGACACTGCGGGGGCAGG + Intronic
1168689576 19:58368669-58368691 CCAGGAGAGGCTGCAGGCGACGG - Exonic
925128206 2:1476803-1476825 CTGGAAGAGGCTGCAGGGGTCGG - Intronic
925128231 2:1476877-1476899 CTGGAAGAGGCTGCAGGGGTTGG - Intronic
925141065 2:1550199-1550221 CCAGCAGAGGCTGACTGAGCTGG + Intergenic
925901735 2:8513855-8513877 CCAGAGGAGGCTGGAGGGGCAGG + Intergenic
926108315 2:10166287-10166309 CCAGAGCCGGCTGCAGGGGCAGG + Intronic
926247562 2:11132368-11132390 CCAGGAGAGGCTGCCACGGAGGG + Intergenic
927691351 2:25210428-25210450 CCACAAGAGGCTGGTGGAGCAGG + Intergenic
927809271 2:26172887-26172909 CGAGGAGAGGGGGCCGGGGCGGG + Intergenic
927917615 2:26947052-26947074 CCAGCCGAAGCTGCAGGGGCAGG + Exonic
929598159 2:43188936-43188958 TCAGAATAGGCTGCTGGGACTGG - Intergenic
929803615 2:45125431-45125453 TGAGAAGAGGATGCCAGGGCAGG + Intergenic
930114372 2:47706336-47706358 CCAGATGAGGCTGTCAAGGCAGG - Intronic
930728954 2:54709471-54709493 CCAGAGGAGGCTGAGGCGGCAGG - Intergenic
930748289 2:54906993-54907015 GCACAAGAGGCTGCTGAGGCTGG - Intronic
931197209 2:60064176-60064198 CCAAATGAGGCTCCTGGGGCAGG + Intergenic
932152565 2:69386909-69386931 CCAGTGGTGGCTGCGGGGGCGGG - Intronic
934978352 2:98821968-98821990 GCAGAAGCGGCTTCCGGGGCAGG + Exonic
936568097 2:113595606-113595628 CCAGAGGAGGCTGACTGGGATGG + Intergenic
937758798 2:125574645-125574667 CCATGAGAGGCTGGAGGGGCTGG - Intergenic
938661543 2:133492014-133492036 ACAGAAGAGCTTGCAGGGGCAGG - Intronic
940422881 2:153499661-153499683 CCAGAGGGGGCTGAGGGGGCAGG + Intergenic
940918920 2:159286650-159286672 GCAGGTGAGGCTGGCGGGGCGGG + Intronic
941264853 2:163348521-163348543 GCAGAAGCAGCTGCCGTGGCCGG - Intergenic
942700510 2:178703234-178703256 CTAGAAGAGGCTGGAGGGGAGGG + Intronic
946189968 2:218002978-218003000 CCAGCAGATGCTGGCGGAGCCGG - Intronic
946332220 2:219016878-219016900 TCAGAAGAGGCTGAGGAGGCGGG - Intronic
947549459 2:231036301-231036323 GAAGAAGAGGCTGCCGGGTCTGG + Intergenic
947701009 2:232233928-232233950 CCAAAAGAGCCTGCAGGGACAGG + Intronic
948575464 2:238946909-238946931 CCAGAGGGGGCTGAAGGGGCAGG + Intergenic
948924153 2:241083143-241083165 CCAGGAGAGCCTGCTGGGGATGG + Intronic
1168760824 20:348229-348251 CCGGAGGAGGCGGGCGGGGCGGG - Intronic
1170010040 20:11712942-11712964 CCAGTAGATGCTGCATGGGCTGG - Intergenic
1170746865 20:19107296-19107318 GCAGAAGATGCTGCCGCTGCAGG - Intergenic
1170962031 20:21034080-21034102 CCTGAAGTGGCTGCAGGGCCTGG - Intergenic
1171408959 20:24933477-24933499 CCAGGAGAGGCTGGGAGGGCCGG - Intergenic
1172552950 20:35815998-35816020 CCAGACTAGACTGCAGGGGCTGG + Intronic
1172559720 20:35876278-35876300 CCAGAAGAGATGGCCGGGCCTGG + Intronic
1173893744 20:46534125-46534147 TCAGAGGAGCCTGCCGGAGCTGG + Intergenic
1174246833 20:49188097-49188119 CCAGGTGAGGCGGCCGGGCCGGG - Exonic
