ID: 1049385902

View in Genome Browser
Species Human (GRCh38)
Location 8:142342865-142342887
Sequence CAGGTGCTGGGACAGGTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 5, 3: 44, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049385902_1049385909 -3 Left 1049385902 8:142342865-142342887 CCGGACACCTGTCCCAGCACCTG 0: 1
1: 1
2: 5
3: 44
4: 438
Right 1049385909 8:142342885-142342907 CTGCCCGGGCCCACCACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049385902 Original CRISPR CAGGTGCTGGGACAGGTGTC CGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900468079 1:2835479-2835501 CAGGTCCTGGGACACTTGCCTGG + Intergenic
900532035 1:3159206-3159228 CAGGTGCCAGGACAGGCATCTGG - Intronic
900620536 1:3584965-3584987 GAGGTTCTGGGCCAGGTGTGAGG + Intronic
900936210 1:5767907-5767929 CAGGTGCTGGCAGAGGTGGCAGG - Intergenic
901400300 1:9011054-9011076 CAGGGGCTGTGCCAGCTGTCTGG - Intronic
901861871 1:12079585-12079607 CGGGAGCTGGGACAGGTGAAGGG + Intronic
902695734 1:18139604-18139626 AAGGCTCTGGGACAGGTCTCTGG + Intronic
902708585 1:18223254-18223276 CAGGAGCTGGGCCAGGTGAGTGG - Intronic
902910971 1:19597066-19597088 CAGGAAGTGGGACCGGTGTCTGG + Exonic
903202345 1:21752318-21752340 CAGGTGTTAGGAACGGTGTCTGG - Intronic
903479075 1:23639923-23639945 CAGGTGGTGGCCCAGGTGACTGG + Intronic
904827275 1:33281703-33281725 CAGGTGCTGGGCCAGGTAGGAGG - Exonic
905308074 1:37032862-37032884 GAGGTGCCGGAACCGGTGTCGGG - Intronic
905622737 1:39462880-39462902 GAGGTGCTGGGACAGGTCTTAGG + Intronic
905634325 1:39539238-39539260 TAGGTGGTTGGACAGGAGTCTGG + Intergenic
905770690 1:40636233-40636255 CCGGAGCAGGGCCAGGTGTCAGG - Intronic
906746089 1:48223136-48223158 CAGGTGCTCAGAGAGGAGTCAGG - Intronic
908169829 1:61493549-61493571 CAGATGTTGGTACAGGGGTCGGG + Intergenic
911559453 1:99386039-99386061 CAGAAGCTGGGAAGGGTGTCTGG + Intergenic
912194005 1:107376813-107376835 CATGTGCTGGGGCTGGTGGCTGG - Intronic
912471140 1:109907807-109907829 CAGGTTCTGGGACAGGTATAGGG - Intergenic
913159060 1:116129005-116129027 CAGGTACTGGGGCAGGCCTCTGG - Intronic
913255745 1:116951724-116951746 CAGCTGCTTGGACACTTGTCAGG + Intronic
914957160 1:152173113-152173135 CAAGGGATGTGACAGGTGTCAGG + Intergenic
915086884 1:153395074-153395096 CAAGGGCAGGGACAGGTCTCAGG + Intergenic
915097586 1:153474331-153474353 CTGAGGCTGGGAGAGGTGTCAGG - Intergenic
915632165 1:157161032-157161054 CATGTGTTGGGGCAGGTGCCAGG + Intergenic
915640789 1:157224353-157224375 CAGGTCCTGGGACATGGGTTGGG + Intergenic
915943693 1:160135089-160135111 GAGGGGCTGGTACAGGTGCCAGG + Intronic
917891848 1:179447220-179447242 CAGATGCTGGGAAGGGTGTGTGG - Intronic
919700757 1:200628851-200628873 AAGGTACTGGGACAAGTGTGAGG + Intronic
919752721 1:201048306-201048328 CCAGTGCTGGCACAGGGGTCAGG - Intronic
919758685 1:201082865-201082887 CAGGTGCTTGCCCAGGTGTCCGG - Intronic
