ID: 1049383980

View in Genome Browser
Species Human (GRCh38)
Location 8:142331639-142331661
Sequence TGCACCGCAGGATGGCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049383966_1049383980 28 Left 1049383966 8:142331588-142331610 CCAGCACCCTCGCATCCAACGTC 0: 1
1: 0
2: 1
3: 1
4: 60
Right 1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 112
1049383967_1049383980 22 Left 1049383967 8:142331594-142331616 CCCTCGCATCCAACGTCGCATCA 0: 1
1: 0
2: 1
3: 0
4: 14
Right 1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 112
1049383970_1049383980 13 Left 1049383970 8:142331603-142331625 CCAACGTCGCATCAGTGGACCCA 0: 1
1: 0
2: 0
3: 7
4: 36
Right 1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 112
1049383973_1049383980 -6 Left 1049383973 8:142331622-142331644 CCCACGAAACCCGGGACTGCACC 0: 1
1: 0
2: 1
3: 0
4: 38
Right 1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 112
1049383974_1049383980 -7 Left 1049383974 8:142331623-142331645 CCACGAAACCCGGGACTGCACCG 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 112
1049383968_1049383980 21 Left 1049383968 8:142331595-142331617 CCTCGCATCCAACGTCGCATCAG 0: 1
1: 0
2: 1
3: 1
4: 18
Right 1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049383980 Original CRISPR TGCACCGCAGGATGGCCTGA GGG Intronic
900410418 1:2510142-2510164 TGCACGCCAGGATGACCTGCAGG + Exonic
901851970 1:12021671-12021693 TGGGCCGCAGGATGTCCTCAGGG - Exonic
906129934 1:43450037-43450059 TTCACCTCAGGATGCCCTGTGGG + Intronic
910876085 1:91879447-91879469 GGCACATTAGGATGGCCTGAAGG + Intronic
915120297 1:153626382-153626404 TGCAAGGCAGGAGGGCCGGAAGG - Exonic
915166679 1:153951879-153951901 TGCACCCCAGGATTCCCTCACGG - Intronic
915649796 1:157301374-157301396 TGCACCCCAGGATGTTCTGTGGG - Intergenic
921837665 1:219794722-219794744 TTCACAGCAGGGTGGCCTCATGG + Intronic
922605563 1:226887887-226887909 TGCGCTGCAGGATGACCTGAGGG + Intronic
1063167103 10:3473563-3473585 TGCACAGCAGGATGTCTTGAGGG + Intergenic
1063462381 10:6222932-6222954 GGCAGCGCAGGACGGCCTGGTGG - Exonic
1065349794 10:24785255-24785277 TGCAACGCAAGAAGGCATGAGGG + Intergenic
1072501500 10:96022844-96022866 TGCACAGCAGGAGGCCCTGAGGG + Intronic
1073023355 10:100466340-100466362 TGCACTGTAGGAAGGCCTGAGGG + Intronic
1076755243 10:132567159-132567181 TGCACAGGAGGGTGGCCGGATGG - Intronic
1077134693 11:992689-992711 TGGCCCGCAGGATGGCAGGAAGG + Intronic
1077151134 11:1073614-1073636 GGCACCGCAGGAGGGCGGGAGGG + Intergenic
1079996042 11:27296013-27296035 AGGACCCCAGGATGGTCTGAAGG - Intergenic
1083622751 11:64057058-64057080 TGCGACGCAGGCTGGCCTGCAGG - Intronic
1083677025 11:64332033-64332055 TGCACCCCAGCATGGCTTGGAGG + Intergenic
1083708066 11:64530247-64530269 GGCACTGCAGACTGGCCTGAGGG - Intergenic
1091820297 12:3470969-3470991 TTCCGCCCAGGATGGCCTGAAGG - Intronic
1092240280 12:6831818-6831840 TGAAGCGCTGGATGTCCTGAGGG - Exonic
1094631876 12:32183810-32183832 TGTTCCACAGGATGGGCTGAGGG - Intronic
1095923305 12:47553010-47553032 TGTACCGAAGGCTGGTCTGATGG - Intergenic
1096986964 12:55766069-55766091 TGCACTTGAGCATGGCCTGAGGG - Intronic
1098408412 12:70152088-70152110 TGCACCCCTGGATGACCTGAGGG + Intergenic
1102456055 12:113071498-113071520 AGCACAGCAGGGTGCCCTGAAGG + Intronic
1102919459 12:116780837-116780859 TGGAAAGCAGCATGGCCTGATGG + Intronic