1174317059 20:49712032-49712054 TCAGAAGATGCTGCTGGGGTAGG - Intronic
1174335114 20:49854275-49854297 CCATAAGAGGCTGGCGAGGGAGG - Intronic
1174501569 20:50988918-50988940 GAAATAGAGGCTGCCGGGGCTGG - Intergenic
1174590996 20:51644953-51644975 CCAGAAGTGGCTTCCAGGGCTGG + Intronic
1175625578 20:60486062-60486084 CCAGCAGAGGCAGCTGGGGGTGG + Intergenic
1176219782 20:63964453-63964475 CCAGGGGTGGCGGCCGGGGCAGG - Intronic
1176412768 21:6457885-6457907 CCAGAGGGGGTGGCCGGGGCTGG - Intergenic
1176582373 21:8543407-8543429 CCAGAAGGGGCTGAGGTGGCAGG + Intergenic
1176993181 21:15522426-15522448 CCAGAGGGGGCTGAAGGGGCAGG + Intergenic
1177880640 21:26690104-26690126 CCAGAGTAGGCTGCCGGGCGGGG + Intergenic
1178917054 21:36710839-36710861 CGAGCAGAGGCCGCCTGGGCAGG - Intronic
1180265208 22:10520455-10520477 CCAGAAGGGGCTGAGGTGGCAGG + Intergenic
1180999697 22:19982306-19982328 CCAGGATGGGGTGCCGGGGCAGG - Intronic
1181299260 22:21867685-21867707 GCCGAGGAGGGTGCCGGGGCGGG + Intergenic
1181304070 22:21904527-21904549 CCAGAAGCGGCTCCCATGGCTGG + Intergenic
1181506704 22:23363290-23363312 CCACACGTGGCTGCCTGGGCTGG - Intergenic
1181689650 22:24551477-24551499 CAAGATGAGGCTGGCGGGCCAGG - Intronic
1182502002 22:30754695-30754717 CAAGATGAGGCCGGCGGGGCAGG - Intronic
1183235570 22:36614407-36614429 CCAGAAGGAGCTGCCGGCTCAGG - Intronic
1183241439 22:36660635-36660657 CCAGGTGAGGCGGGCGGGGCGGG + Intronic
1184692579 22:46123939-46123961 CCAGACAAGGCTGCCCTGGCTGG - Intergenic
1184726145 22:46347800-46347822 CCAGCAGAAGCAGCAGGGGCTGG - Intronic
1184737843 22:46409638-46409660 CCACCAGAGGCTGCCGGACCTGG + Intronic
1184857910 22:47156580-47156602 CCAGAAGAGGGACCTGGGGCAGG + Intronic
1184872720 22:47251223-47251245 ACAGGAGACGTTGCCGGGGCTGG + Intergenic
1184892136 22:47386589-47386611 CCAGTAGATGCCTCCGGGGCCGG - Intergenic
1185041097 22:48504832-48504854 CCAGCAGCAGCTGCCAGGGCAGG + Intronic
1185127252 22:49018045-49018067 CCAGAGGAGGGTGTCGGGGCAGG + Intergenic
1185278669 22:49960752-49960774 CCGGGCGAGGCGGCCGGGGCGGG + Exonic
1185314918 22:50174831-50174853 CTAGCAGGGGCTGCCAGGGCCGG - Intronic
1185367587 22:50444005-50444027 GCAGAAGAGACTGCTGGGGTGGG - Exonic
1185368282 22:50446870-50446892 CCAGCACACGCTGACGGGGCCGG + Exonic
949824310 3:8149045-8149067 CTAGAAGAGGATGCCAGGGGAGG - Intergenic
950709794 3:14805971-14805993 GCTGAAGAGGCTGCAGGGCCAGG + Intergenic
951264775 3:20552684-20552706 CCAGAGGAGGCTGAGGTGGCAGG + Intergenic
952262608 3:31755072-31755094 CCAGTAGAGGCTCCAGAGGCAGG - Intronic
952329078 3:32347377-32347399 CCAGCACACGCTGACGGGGCTGG + Intronic
953032329 3:39186901-39186923 CCAGCAGGGGCTGCTGGTGCAGG - Exonic
954123019 3:48511454-48511476 ACAGAAGAGGCTGGTGGGGCTGG - Intergenic
955182237 3:56683145-56683167 CCCCAAGAGGCTGCCAGGTCGGG - Intronic
955389741 3:58512628-58512650 ACAGAAGAGGCCACAGGGGCAGG - Intronic