919843475 1:201626286-201626308 GAGGTGCTGGGGCGGGTGGCAGG - Intronic
919847187 1:201649473-201649495 CAGCTGCTGGGGAAGGTGTGGGG + Intronic
920245445 1:204584423-204584445 CAGGCACTGGGCCAGGTGCCAGG + Intergenic
920684221 1:208096792-208096814 GAGGTGGAGGGGCAGGTGTCCGG - Exonic
920692237 1:208155681-208155703 CGGGTGTTGGGCCAGGAGTCAGG - Intronic
922079061 1:222277036-222277058 CAGTAGCTGGGACAGGTGCGAGG - Intergenic
922699651 1:227751303-227751325 CAGGTAGTGGGACAGGTGGTGGG - Intronic
922937529 1:229433428-229433450 CAGCTCCTGGAACAGGTGTCAGG - Intronic
923026462 1:230208467-230208489 TAGGTGGTGGGATATGTGTCTGG + Intronic
923030187 1:230243437-230243459 CGGGGGCTGGGAGGGGTGTCAGG + Intronic
1063168736 10:3486991-3487013 CAGCTGCTGGGACAGGACCCAGG - Intergenic
1064164271 10:12973285-12973307 CAGGACCTGGGACACGTGGCTGG - Intronic
1065536171 10:26716842-26716864 CAGGATCTGGGAGAGGTGACAGG - Intronic
1066226602 10:33389596-33389618 CAGGAGATGGGACAGGTGCCAGG + Intergenic
1067565949 10:47337175-47337197 CACGTGCTGGGCGAGGAGTCAGG - Intergenic
1069919470 10:71807765-71807787 CAGGTGCAGGGACTGGAGCCTGG + Exonic
1070866009 10:79708592-79708614 CAGATGGCGGGACAGGTGTGGGG + Intronic
1070917031 10:80161519-80161541 CAGGTGGTGGAGCAGGTGTGGGG - Intronic
1072637629 10:97187786-97187808 CAGGTGCTGGGGTGTGTGTCTGG - Intronic
1072645910 10:97253476-97253498 CAGATGCTGGGATAGGTGTTAGG + Intronic
1073246377 10:102093220-102093242 CAGGTGCAGTGACATGTGCCAGG + Intergenic
1074088746 10:110227384-110227406 CAGGTGCTGGGGGAGGTGCGAGG + Intronic
1074623931 10:115156942-115156964 CAGAGGCTGGGAAAGGTTTCGGG + Intronic
1075711153 10:124531097-124531119 GAGGTGGTGGGACAGGTGAAGGG - Intronic
1075930260 10:126289276-126289298 CAGGTGCTGGCAGAGATGCCTGG - Intronic
1076270805 10:129150556-129150578 CAGGTGCTGAGGCATGGGTCAGG - Intergenic
1076271116 10:129152942-129152964 CAGGTGAAGGCACAGGTGTCTGG - Intergenic
1076507770 10:130989218-130989240 CTGGTGCTGGGAAAGGTCCCAGG - Intergenic
1076658004 10:132037014-132037036 CAGGTGCTGGGCCAGGGCTGGGG + Intergenic
1077071498 11:676077-676099 CAGGTGCTGGGGGGGATGTCGGG - Intronic
1077180276 11:1209162-1209184 CAGGTGCTGAGGCCGGTGTCGGG - Intergenic
1077192872 11:1262786-1262808 CAGGAGGTGGGACAGGAGGCGGG - Intergenic
1077208100 11:1353675-1353697 CAGAGGCAGGGACGGGTGTCTGG - Intergenic
1077221897 11:1421673-1421695 CAGGAGCTGGGGCAGGGGGCAGG - Intronic
1077226421 11:1440792-1440814 CTGGTGCTAGAACACGTGTCAGG + Exonic
1077506191 11:2930967-2930989 CTGCTGCAAGGACAGGTGTCAGG - Intergenic
1079592069 11:22193141-22193163 CAGGCACAGGGACAGGTGCCTGG + Intergenic
1080768873 11:35322067-35322089 CATGTGATGGGACAGCTGTTGGG + Intronic
1081786932 11:45754273-45754295 CAGGCCCTGGGAGGGGTGTCTGG + Intergenic
1082011517 11:47452890-47452912 CAGGCTCTGGGACAGGTGGCTGG + Intergenic
1083067943 11:59945281-59945303 CAGGGGCTAGGACAGGGGTTTGG - Intergenic
