ID: 1049383161

View in Genome Browser
Species Human (GRCh38)
Location 8:142327544-142327566
Sequence CGATGGAGGGCTCTGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049383161_1049383174 13 Left 1049383161 8:142327544-142327566 CCCCCTCACAGAGCCCTCCATCG 0: 1
1: 0
2: 2
3: 26
4: 195
Right 1049383174 8:142327580-142327602 GTCAGCTCTTCACACCCTGCTGG No data
1049383161_1049383171 -9 Left 1049383161 8:142327544-142327566 CCCCCTCACAGAGCCCTCCATCG 0: 1
1: 0
2: 2
3: 26
4: 195
Right 1049383171 8:142327558-142327580 CCTCCATCGGGCACTCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049383161 Original CRISPR CGATGGAGGGCTCTGTGAGG GGG (reversed) Intronic
901839068 1:11942674-11942696 CAATGCAGGGGTCTGGGAGGCGG - Intronic
903220239 1:21865309-21865331 CGCTGCAGGGCCCTGAGAGGAGG - Exonic
903283740 1:22264582-22264604 AGATGGAGGTCTCTGAGAGCAGG - Intergenic
905150302 1:35921830-35921852 GAATGGAGGGCTCTGGGAGGAGG + Exonic
906780685 1:48570376-48570398 GGCTGGAGGGCTGTGAGAGGTGG + Intronic
906872868 1:49503404-49503426 CCATTGAGGACTCTGTGTGGGGG - Intronic
907315445 1:53567970-53567992 CCAAGGGGGGCTCTGTGTGGGGG - Intronic
907527232 1:55060975-55060997 CCATGGAGGGCATTCTGAGGTGG + Intronic
908545891 1:65161883-65161905 CGTTAGAGGCCTCTTTGAGGAGG + Intronic
910217189 1:84854318-84854340 CCATGGAGGCCTCTTTGAGAAGG - Intronic
911033993 1:93519470-93519492 CAATAGAGGGCTCTGTAAAGAGG - Intronic
912523853 1:110266309-110266331 CCCTGGAGGGCTGAGTGAGGAGG + Intronic
915322370 1:155062860-155062882 CGAGGGCGGGCTGTGTGGGGCGG + Intergenic
915813671 1:158943621-158943643 TGAGGGAGAGCTCTGTGAGATGG + Intronic
917201510 1:172521248-172521270 CAATGGAGGGCTCTGCAAGAGGG + Intergenic
917274277 1:173314826-173314848 AGATGAATGGCTCTTTGAGGGGG - Intergenic
917408751 1:174736574-174736596 TGGTGGAGGACTCTGTGTGGGGG + Intronic
920283615 1:204862762-204862784 CTTTGGAGGGCAGTGTGAGGAGG + Intronic
922485259 1:225969065-225969087 CTAAGGAGGGCTCGCTGAGGAGG + Intergenic
922590506 1:226772236-226772258 GGATGGATGGATCTGTGAGATGG - Intergenic
923631217 1:235650219-235650241 CACTGGAGGGGTCTGTGGGGCGG + Intronic
924843654 1:247743165-247743187 CAGTGGAGGGCTCTGTGGGCAGG - Intergenic
1063647986 10:7904925-7904947 CAATGGAGAGCTCAGTGTGGAGG - Intronic
1064340113 10:14477957-14477979 GGATGGAGGCCCCTGTGATGCGG + Intergenic
1067782500 10:49219050-49219072 TGAGGCAGGGCACTGTGAGGGGG - Intergenic
1068148124 10:53097643-53097665 CCATTGAGGACTCTGTGTGGGGG - Intergenic
1069235893 10:66072723-66072745 AGATGGAGGACTCTGAGAAGGGG - Intronic
1069904652 10:71725197-71725219 AGCTGGAGGACTCTGTGAGGTGG - Intronic
1072977264 10:100069512-100069534 CCATGGAGGGCTCTATGCTGAGG + Intronic