956052892 3:65267722-65267744 CCAGAAGAGGCAGCTGAGACTGG - Intergenic
960096709 3:113696547-113696569 CAAAAAGAGGCGGCGGGGGCGGG - Exonic
960333799 3:116392471-116392493 CCAGAGGAGGCTGAGGTGGCAGG - Intronic
960907969 3:122620709-122620731 CCTGAGGAGGCTGCCTGGGAGGG + Intronic
961368458 3:126415655-126415677 CGTGAAGAGACTCCCGGGGCCGG + Intronic
961449683 3:126996972-126996994 CCAGGAGGGGCTGCCGGGGATGG - Intronic
961539585 3:127590523-127590545 CCAGACCAGGCGGCCTGGGCCGG + Exonic
961749662 3:129087809-129087831 CCCTAAGAGGCTGCCGGAGTTGG - Exonic
962752082 3:138440958-138440980 TCAGAAGAGGCTGCCCTTGCAGG - Intronic
965009775 3:163073219-163073241 CCAGAGGAGGCTGATGTGGCGGG - Intergenic
966807695 3:183819514-183819536 CCAGAGGAGGAACCCGGGGCTGG + Intronic
966875632 3:184320199-184320221 CCAGAATAGGGTGCCAGAGCTGG + Intronic
968590153 4:1454462-1454484 CCAGAACAGGCTACAGGGCCAGG - Intergenic
968634120 4:1669119-1669141 TCAGTTGAGGCTTCCGGGGCGGG - Intronic
970620344 4:17811199-17811221 CGAGAGGCGGCGGCCGGGGCCGG - Intronic
971287900 4:25307990-25308012 AAGGCAGAGGCTGCCGGGGCAGG + Intergenic
971300027 4:25434247-25434269 CCAGAAGGGGCAGCTGGGGAGGG + Intergenic
978885578 4:113762413-113762435 GCAGAAGGGGCTGCGGGGGAGGG - Intergenic
979466210 4:121041414-121041436 GCAGAAGAGACTGCTGGGGTCGG - Intronic
979674570 4:123397880-123397902 CAGGCAGAGGCTGCCGCGGCCGG - Intronic
984765677 4:183398751-183398773 GCTGAAGAGGCCGCCGGGCCCGG + Intergenic
985173467 4:187176650-187176672 ATGGAAGAGGCTGGCGGGGCCGG + Intergenic
985550118 5:528587-528609 GCAGCAGAGGCGTCCGGGGCGGG - Intergenic
985577305 5:679350-679372 CCAGCGGAGGATGCAGGGGCAGG + Intronic
985592219 5:771401-771423 CCAGCGGAGGATGCAGGGGCAGG + Intergenic
985685567 5:1279905-1279927 CCACAAGAAGCAGCCGGGCCAGG - Intronic
985910734 5:2878636-2878658 CCAGAGGAGGAAGCCAGGGCTGG + Intergenic
989133551 5:38130831-38130853 CCAGGAGAGGCTGCTAGGTCAGG - Intergenic
991198498 5:63962044-63962066 CCCGAACTGGCTGCCGGAGCTGG + Exonic
994710339 5:103258531-103258553 CCAGAAGAAGTTGGCGGGGGTGG - Intergenic
994897441 5:105723468-105723490 CCAGAAGAGACTGACGGGGTGGG + Intergenic
995842090 5:116452179-116452201 GCAGAAGAGGATGCAGGGGTTGG - Intronic
995994564 5:118282972-118282994 CCAGAAGGGGCGGCCGGGCGGGG - Intergenic
997441448 5:133911510-133911532 CCAGAAAAGGCTTCCAGGGGAGG + Intergenic
1002136867 5:177113024-177113046 TCAGAGGAGGCAGCCAGGGCCGG - Intergenic
1002297864 5:178241390-178241412 CCAGAAGAGTCTCTCTGGGCTGG - Intronic
1002614028 5:180439259-180439281 CCAGCAGAGGTGGCCGGGGGAGG - Intergenic
1002946072 6:1762409-1762431 CCAGAGCTGGCTGCCAGGGCAGG + Intronic
1003074406 6:2971149-2971171 ACGGAAGAGGCGGCCGGCGCGGG - Intronic
1003236969 6:4303395-4303417 CCAGCAGAGACTGTTGGGGCTGG - Intergenic
1006187441 6:32189405-32189427 CCAGAGGGGGCTCCCGGGGATGG + Intronic