1083777955 11:64903406-64903428 CAGGTGCTGGGGCCGGGGCCGGG - Intronic
1083903875 11:65657597-65657619 CAGGTGCTGGGCCACCTGCCTGG + Intronic
1084033517 11:66494408-66494430 CAGCTGCTGGGTCAGCAGTCTGG + Intronic
1084739308 11:71128708-71128730 GTGGTGCTGAGACAGATGTCGGG - Intronic
1085012653 11:73152096-73152118 CAGGTGCAGGGTCAGGTATTTGG - Intergenic
1086193053 11:84103312-84103334 CAGGCTCTGGGACAATTGTCAGG - Intronic
1087961632 11:104357709-104357731 CAAGTGCTGGGAGAGGTATTGGG - Intergenic
1089460489 11:118650301-118650323 CAGGTCCTGGGACAGAGATCTGG - Intronic
1090222344 11:125039024-125039046 CAGTTGTTGGCACAGGTATCAGG - Exonic
1090449287 11:126791802-126791824 CAGGTGGAGGGACAGTTGTGGGG + Intronic
1090616090 11:128516616-128516638 CATGGGCTGGGACAGCTGGCAGG + Intronic
1091832233 12:3557956-3557978 CAGGGGCTGGGTCAGAGGTCAGG - Intronic
1091911544 12:4234582-4234604 CAGGGGCTGGGAAGGGTGTGTGG - Intergenic
1091987501 12:4924168-4924190 CAGGTTCATGGACAGGTGTATGG - Intronic
1095704245 12:45220540-45220562 TAGGTGCTGGGTCAGGTGTTGGG + Intronic
1096215227 12:49794810-49794832 CAGGTGCAGGGCCAGCTGGCTGG - Exonic
1097484428 12:60177654-60177676 CAGGTGCTGGGAGAGAAATCAGG + Intergenic
1102167249 12:110816435-110816457 CAGTTGCTGGGCAAGGTGCCAGG + Intergenic
1102487556 12:113268544-113268566 CAGGTGCTGGCACAGGTGTGTGG - Intronic
1102553314 12:113708637-113708659 CAGAGGCTGGGAAAGGTGTGTGG + Intergenic
1102868161 12:116390873-116390895 TGGGTGCAGGGACAGGAGTCTGG + Intergenic
1103728056 12:123008674-123008696 CAGCAGCTGGGAGAGGTGGCAGG - Intronic
1103852815 12:123944173-123944195 CAGGGGGTGGTGCAGGTGTCTGG + Intronic
1104048700 12:125182507-125182529 CAGGGGCTGGGAAGGGTGTGAGG - Intergenic
1104195043 12:126528563-126528585 CAGTTGCTGGTATTGGTGTCTGG - Intergenic
1104675458 12:130709389-130709411 CTGGGGCTGGGGCAGGTCTCTGG + Intronic
1104807383 12:131598390-131598412 CAGGTGCTGGAAATGGAGTCTGG + Intergenic
1104904044 12:132204050-132204072 CGGGTGCTGGGGGAGGTGGCTGG - Intronic
1105407845 13:20146164-20146186 GAGGTGCTGGGACAGGGGCCTGG + Intronic
1106777722 13:33024812-33024834 CAGGTGCGGGGACAGTGGTAGGG + Intronic
1108832829 13:54500334-54500356 CTGGTGCTGGGACAGGCATGGGG - Intergenic
1110030656 13:70608400-70608422 CAGGCTTTGAGACAGGTGTCTGG - Intergenic
1110721329 13:78765479-78765501 TTGGTGATGGGACAGGTTTCAGG - Intergenic
1111854620 13:93622020-93622042 CAGAAGCTGGGAAGGGTGTCTGG - Intronic
1112093174 13:96104666-96104688 CAGGCCCTGGGGCAGTTGTCTGG - Intronic
1112693411 13:101919867-101919889 CAGGCGCTGCGCCAGGGGTCGGG - Intronic
1113425423 13:110203868-110203890 CAGTTGATGGGACAAGTATCTGG - Intronic
1113667646 13:112151998-112152020 GAAGAGCTGGGACAAGTGTCAGG - Intergenic
1113860666 13:113483743-113483765 CTGGTGCCGGGGCAGGTCTCCGG - Intronic
1114143813 14:19949107-19949129 TAGGTTCTGGGCCAGGTGTTGGG + Intergenic
