ID: 1049383830

View in Genome Browser
Species Human (GRCh38)
Location 8:142331040-142331062
Sequence GGCCCCACTGCAGCCCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1577
Summary {0: 1, 1: 0, 2: 2, 3: 70, 4: 1504}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049383826_1049383830 -4 Left 1049383826 8:142331021-142331043 CCTGCTACTCCATATGGGTGGCC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG 0: 1
1: 0
2: 2
3: 70
4: 1504
1049383822_1049383830 -1 Left 1049383822 8:142331018-142331040 CCCCCTGCTACTCCATATGGGTG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG 0: 1
1: 0
2: 2
3: 70
4: 1504
1049383818_1049383830 4 Left 1049383818 8:142331013-142331035 CCCTGCCCCCTGCTACTCCATAT 0: 1
1: 0
2: 2
3: 15
4: 219
Right 1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG 0: 1
1: 0
2: 2
3: 70
4: 1504
1049383825_1049383830 -3 Left 1049383825 8:142331020-142331042 CCCTGCTACTCCATATGGGTGGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG 0: 1
1: 0
2: 2
3: 70
4: 1504
1049383823_1049383830 -2 Left 1049383823 8:142331019-142331041 CCCCTGCTACTCCATATGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG 0: 1
1: 0
2: 2
3: 70
4: 1504
1049383819_1049383830 3 Left 1049383819 8:142331014-142331036 CCTGCCCCCTGCTACTCCATATG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG 0: 1
1: 0
2: 2
3: 70
4: 1504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049383830 Original CRISPR GGCCCCACTGCAGCCCGGGC AGG Intronic