1073051340 10:100669411-100669433 CAGTGGAGGGGTCAGTGAGGGGG - Intergenic
1074639994 10:115369226-115369248 GGATGGAGGATTCTGTGATGAGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1084934001 11:72577332-72577354 CAGTGGAGGGCTGTGGGAGGTGG + Exonic
1089103082 11:115980554-115980576 CCAAGCAGGGCTCTGGGAGGAGG + Intergenic
1089286097 11:117409122-117409144 AGAGGGAGGCCTCTGTGAGCCGG + Intronic
1089395852 11:118136022-118136044 TGATGGAGGGCACGGTGGGGGGG + Exonic
1092045340 12:5428512-5428534 TGCTGGAGGGCGCTGTGGGGAGG - Intergenic
1095789672 12:46150940-46150962 CGAGGGAGGGATCTGTTGGGAGG + Intergenic
1099658706 12:85527822-85527844 CCAGTGAGGGCTCTGTGTGGGGG - Intergenic
1101824264 12:108208457-108208479 GGATGGAGGGCTCCATGTGGAGG + Intronic
1106018447 13:25891680-25891702 CATTAGGGGGCTCTGTGAGGTGG + Intronic
1106071042 13:26411197-26411219 GGAGGGAGGGCTCTCTGAGGAGG - Intergenic
1106564109 13:30870650-30870672 GGAGTCAGGGCTCTGTGAGGTGG + Intergenic
1106564153 13:30870881-30870903 GGAGTCAGGGCTCTGTGAGGTGG + Intergenic
1106592748 13:31111142-31111164 CGATGGATGCCTCAGAGAGGAGG - Intergenic
1107725323 13:43293178-43293200 TGATGAAGGCATCTGTGAGGGGG - Intronic
1111836810 13:93398322-93398344 GGATGGAGTGCTCTCTGGGGAGG + Intronic
1113584270 13:111452624-111452646 GGATGGAGGGACCTGTTAGGGGG + Intergenic
1113956090 13:114100449-114100471 GGAGGCAGGGCTCTGTCAGGCGG + Intronic
1117501683 14:56358683-56358705 CTATGGAGGACTCTGTCAGGAGG - Intergenic
1117758987 14:59006244-59006266 AGAAGGAGGGCCCTGAGAGGCGG + Intergenic
1118519902 14:66571317-66571339 CAATGGAGGGATCTGATAGGAGG - Intronic
1119589070 14:75868009-75868031 CCATGCTGGGGTCTGTGAGGAGG + Intronic
1121406147 14:93720459-93720481 TGATGGAGGACTCTGGGAGAGGG + Exonic
1122213487 14:100188373-100188395 CTATGGGGGGCTCTCTGTGGTGG - Intergenic
1124390415 15:29250644-29250666 CAGTGCAGGGCTCTGTGTGGGGG - Intronic
1125737231 15:41935196-41935218 TCAGGGAGGGCTCTCTGAGGAGG - Intronic
1128161065 15:65423036-65423058 CGATGGAGGGGCGGGTGAGGCGG - Exonic
1128899842 15:71410385-71410407 CCATGGAGGGCTTCCTGAGGAGG + Intronic
1129392247 15:75226279-75226301 CCTTGGAGGGCTCCATGAGGAGG + Intergenic
1129522359 15:76193909-76193931 CGCTGGAGAGCTCTGGGAGGAGG - Intronic
1129732522 15:77940257-77940279 CCTTGGAGGGCTCCATGAGGAGG - Intergenic
1132502991 16:292871-292893 CCAAGGAGGGCGCAGTGAGGAGG + Intronic
1132593567 16:737684-737706 CGAAGGTGGGCTCTGAAAGGAGG + Intronic
1132664831 16:1076593-1076615 CCAGAGAGGGCTCTGTGGGGTGG - Intergenic
1134190093 16:12114306-12114328 CCCTGAAGGGCTCTGTTAGGAGG + Intronic
1134438987 16:14286230-14286252 AGATGGAGGGCTCTGGGGGTGGG + Intergenic