1114646564 14:24259496-24259518 CAGGAGCTGGGACAGGAGCCAGG + Intronic
1116790103 14:49330442-49330464 CAGGGGCTGGAACAGGTGGGAGG - Intergenic
1117186789 14:53247734-53247756 CAGGAGCTGGGACATGAGACGGG - Intergenic
1120605443 14:86570578-86570600 CAGCTGTGGGGACAGGTGTGTGG + Intergenic
1121781728 14:96626329-96626351 CAGGCACTGTGCCAGGTGTCAGG + Intergenic
1122037584 14:98960168-98960190 CAGGTCCTGGGGCAGGAGTGGGG - Intergenic
1122410090 14:101521418-101521440 GAGGGGCTCGGACAGGTTTCAGG + Intergenic
1122857270 14:104565886-104565908 CGTGGGCTGGGACATGTGTCTGG - Intronic
1122870651 14:104636721-104636743 CAGGCGCTGGGACAGGATTAAGG - Intergenic
1202855140 14_GL000225v1_random:45263-45285 CAGGTGATGTGACAATTGTCTGG - Intergenic
1123403010 15:20004873-20004895 CAGGTGCTGGTCCAGGCGTCTGG + Intergenic
1123512350 15:21011527-21011549 CAGGTGCTGGTCCAGGCGTCTGG + Intergenic
1123954980 15:25325831-25325853 CAGGTGCATGGACAGCTGTGTGG - Intergenic
1124339928 15:28884441-28884463 CAGCTTCAGGCACAGGTGTCTGG + Intergenic
1124342790 15:28900954-28900976 CAGGTGCTGTGCCAGGTGCTGGG - Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124577228 15:30920705-30920727 CATGTGAAGGGACAGCTGTCGGG + Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124797970 15:32801068-32801090 CAGGTGATGCCAGAGGTGTCAGG - Intronic
1125277200 15:38005461-38005483 AAGAGGCTGAGACAGGTGTCAGG + Intergenic
1125548015 15:40522796-40522818 GAGGTGCTGCCACAGGTTTCTGG + Intergenic
1125599846 15:40909475-40909497 GATGAGCTGGGACAGGTCTCAGG - Intergenic
1126370929 15:47946327-47946349 CAAGGGCTTGGAGAGGTGTCTGG - Intergenic
1128108503 15:65061476-65061498 CAGGGGCTGGGGCAGGAGTGAGG + Intronic
1129774923 15:78230278-78230300 CAGTGACTGGGGCAGGTGTCCGG - Intronic
1131801241 15:96071561-96071583 CAGGAGCTGGGTCCGCTGTCAGG - Intergenic
1132220143 15:100099176-100099198 CAGGGGCTGGGACAGGTCCATGG + Intronic
1132514350 16:359351-359373 CAGGGGCTGGGACTGGGGCCAGG + Intergenic
1132576250 16:665787-665809 CAGGTGCTGAACCAGGTGTGTGG + Exonic
1132702940 16:1229732-1229754 CTGGGGCTGGGGCAGGTGCCAGG + Exonic
1132705383 16:1241136-1241158 CTGGGGCTGGGGCAGGTGCCAGG - Exonic
1132708512 16:1256499-1256521 CTGGGGCTGGGGCAGGTGCCAGG - Exonic
1132932466 16:2465925-2465947 CTGGTGCTGGGGCAGGTGTGGGG + Intergenic
1132933189 16:2468952-2468974 CAGGGGCTGGGACAGGTGGCTGG + Intergenic
1133342399 16:5045187-5045209 CAGGACCTGGGACAGGACTCCGG - Intronic
1133550018 16:6845400-6845422 ATGGTGCTGGGACAACTGTCTGG - Intronic
1134178173 16:12025498-12025520 CAGGTGCTGAGCTAGGTGCCAGG + Intronic
1134369716 16:13611828-13611850 TAGGTCTTGGGAGAGGTGTCAGG + Intergenic
1134632755 16:15768790-15768812 AAGGTGCTGGGCCTGGAGTCTGG + Intronic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1135874941 16:26189896-26189918 CAGGCTCTTGGACAAGTGTCAGG - Intergenic