1104189099 12:126460698-126460720 TGCACAGAAGGATGGACAGATGG + Intergenic
1104929107 12:132329005-132329027 GGCGCTGCAGGATGGCCTCACGG + Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1105943202 13:25169743-25169765 TGCACCACGGGATGGCTAGATGG + Exonic
1112637700 13:101233879-101233901 TGCAGGGCAGCATGGCCTGTGGG - Intronic
1113475575 13:110578419-110578441 TTCACCGCAGAGTGACCTGAAGG - Intergenic
1113537041 13:111076307-111076329 TGCACCACCGGGGGGCCTGAGGG - Intergenic
1118254432 14:64193134-64193156 TGCTCTGCGGGATGCCCTGATGG + Intronic
1120996543 14:90422286-90422308 TGCACCAGAGGATGGGCAGAGGG - Intergenic
1122795384 14:104203471-104203493 TGCCTCGCAGGCTGGCCTCACGG + Intergenic
1124407926 15:29408266-29408288 TGCTCCCCAGGATGTCATGAGGG - Intronic
1127671278 15:61197456-61197478 TGCACCTCAGGTTTGCCAGATGG + Intronic
1139632632 16:68239759-68239781 TGCAGCCCAGGCAGGCCTGAGGG - Intergenic
1141764640 16:86050398-86050420 TGCAACCCAGCAGGGCCTGAGGG - Intergenic
1144738635 17:17568902-17568924 TGCACCCCAGGGTGGCCAGACGG - Intronic
1145279606 17:21457906-21457928 TGCTCAGCAGGAGGGCCAGAGGG + Intergenic
1145398273 17:22512586-22512608 TGCTCAGCAGGAGGGCCAGAGGG - Intergenic
1146375146 17:32288818-32288840 TGCCCTGCAGGATGGCTTGGCGG - Exonic
1148756486 17:49975787-49975809 TCCAGCCCAGCATGGCCTGAGGG + Intergenic
1150686367 17:67324306-67324328 TGCTCTGCAGGATGTCCAGATGG + Intergenic
1151553993 17:74837464-74837486 TGCACTGTAGGAGGCCCTGAGGG - Exonic
1151756762 17:76079695-76079717 TGTATCGCAGGATGTCCTGGGGG - Exonic
1153925670 18:9832875-9832897 TGCCCCGCAGGGAGGCCTGCAGG - Intronic
1160425297 18:78774908-78774930 TGCACCGGGGGAAGGACTGACGG - Intergenic
1160936666 19:1599364-1599386 TGGACTGCATGATGGCCGGATGG - Intronic
1161316568 19:3620122-3620144 CGCACCGCAGCTTGGCCTGCTGG + Exonic
1167161281 19:47768873-47768895 TGAACAGCAGGAGGGACTGAGGG + Intergenic
1167515235 19:49919522-49919544 TGCTACACAGGATGGCCTCAAGG + Intronic
924979856 2:209703-209725 TGCACTGCAGAGTGGCCTGAGGG + Intergenic
929949417 2:46395038-46395060 TGCAACCCAGGATGACCAGAGGG + Intergenic
934982043 2:98850705-98850727 TGCCCCGCAGCAGGGCCTGGAGG - Intronic
936058999 2:109282463-109282485 AGCACTGCAGGAAGGCCCGAGGG + Intronic
936348375 2:111692314-111692336 TGCACTGCAGAATGAGCTGAAGG - Intergenic
947832862 2:233154005-233154027 TTCTCCGCAGGGTGGTCTGATGG - Intronic
948764318 2:240211780-240211802 TGCACCTCCGGATAGGCTGACGG + Intergenic
948947485 2:241228462-241228484 TGCACAGCCGGATGGCCTGTGGG + Exonic
1171104724 20:22421475-22421497 AGCCCCGCAGCATGGTCTGAAGG + Intergenic
1173954348 20:47019110-47019132 TGAAGGGCAGGATGGCGTGAGGG - Intronic
1178722488 21:35022355-35022377 CGCCCCGCAGGAGTGCCTGAAGG + Intronic
1180020853 21:45125654-45125676 TGGAGGGCAGGAAGGCCTGATGG - Intronic
1180044894 21:45300844-45300866 TGAACCGCATGAGGGTCTGAAGG - Intergenic
1181169411 22:20999877-20999899 TGAGCAGCAGCATGGCCTGAGGG - Exonic
951743258 3:25947599-25947621 TGCACAACAAGTTGGCCTGAAGG + Intergenic
953778426 3:45843057-45843079 TGCACGGAATGATGGCCTGAAGG + Intronic
953886914 3:46719290-46719312 GGCCTCGCAGGAAGGCCTGAGGG + Intronic
954153993 3:48674645-48674667 TGCGTCGCAGTATGGCCTGCAGG + Exonic
954813987 3:53266037-53266059 TCCACTGCAGGATTGCTTGATGG - Intergenic
954885702 3:53871352-53871374 TGCACAGGGAGATGGCCTGATGG - Exonic
961165376 3:124759976-124759998 TGCACCCCTGGAGGGTCTGAAGG + Intergenic