1134875838 16:17697784-17697806 CAATGGAGGGTTCTGGGATGTGG + Intergenic
1136136534 16:28259747-28259769 CCATGGAGGGCTCTGAGCAGGGG - Intergenic
1136519296 16:30786027-30786049 CTTTGGATGGCTGTGTGAGGTGG + Intronic
1138657602 16:58500136-58500158 AGATGGTCGGCTCTGTGATGGGG - Intronic
1138880309 16:61006221-61006243 CGCTGAGGAGCTCTGTGAGGAGG - Intergenic
1139559731 16:67734448-67734470 GGATGCTGGGCCCTGTGAGGTGG + Intronic
1142377046 16:89711725-89711747 CGTGGGAGGGCCCGGTGAGGGGG - Intronic
1143479229 17:7219085-7219107 TGCTGGAGCCCTCTGTGAGGAGG - Exonic
1143584100 17:7842847-7842869 CGAGGGAGGGCTTTGTACGGGGG + Intronic
1144796999 17:17898512-17898534 AGAGGGAAGGCCCTGTGAGGGGG + Intronic
1145798070 17:27667352-27667374 CGCTTGAGGGCCCTGTGAGGGGG + Intergenic
1146161685 17:30563189-30563211 CCCTTGAGGGCCCTGTGAGGGGG - Exonic
1146558398 17:33847309-33847331 GGATGAAGGGCTGGGTGAGGTGG - Intronic
1147158866 17:38559328-38559350 AGAAGGAGGGCTCAATGAGGGGG + Intronic
1147839838 17:43363523-43363545 GGATGGAGGGCTCCGGGAGCGGG - Intergenic
1148447505 17:47746424-47746446 GGGTGCAGGGCGCTGTGAGGCGG + Intergenic
1150764809 17:67994167-67994189 AGAAGAAGGGCTCTGGGAGGGGG + Intergenic
1152004133 17:77667085-77667107 CGATGGCGGCTTCTGAGAGGTGG + Intergenic
1153019353 18:612611-612633 CGAGGAAGGCCTCTTTGAGGAGG - Intronic
1153082704 18:1247193-1247215 TAATGGAGGGGTCTGTGAAGGGG + Intergenic
1153815150 18:8784744-8784766 AGCTAGAGGACTCTGTGAGGTGG - Exonic
1158362897 18:56696247-56696269 CCACGGAGTGTTCTGTGAGGTGG - Exonic
1160686167 19:437855-437877 TCCTGGAGGGCTCTGGGAGGTGG - Intronic
1161251975 19:3285470-3285492 TGATGGAGGGCTATGTGGGCAGG - Intronic
1162304466 19:9863340-9863362 CCATGGAGGGTTCTGTGCAGAGG + Intronic
1162788672 19:13051916-13051938 AGAAGGCGGGCGCTGTGAGGAGG - Intronic
1162844498 19:13381921-13381943 CCATGGAGGGTTCTGAGGGGAGG + Intronic
1164566367 19:29328868-29328890 CCATGGAGGGCACTAAGAGGAGG - Intergenic
1165096233 19:33411386-33411408 GGATTGTGGGCTCTCTGAGGGGG - Intronic
1165739095 19:38195144-38195166 AAAAGGAAGGCTCTGTGAGGTGG - Intronic
925831745 2:7903155-7903177 AGATGGAGGACTCTGTGAGATGG - Intergenic
925831766 2:7903261-7903283 AGATGGAGGACTCTGTGAGATGG - Intergenic
925831768 2:7903278-7903300 GGATGGAGGACTCTGTGAGATGG - Intergenic
925831776 2:7903312-7903334 GGATGGAGGACTCTGTGAAATGG - Intergenic
925831784 2:7903346-7903368 AGATGGAGGACTCTGTGAGATGG - Intergenic
925831792 2:7903403-7903425 AGATGGAGGACTCTGTGAGATGG - Intergenic
925831807 2:7903480-7903502 AGATGGAAGACTCTGTGAGATGG - Intergenic
925831816 2:7903537-7903559 AGATGGAGGACTTTGTGAGATGG - Intergenic
925831832 2:7903614-7903636 AGATGGAGGACTCCGTGAGATGG - Intergenic