1136702760 16:32158420-32158442 CAGGTGCTGGTACTTGTTTCAGG - Intergenic
1136764939 16:32769176-32769198 CAGGTGCTGGTACTTGTTTCAGG + Intergenic
1136803160 16:33101208-33101230 CAGGTGCTGGTACTTGTTTCAGG - Intergenic
1137239011 16:46638981-46639003 GAGTGGCTGGGACAGATGTCAGG - Intergenic
1137291583 16:47055377-47055399 CAGGAGCAGGGACAGGAGGCTGG + Intergenic
1138449093 16:57082437-57082459 CAGGTGCTGGGCCATGTCGCAGG - Exonic
1140523262 16:75600409-75600431 CAGTTGCTTGCTCAGGTGTCTGG - Intronic
1141882822 16:86871118-86871140 GGGGTGCTGGGGCAGGTGGCCGG + Intergenic
1142006618 16:87692358-87692380 CATGTCAGGGGACAGGTGTCAGG + Intronic
1142124538 16:88403608-88403630 CAGCTGCTGGGACAGGGAGCAGG + Intergenic
1142347234 16:89561563-89561585 CTGGTTCTGGGGCAGGTGGCCGG + Exonic
1142366292 16:89651715-89651737 CAGGTGTGGGCACAGGTGTGGGG - Intronic
1203067296 16_KI270728v1_random:1031301-1031323 CAGGTGCTGGTACTTGTTTCAGG + Intergenic
1142476072 17:191077-191099 TAGGGGCTGGGAGAGGGGTCAGG - Intergenic
1142967461 17:3590449-3590471 CAGGTGCTGGGGAAGGGCTCTGG + Intronic
1143019651 17:3910559-3910581 GAGGAGCTGGGACAGGTGCGGGG + Intronic
1143724710 17:8837095-8837117 CAGGTGCTGGGAGAAGAGGCTGG - Intronic
1144788818 17:17846358-17846380 GAGGTGTGGGGCCAGGTGTCTGG + Intronic
1145777466 17:27539356-27539378 GAAGTGCTGGCCCAGGTGTCAGG - Intronic
1147325546 17:39667913-39667935 TGGGTGCTGGGACGGGTGTCCGG + Intergenic
1147592915 17:41696581-41696603 CAGGTGCTGTGCCAGGTGTGGGG + Intergenic
1148619120 17:49021523-49021545 CAGGTCCTGGGCCAGGGGTGGGG - Intronic
1149120053 17:53151830-53151852 CAGTTTCTGGGACTGATGTCAGG + Intergenic
1150284488 17:63947319-63947341 CAGGTACTGGGACAGGTCCCAGG - Intronic
1150446903 17:65233129-65233151 CTGGTACTGGCACAGGTGTCAGG + Intergenic
1151460921 17:74253489-74253511 AAGCTGGTGGGACAGGTCTCAGG + Intronic
1151537084 17:74745150-74745172 CAGGGGCTGGGCCAGGGGCCGGG - Intronic
1152037626 17:77883209-77883231 CAGGGGCCAGCACAGGTGTCAGG - Intergenic
1152092753 17:78256232-78256254 CAGCTGCTGGGCCAAGCGTCTGG + Intergenic
1152471546 17:80492445-80492467 CAGGTGGTGGTGCAGGTGGCAGG + Intergenic
1152555830 17:81052711-81052733 CAGGTGCTGGGAGAGGGGGTGGG + Intronic
1152656765 17:81523507-81523529 TAGGTGCTGGGCCAGGAGTGAGG + Intronic
1153588204 18:6645526-6645548 TAGGTGCTGAGAGAGGTGTGTGG + Intergenic
1154461779 18:14597156-14597178 TAGGTTCTGGGCCAGGTGTTGGG + Intergenic
1155216676 18:23649367-23649389 CATGTGGTGGCTCAGGTGTCTGG - Intronic
1157579299 18:48764180-48764202 GAGGTGCTGGGACAGGAGAAGGG - Intronic
1157752554 18:50193117-50193139 CAGGAGCTGGGACTGGAGGCTGG - Intronic
1158976688 18:62716419-62716441 AAGGTGCTGGGCCAGGGGCCCGG + Exonic
1159203667 18:65222530-65222552 CAGGTTCTGGGAAATATGTCTGG - Intergenic
1159937198 18:74378645-74378667 CAGGAGCTGGGCCAGCAGTCAGG - Intergenic
1159957536 18:74530317-74530339 CAGATGCTGGGGCAGGCGTGGGG - Intergenic
