ID: 1049382619

View in Genome Browser
Species Human (GRCh38)
Location 8:142325028-142325050
Sequence CACGGCCCAGTTTCATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049382610_1049382619 17 Left 1049382610 8:142324988-142325010 CCTAGACCTGGCAACACCCCAGG 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data
1049382612_1049382619 11 Left 1049382612 8:142324994-142325016 CCTGGCAACACCCCAGGAGTGAC 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data
1049382609_1049382619 21 Left 1049382609 8:142324984-142325006 CCGTCCTAGACCTGGCAACACCC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data
1049382608_1049382619 22 Left 1049382608 8:142324983-142325005 CCCGTCCTAGACCTGGCAACACC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data
1049382615_1049382619 -1 Left 1049382615 8:142325006-142325028 CCAGGAGTGACTCCATGTAGACC 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data
1049382607_1049382619 23 Left 1049382607 8:142324982-142325004 CCCCGTCCTAGACCTGGCAACAC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data
1049382614_1049382619 0 Left 1049382614 8:142325005-142325027 CCCAGGAGTGACTCCATGTAGAC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data
1049382613_1049382619 1 Left 1049382613 8:142325004-142325026 CCCCAGGAGTGACTCCATGTAGA 0: 1
1: 0
2: 1
3: 7
4: 156
Right 1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049382619 Original CRISPR CACGGCCCAGTTTCATGAGC AGG Intronic
No off target data available for this crispr