925831847 2:7903691-7903713 AGATGGGGGACTCTGTGAGATGG - Intergenic
925831856 2:7903728-7903750 AGATGGAGGACTCTGTGAGATGG - Intergenic
927967887 2:27282989-27283011 GGATAGAGTGCTCTCTGAGGTGG + Intronic
929885263 2:45872441-45872463 CGTAGGAGGGCTCTGTGCAGAGG + Intronic
931744207 2:65277868-65277890 CCATTGATGGCTCTGTGTGGTGG + Intergenic
934090124 2:88543854-88543876 AGATGGAGGGAGCTTTGAGGTGG + Intergenic
935354929 2:102188835-102188857 CGATGGGGAGGTTTGTGAGGAGG + Intronic
937347913 2:121138454-121138476 AGAATGAGGGCTCTGTGAGGCGG + Intergenic
943936107 2:193918990-193919012 CCATTGAGGGCTCTGTGTGGGGG - Intergenic
947666841 2:231911257-231911279 CCATGGAGGTGACTGTGAGGAGG + Intergenic
948488269 2:238294994-238295016 CCAAGGAGGGCACTGTGAGCTGG - Intergenic
948494913 2:238341747-238341769 CTCAGGATGGCTCTGTGAGGCGG + Intronic
1168981181 20:2005162-2005184 CATTGGAGGCCTCTTTGAGGAGG - Intergenic
1169264187 20:4157691-4157713 TGATGGTGGGCTGTGGGAGGGGG + Intronic
1171282349 20:23911356-23911378 CCATGGAGAGCTCTGTAATGGGG - Intergenic
1172099398 20:32476149-32476171 CGAAGGAGGGCTGTGGGTGGAGG - Intronic
1172125359 20:32622328-32622350 CTATGGAGGGCTCTGAGCAGGGG + Intergenic
1174362932 20:50039926-50039948 TCAAGGAGGGCTCTCTGAGGAGG + Intergenic
1174959427 20:55138314-55138336 CAATTAAGGGCTCTGTAAGGAGG - Intergenic
1175410138 20:58762350-58762372 GGTGGAAGGGCTCTGTGAGGAGG + Intergenic
1175936842 20:62517955-62517977 CAATGGAGGAGGCTGTGAGGGGG - Intergenic
1176045780 20:63091961-63091983 CTGTGGGGTGCTCTGTGAGGAGG - Intergenic
1176371125 21:6061861-6061883 CGCTGGAAGGCTCTGGGCGGTGG - Intergenic
1178177524 21:30120092-30120114 AGATAGAGGTATCTGTGAGGTGG + Intergenic
1178489789 21:33042174-33042196 GGATGCAGAGCTCTTTGAGGGGG - Intergenic
1179752394 21:43476680-43476702 CGCTGGAAGGCTCTGGGCGGTGG + Intergenic
1180994698 22:19959694-19959716 TGCTGGAGGGCCTTGTGAGGTGG + Intronic
1181110972 22:20602788-20602810 CCAGCGTGGGCTCTGTGAGGTGG + Intergenic
1183323779 22:37180591-37180613 CGGAGGAGGGCTCTGAGACGAGG + Exonic
1183910208 22:41073505-41073527 GGAGGTAGGGCTCTGGGAGGTGG + Intergenic
1183982815 22:41552258-41552280 CGAGAGAGGAGTCTGTGAGGTGG - Intergenic
1184912144 22:47543241-47543263 CCAGGGAGGGCTTTCTGAGGAGG - Intergenic
1185272883 22:49936758-49936780 GGATGGAGGGCTGTGGGTGGAGG - Intergenic
952746599 3:36787686-36787708 CTGTGGTGGGCTCTATGAGGGGG - Intergenic
956641939 3:71423733-71423755 TGCTGAAGGGCTCAGTGAGGTGG - Intronic
960798078 3:121510091-121510113 CGATTGAGGCCTGTGTGATGTGG - Exonic
961701923 3:128751179-128751201 CTGTGGAGAGCTCTGTGTGGGGG - Intronic
962316492 3:134362739-134362761 AGATGGAGGGCTCTGTGGTCTGG - Intronic
962950343 3:140212869-140212891 GAATGAAGGGCACTGTGAGGGGG - Intronic