1160036992 18:75310567-75310589 CAGCTGGTGGGGCAGGTGCCTGG - Intergenic
1160824082 19:1071356-1071378 GAGGTGAGGGGACAGGTGCCGGG + Intronic
1161114924 19:2491288-2491310 CAGCAGCTGGGAGAGGTTTCCGG + Intergenic
1161453661 19:4359958-4359980 CACGTCCTGGAACAGGTGTGCGG + Exonic
1161514174 19:4687509-4687531 CAGGTTCTGGGCAAGGTGTCAGG + Intronic
1161553100 19:4925263-4925285 CAGTAGCTGGGACAGGGTTCAGG - Intronic
1161949474 19:7459883-7459905 CAGCTGCAGGGAGAGGAGTCGGG - Exonic
1162302089 19:9849931-9849953 TGGGTGCTGGGCCAGGTGCCGGG - Intergenic
1162501507 19:11056663-11056685 GAGGTGCAGGGACAGGATTCTGG + Intronic
1162916635 19:13877763-13877785 CAGGTGCCTGCACAGGTGGCTGG + Exonic
1162965877 19:14155720-14155742 AAGGTACTGGGTCAGGGGTCGGG + Intronic
1163849647 19:19655858-19655880 CAGGTGCGGGGCCAGGTCTGGGG - Exonic
1164584118 19:29455231-29455253 AAGGTGCAGGGTCAGGTCTCTGG + Intergenic
1165828893 19:38720761-38720783 CAGGTGCTGGGACAGAGCTGAGG + Intronic
1165977640 19:39691354-39691376 CAGGTGCAGGTACAGGTGATTGG - Intergenic
1166204316 19:41259337-41259359 CAGGAGCTGGGAAGGGTCTCGGG - Intronic
1166841260 19:45698632-45698654 CATGAGCTGGGCCAGGTGCCGGG - Exonic
1167729839 19:51245697-51245719 CAGGGGCTGGGAGAGGGGACAGG - Intergenic
1167960211 19:53099026-53099048 CAGATGCTGGGGCTGGGGTCGGG - Intronic
924959734 2:23469-23491 CAGGTAATGGGACAGGATTCTGG + Intergenic
925156157 2:1650126-1650148 GATGTGCAGTGACAGGTGTCAGG - Intronic
925841482 2:7996013-7996035 CAGGAGCTGGGACAGGGGTTTGG - Intergenic
925889991 2:8425912-8425934 GGGGTGGTGGGACAGGTGTTGGG - Intergenic
925983593 2:9196931-9196953 CAGAAGCTGGGACAGGGGCCTGG + Intergenic
926984885 2:18611864-18611886 CAGGTGCTGTGTCAAGTTTCAGG + Intergenic
929532424 2:42761478-42761500 CAGGTGCTGGGAGAGGTGCGAGG + Intergenic
929578492 2:43067665-43067687 CCGGTGCTGGCCCAGGTGTTGGG - Intergenic
930865931 2:56121804-56121826 GAGGTGCTGGGGCATTTGTCAGG + Intergenic
931460881 2:62449037-62449059 CTGGTGCTGGGACAAGGGTATGG - Intergenic
932326114 2:70862974-70862996 CAGGTGCTGGGGCCGGGTTCAGG - Intergenic
933609167 2:84416049-84416071 CAGGAGCTGTGAGAGGTGTGAGG + Intergenic
934028334 2:88018907-88018929 CAAGTGCTGGCACAGGAGTGGGG + Intergenic
934640247 2:96023559-96023581 CAGGTGCTGGGGCATGGCTCTGG - Intronic
934793404 2:97081859-97081881 CAGGTGCTGGGGCATGGCTCTGG + Intergenic
934897439 2:98131109-98131131 CAGTGGCTGGGAAAGGTGTGAGG - Intronic
935336693 2:102023243-102023265 CAGTTGCTGGGACTGCTGGCTGG + Intronic
936261629 2:110964980-110965002 CAGAGGCTGGGAAAGGTGTGGGG - Intronic
937336149 2:121063508-121063530 CAGGTGGTGGGATAGGGTTCAGG - Intergenic
938235628 2:129704207-129704229 CAGGTGCGGGGACTGGGGCCTGG - Intergenic
938262015 2:129903193-129903215 CTGGTGCTGGGGCAGGTGATAGG - Intergenic
938564421 2:132505555-132505577 CAGGAGCTGGGAAGGGTGTGTGG - Intronic