1006759013 6:36443019-36443041 CCAGAAGCCGCAGCCGGGACCGG - Exonic
1007380643 6:41488272-41488294 CTTGGAGAGGCTGCAGGGGCAGG - Intergenic
1008410649 6:51174699-51174721 CCTGAAGAGGCTGCAGGCTCTGG + Intergenic
1017705536 6:157119403-157119425 CCAGCAAAGGAAGCCGGGGCTGG - Intronic
1018702252 6:166436504-166436526 CCAGAAGGGGCTGCATGGGGTGG + Intronic
1018712896 6:166509397-166509419 GCAGAGGAGGCTGCAGAGGCTGG - Intronic
1018859861 6:167703820-167703842 ACAGAGGAGGCTGGCGTGGCTGG - Intergenic
1019144000 6:169965130-169965152 CCACAGGAGCCTGCAGGGGCAGG + Intergenic
1019283252 7:211129-211151 CCAGGGGAGGCTGACGGGGGAGG - Intronic
1019423894 7:964088-964110 CCCCAAGAGCCTGCCGAGGCGGG + Intronic
1019451105 7:1098802-1098824 TGGGAAGCGGCTGCCGGGGCTGG + Intronic
1019484778 7:1284507-1284529 CCAGAGGAGGCTCCCTGGCCAGG - Intergenic
1022091117 7:27108682-27108704 CGACAAGAGCCCGCCGGGGCAGG - Exonic
1022152112 7:27618544-27618566 CCAGTAGTGGCAGCGGGGGCTGG - Intronic
1022310812 7:29194534-29194556 CCAGGAGAGGGTGCGGGAGCTGG + Exonic
1022388675 7:29924958-29924980 CAAGATGAGGCTGCTGAGGCTGG - Intronic
1023362313 7:39429520-39429542 CAAGAAGATGCAGCTGGGGCAGG - Intronic
1023623502 7:42095269-42095291 CCAGATGAGGCTGCTGCTGCTGG + Intronic
1024325819 7:48108297-48108319 CCAGCAGAGGCCGCAGCGGCTGG + Exonic
1026899571 7:74029423-74029445 ACAGAAGAGGCTCCCGGGCATGG + Intronic
1027202631 7:76073140-76073162 CCAGGAGATGCTGTTGGGGCGGG + Intergenic
1031869679 7:127078223-127078245 CCAGGAAAGGCTGCCAGGGGAGG - Intronic
1033837364 7:145331536-145331558 CCAGAGGATGCTGCCTGAGCAGG + Intergenic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1034962252 7:155370208-155370230 ACAGAAGGGGCAGCAGGGGCAGG + Intergenic
1035051218 7:155999931-155999953 ACAGGTGAGGCTGCCTGGGCTGG + Intergenic
1035303884 7:157917172-157917194 CCAGGACAGGCTGCCGCAGCTGG + Intronic
1035323073 7:158046674-158046696 CCAGGAGAGGATGCCGGGCTGGG + Intronic
1035496613 7:159333287-159333309 CCAGAAGAGGCTGGAGGCCCAGG + Intergenic
1035630181 8:1101505-1101527 GCAGACGGGGGTGCCGGGGCTGG + Intergenic
1035638172 8:1162874-1162896 CCAGAAGAGGGTGCTGGGCTGGG + Intergenic
1037402025 8:18503206-18503228 CCCGACGAGGCTGCCTGGGTGGG + Intergenic
1038775559 8:30527644-30527666 CCAGCACAGGATGCTGGGGCTGG - Intronic
1039576134 8:38625494-38625516 CCAGAGGAGACTCACGGGGCAGG + Intergenic
1043708100 8:83378426-83378448 CCAGAGGAGGCTGAGGTGGCAGG + Intergenic
1046818902 8:118615386-118615408 CCAGTGGAGGCTGCAGGGGAGGG + Intronic
1048044120 8:130757062-130757084 GCAGAAGAGGGTACAGGGGCTGG + Intergenic
1048334793 8:133494519-133494541 CCAGGAGAGGCTGCAAGGTCTGG - Intronic
1048340176 8:133532815-133532837 CCAGAAGAGTCCGCAGGTGCTGG + Intronic
1048456154 8:134580036-134580058 CCAGGACAGGATGCCGAGGCAGG + Intronic
1048944475 8:139431654-139431676 CCACAGGAGCCTCCCGGGGCAGG + Intergenic