963844708 3:150143526-150143548 TCCACAGCAGGATGGCCTGGTGG + Intergenic
964746243 3:160015396-160015418 TGCAAGGCATTATGGCCTGAGGG - Intergenic
968940482 4:3634942-3634964 GGCAGGGCAGGGTGGCCTGAGGG - Intergenic
969870691 4:10102718-10102740 TGCACAGCAGCCTGTCCTGAAGG - Intronic
970869659 4:20800264-20800286 TTCACCGAAGGTGGGCCTGAGGG - Intronic
977359079 4:95981048-95981070 TTCAGGGCAGGAGGGCCTGAAGG + Intergenic
978196044 4:105973190-105973212 TTCACGGCTGGAAGGCCTGAGGG + Intronic
985883724 5:2659741-2659763 AGCACCTCTGGATGTCCTGATGG + Intergenic
989204529 5:38797824-38797846 TCCACCGGTGGATGGCCTGCTGG + Intergenic
990481920 5:56220028-56220050 TGCACCGGAGGCTGAGCTGAGGG + Intronic
993487267 5:88502302-88502324 TGCACTGCAGGATGCCATGAAGG + Intergenic
1000256165 5:159540705-159540727 TGCGTTGAAGGATGGCCTGAAGG + Intergenic
1000702005 5:164463328-164463350 TGGACGGCAGGATAACCTGATGG + Intergenic
1001339743 5:170832267-170832289 TGCACCACAGGATGCCCAGTTGG - Intergenic
1001562224 5:172677255-172677277 TGCATGGCAGGGTGTCCTGAAGG + Intronic
1002095127 5:176826150-176826172 CGCACAGCAGGAGGGGCTGAGGG + Intronic
1002371343 5:178757482-178757504 TGCACCACAGGATGCCCAGCTGG + Intergenic
1004539501 6:16536351-16536373 TGGACTGCAGGATGGACAGATGG + Intronic
1005094618 6:22101097-22101119 TGCTACTCAGGATGGCCTAAAGG + Intergenic
1005192915 6:23246542-23246564 TGCACTGCAGGAAGACCTAATGG - Intergenic
1005838536 6:29725071-29725093 AGCACCTCAGGGTGGCCTCATGG - Exonic
1005859444 6:29889369-29889391 AGCACCTCAGGGTGGCCTCATGG - Intergenic
1005860538 6:29896691-29896713 AGCACCTCAGGGTGGCCTCATGG - Intergenic
1005867008 6:29944162-29944184 AGCACCTCAGGGTGGCCTCATGG - Exonic
1005868715 6:29957478-29957500 AGCACCTCAGGGTGGCCTCATGG - Intergenic
1005905906 6:30261244-30261266 AGCACCTCAGGGTGGCCTCATGG - Intergenic
1005932009 6:30491177-30491199 AGCACCTCAGGGTGGCCTCATGG - Exonic
1006042931 6:31270423-31270445 AGCACCTCAGGGTGGCCTCATGG + Exonic
1006052517 6:31355530-31355552 AGCACCTCAGGGTGGCCTCATGG + Exonic
1020073679 7:5243610-5243632 GGCACCGCAGGCAGGGCTGAGGG + Intergenic
1022300735 7:29099897-29099919 TGCCTCACAGGATTGCCTGAAGG + Intronic
1023638034 7:42232434-42232456 TGCTGGGCAGCATGGCCTGAAGG + Intronic
1030756725 7:113294956-113294978 TGTGCCACAGGGTGGCCTGAGGG + Intergenic
1042694638 8:71543308-71543330 TGAACTGCAGAGTGGCCTGAGGG + Intronic
1045897564 8:107237496-107237518 TGCAGGGCTGGATGGACTGAAGG + Intergenic
1047404420 8:124573320-124573342 TTCACAGCAGGATTCCCTGAAGG - Intronic
1049283671 8:141763163-141763185 GGCACCCCAGGCTGGCCTGCAGG + Intergenic
1049383960 8:142331555-142331577 TGCACTGCAGGACGGCCTGACGG + Intronic
1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG + Intronic
1049546861 8:143236286-143236308 AGCACCGCAGCATGGCCTCGGGG - Intergenic
1050285134 9:4093478-4093500 TGAACAGAAGGGTGGCCTGAAGG + Intronic
1060550284 9:124481718-124481740 TGAACAGCAGGATGCCCTGTTGG - Exonic
1061936863 9:133862728-133862750 TGCAGCGCAGGATGGCCTCGTGG - Intronic
1187338641 X:18402194-18402216 GGCACCATAGGATGGCCTCAGGG + Intergenic
1189236273 X:39489614-39489636 TGGGCCTCAGCATGGCCTGATGG + Intergenic
1192045020 X:67663291-67663313 TGCACTGCAGGAGCTCCTGAAGG - Intronic
1199678404 X:150207014-150207036 TGCCCAGCAGAATGGCTTGATGG + Intergenic
1199971274 X:152863701-152863723 TGCAGCTTAGGATGGCCTCAGGG - Intronic