963947489 3:151162216-151162238 CAAGGAAGGGCTCTGTCAGGAGG + Intronic
964890142 3:161524910-161524932 GGATGGAGGGCCCTGTCATGAGG + Intergenic
967048421 3:185759030-185759052 CCATGCAGGCCACTGTGAGGGGG + Intronic
969639418 4:8388120-8388142 CGATGGACGGGTGTGTCAGGAGG - Intronic
973820432 4:54657882-54657904 AGAGGGAGGGCGCTGGGAGGAGG + Intergenic
975038124 4:69710027-69710049 CCAAGTAGGGCTCTGTGTGGGGG + Intergenic
976330794 4:83829017-83829039 CGATGGAGGGATCCAGGAGGTGG + Intergenic
977686827 4:99856298-99856320 CAAGGGAGGCCTCTGTGAGGAGG + Intronic
983216107 4:165004559-165004581 CAATGAAGAGCTCTGTGATGGGG - Intergenic
985386389 4:189452500-189452522 CCAGGGGGGACTCTGTGAGGGGG - Intergenic
986116643 5:4781841-4781863 CAATGGAGGGATCTGTGCAGAGG + Intergenic
994030675 5:95138635-95138657 CAGTGGTGGTCTCTGTGAGGGGG - Intronic
994151735 5:96455725-96455747 CAACGGAGGCCTCTGTGAGGAGG - Intergenic
996614704 5:125426884-125426906 TAATGGAGGGTTCTGAGAGGAGG + Intergenic
998395194 5:141813744-141813766 AGATGCAGGGAGCTGTGAGGAGG - Intergenic
1000876015 5:166639134-166639156 CCAAGGAGGGCTCTTTGAGGAGG - Intergenic
1001141375 5:169146704-169146726 AGAAGGGGGGCTCTGTGAGCTGG - Intronic
1005831259 6:29672874-29672896 AGTTGGGCGGCTCTGTGAGGTGG + Exonic
1006224057 6:32521624-32521646 CCTTGGAGGCCTCTGTGGGGAGG - Intronic
1006228057 6:32557665-32557687 CCTTGGAGGCCTCTGTGGGGAGG - Intronic
1006416845 6:33909528-33909550 AGTAGGAGGGCTCTGTGACGGGG - Intergenic
1007470489 6:42087017-42087039 CGAGGGAGGGCTCTGAGAGGAGG - Intronic
1007787224 6:44287573-44287595 GAATGCAGAGCTCTGTGAGGAGG + Exonic
1008054072 6:46928482-46928504 CTATGGAGCGCTCAGTGAAGAGG - Intronic
1012470480 6:99568281-99568303 GGAGGGAAGGATCTGTGAGGGGG - Intronic
1012755775 6:103228263-103228285 CCATGGAGGACTCTATGTGGGGG - Intergenic
1021410052 7:20320086-20320108 GGATGGGGGGCTGTGTAAGGAGG - Intergenic
1022503625 7:30897389-30897411 TCATGGAGGGCTCCGTGGGGAGG - Intergenic
1023373904 7:39537560-39537582 TGTTGTAGGGCTCTGTGGGGAGG - Intergenic
1026748827 7:73033804-73033826 AGGTGGAGGGCTCAGTGAGGTGG - Intergenic
1026752475 7:73061949-73061971 AGGTGGAGGGCTCAGTGAGGTGG - Intergenic
1026756126 7:73090080-73090102 AGGTGGAGGGCTCAGTGAGGTGG - Intergenic
1027035024 7:74919099-74919121 AGGTGGAGGGCTCAGTGAGGTGG - Intergenic
1027091279 7:75303344-75303366 AGGTGGAGGGCTCAGTGAGGTGG + Intergenic
1027094923 7:75331317-75331339 AGGTGGAGGGCTCAGTGAGGTGG + Intergenic
1027324416 7:77036368-77036390 AGGTGGAGGGCTCAGTGAGGTGG - Intergenic
1029113168 7:98223676-98223698 CGATGAAGGATTTTGTGAGGAGG - Exonic
1029395033 7:100302040-100302062 AGGTGGAGGGCTCAGTGAGGTGG + Intergenic