1049275095 8:141716300-141716322 CCAGAGGAGGCAGCCGGGTTAGG + Intergenic
1049380739 8:142314562-142314584 CCAGAAGAGGCTGCCGGGGCCGG + Intronic
1049380755 8:142314634-142314656 CCAGAAGAGGCTGCCAGGGCCGG + Intronic
1049552218 8:143265658-143265680 CAAGAAGAGGCTTCTGGGGAGGG + Intronic
1049884433 9:17920-17942 CCAGAGGAGGCTGACTGGGATGG - Intergenic
1050343273 9:4662303-4662325 GCGGAAGAGGCTGCAGGGCCGGG + Exonic
1055482757 9:76726028-76726050 CCAGAAGAGGATGGAGAGGCAGG - Intronic
1056838115 9:89974395-89974417 ACAGAAGAGGCTGGCATGGCAGG + Intergenic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1057704633 9:97388173-97388195 CCAGAAGAGGCAGCAGCTGCAGG - Intergenic
1057842704 9:98499370-98499392 CCAGAAGAGCCAGCCAGGACTGG - Intronic
1057911064 9:99021098-99021120 CCAGAGCAGGCTCCCTGGGCAGG - Intronic
1059341700 9:113601076-113601098 CCAGAGGTGGCTGCCTGGGCAGG - Intergenic
1060730394 9:126033458-126033480 CCCCAAGAGCCTGCAGGGGCAGG + Intergenic
1060829086 9:126702644-126702666 CCAGAAGAGGGTGCAGGGCGGGG - Intergenic
1061149116 9:128818879-128818901 CAAGTACGGGCTGCCGGGGCTGG + Exonic
1061714294 9:132509346-132509368 CCAGCAGAGGTAGCCCGGGCTGG - Intronic
1061782244 9:133003155-133003177 CCAAAAGGGGCTCCTGGGGCAGG - Intergenic
1061860656 9:133467145-133467167 CTAGAGGAGGCTGCCTGTGCAGG - Intronic
1061880485 9:133566525-133566547 TCTGAGGAGGCTGACGGGGCTGG + Intronic
1061935162 9:133853435-133853457 TCAGCAGAGGCCGCTGGGGCAGG - Intronic
1062105220 9:134751445-134751467 CTGGAAGGGGCTGCCTGGGCTGG + Intronic
1062347476 9:136122037-136122059 CGAGCAGAGACTGGCGGGGCAGG - Intergenic
1062352554 9:136146228-136146250 CCAGGGGTGGCTGCTGGGGCTGG - Intergenic
1062408173 9:136407756-136407778 CCAAAGGAGGCTGCAGAGGCCGG + Intronic
1062428719 9:136517540-136517562 GCAGATGAGGGTGCCGGGCCAGG - Intronic
1062437948 9:136555078-136555100 ACAGCAGAGGCTGCCTGGCCTGG + Intergenic
1062590640 9:137272985-137273007 CCGGAAGAGGCTCCCGGACCTGG + Exonic
1062721378 9:138046016-138046038 CCAGAAGAGGCAGCCGTGGACGG - Intronic
1203612388 Un_KI270749v1:21421-21443 CCAGAAGGGGCTGAGGTGGCAGG + Intergenic
1186415566 X:9380472-9380494 CCAGAGGAGGCAGCAGGGGTGGG + Intergenic
1189321814 X:40091746-40091768 CCAGGAGAAGCCGCCGGGGCGGG - Intronic
1191157244 X:57287031-57287053 TCAGAAGAGGCTGGAGGGACAGG + Intronic
1193571031 X:83143718-83143740 CAAAAAGAGTCTGCTGGGGCTGG + Intergenic
1196794943 X:119494745-119494767 CAAACAGAGGCTGCCTGGGCTGG + Intergenic
1197776382 X:130121110-130121132 CCAGAAGAGGCGCCCAGGGCAGG - Intergenic
1198518157 X:137428576-137428598 CCAGCAGGGCCTGCCTGGGCCGG + Intergenic
1199721279 X:150544333-150544355 CCAAGAGAGGCTCCCGGGACTGG + Intergenic
1200401372 X:156022236-156022258 CCAGAGGAGGCTGACTGGGATGG + Intergenic
1200787483 Y:7273510-7273532 CCAAGAGGGGCTGCCGGGTCTGG - Intergenic