1032076582 7:128838898-128838920 GGATGGAGGACTCAGGGAGGGGG - Intronic
1034422968 7:150998878-150998900 GGATGGAGGGGTCCCTGAGGAGG + Intronic
1034465657 7:151227053-151227075 GGATGGAGGGCTCTGCGAGGGGG - Intronic
1037692621 8:21195042-21195064 GCATGGAGGGGGCTGTGAGGTGG + Intergenic
1037930700 8:22878396-22878418 AGTGGGAGGGCTCTGAGAGGTGG + Intronic
1039216538 8:35278169-35278191 AGTTGGAGGGCACTGTGAGCAGG - Intronic
1039454034 8:37696335-37696357 CGCTGGCGGGCTGAGTGAGGAGG + Intronic
1042844056 8:73152736-73152758 CTCTGGACAGCTCTGTGAGGAGG - Intergenic
1043006065 8:74820146-74820168 CAATGGAGAGGTCTGTGTGGTGG + Intronic
1044946839 8:97397313-97397335 TGAGGGAGGGCTGTGTGAGTGGG - Intergenic
1047305821 8:123652350-123652372 AGATGATGGGCTCTGTGGGGAGG - Exonic
1049358005 8:142198275-142198297 CATTGGAGGGCTCTGTGGGAAGG + Intergenic
1049383161 8:142327544-142327566 CGATGGAGGGCTCTGTGAGGGGG - Intronic
1049508129 8:143014649-143014671 GGAGGGAGTGCTGTGTGAGGAGG + Intergenic
1049508157 8:143014757-143014779 GGAGGGAGTGCTGTGTGAGGAGG + Intergenic
1049508190 8:143014886-143014908 GGAGGGAGTGCTGTGTGAGGAGG + Intergenic
1049508216 8:143014994-143015016 GGAGGGAGTGCTGTGTGAGGAGG + Intergenic
1049508265 8:143015192-143015214 GGAGGGAGTGCTGTGTGAGGAGG + Intergenic
1049508334 8:143015444-143015466 GGAGGGAGTGCTGTGTGAGGAGG + Intergenic
1049508400 8:143015705-143015727 GGAGGGAGTGCTGTGTGAGGAGG + Intergenic
1051389822 9:16552198-16552220 AAAAGGAGGGCTCTTTGAGGCGG - Intronic
1056583652 9:87914305-87914327 CGAAGGAGGGATCTGGAAGGCGG + Intergenic
1056584144 9:87917774-87917796 CGAAGGAGGGATCTGGAAGGCGG + Intergenic
1056613222 9:88138641-88138663 CGAAGGAGGGATCTGGAAGGCGG - Intergenic
1056830316 9:89911874-89911896 CCATGGAGGGCCCCGGGAGGGGG - Intergenic
1058698999 9:107585621-107585643 CTATTGAGGGCTCTCTGAGCTGG + Intergenic
1058797834 9:108515851-108515873 CGATGGAGGGACCTGGTAGGAGG - Intergenic
1060176042 9:121498462-121498484 CGAAGGAGGGCTCTGGGAGTGGG - Intergenic
1060973190 9:127750474-127750496 GGATGGAAGCCTTTGTGAGGTGG - Intronic
1062320968 9:135990363-135990385 TGAGGGAGGGCTCAGTGGGGAGG + Intergenic
1185573454 X:1152277-1152299 CGAAGGAGGGAGCTGGGAGGAGG + Intergenic
1185621804 X:1454263-1454285 CCAGGGCGGGCGCTGTGAGGTGG + Intergenic
1186696877 X:12044557-12044579 CAAGGGAGGCATCTGTGAGGAGG + Intergenic
1187709704 X:22040863-22040885 CGGTGGAGGGCTCAGTTAGAGGG + Intronic
1189746104 X:44170548-44170570 AGAGGGAGGCCTCTGTGATGGGG - Intronic
1192924405 X:75740568-75740590 CTGTGCAGGGCTCTTTGAGGTGG - Intergenic
1196749745 X:119105136-119105158 CGATGGTGGGTTCTGTCAAGAGG + Exonic
1198941702 X:141963848-141963870 CTAGTGAGGGCTCTGTGTGGGGG + Intergenic