938836853 2:135112586-135112608 CAGCTGGTGGGAGAAGTGTCTGG - Intronic
939714662 2:145569129-145569151 GAGGTGCTGGCAAAGGTGTGTGG - Intergenic
940804817 2:158175052-158175074 CAAGTGCTGGGAGAGGAGACTGG - Intronic
941748924 2:169115256-169115278 TAGGTGATGGCACAGGTGGCTGG + Intergenic
942909978 2:181231479-181231501 CAGCTGCAGGGAGAGCTGTCAGG - Intergenic
943581350 2:189687128-189687150 CAGAAGCTGGGAAAGGTGGCAGG - Intronic
943972420 2:194428087-194428109 CAGGTGCTGGGGCAGGGGTGGGG + Intergenic
944605393 2:201347520-201347542 CAGGTGCTGGGAAAAGAGCCAGG - Intronic
944866052 2:203863276-203863298 CAGGTTCAGGGCCATGTGTCTGG - Intergenic
946319683 2:218944914-218944936 CAGGAGCTGCGACAGGTGAGGGG + Intergenic
947798864 2:232914438-232914460 AAAGTGCTGAGACAGGTGTGAGG - Intronic
947838157 2:233189784-233189806 CAGGTGAGGGGACAGGTGGGTGG - Intronic
947890896 2:233618412-233618434 CATATGCTGTGACAGGTGTTTGG - Exonic
948458258 2:238117234-238117256 CAGGAGCTGTGACAGGGGCCAGG + Intronic
948458268 2:238117258-238117280 CAGGGGCTGTGACAGGGGTGGGG + Intronic
948458279 2:238117299-238117321 CAGGGGCTGTAACAGGGGTCAGG + Intronic
948807336 2:240458737-240458759 CAGCTGCTGGGACAGCAGGCTGG + Intronic
949079944 2:242088713-242088735 CAGGTGCCGGCCCAGGTGGCAGG + Intergenic
1168813946 20:723920-723942 CAGTTGCTGAGCCAGGTGGCTGG + Intergenic
1169117488 20:3075149-3075171 CAGTGGCTGGAAAAGGTGTCAGG + Intergenic
1172046312 20:32083121-32083143 CAAGAGCTTGGACAGATGTCAGG - Intronic
1172179316 20:32991191-32991213 CAGGTGCTGGGACTGGCTTGAGG + Intronic
1172885135 20:38225848-38225870 CTGGTGCTGGGGCAGGGATCTGG - Intronic
1173825266 20:46044012-46044034 GAGGTGCTGGGACCTGTGTGAGG + Intronic
1174183376 20:48688902-48688924 CAGGTGGTGGGGCAGGTGGCAGG - Intronic
1174215352 20:48912122-48912144 CAGGTGCCCGCAGAGGTGTCTGG - Intergenic
1174321054 20:49741950-49741972 CAGGGGCTGGGAGGCGTGTCAGG - Intergenic
1174398696 20:50264110-50264132 CAGGGGCTGGGAGAGGACTCAGG - Intergenic
1175290062 20:57869740-57869762 CCAGGGCTGGGACAGGTCTCAGG - Intergenic
1175293886 20:57895738-57895760 CCAGGGCTGGGGCAGGTGTCAGG - Intergenic
1175427436 20:58877543-58877565 CAGGTGCTAAGTCAGGTGTGAGG + Intronic
1175722009 20:61293294-61293316 CAGCTCCTGGGACGGGTGGCAGG + Intronic
1176134740 20:63517490-63517512 CAGGTGCTTGGACCAGTATCTGG - Intergenic
1176258695 20:64167466-64167488 CAGCTGGTGGAACAGGGGTCAGG + Intronic
1176370696 21:6060044-6060066 CAGAGGCTGGGACAGGATTCAGG - Intergenic
1176812775 21:13561434-13561456 TAGGTTCTGGGCCAGGTGTTGGG - Intergenic
1179412083 21:41169300-41169322 CAGGGGCTGAGTGAGGTGTCCGG + Intronic
1179489428 21:41730602-41730624 CAGGGGCTGGGGGAGGTGTGGGG - Intergenic
1179524193 21:41965179-41965201 CAGGTGCTGGGCTAGGTGCTGGG + Intergenic
1179610841 21:42548836-42548858 CAGGTGCTGCCCCAGGTGCCGGG - Intronic
1179752823 21:43478497-43478519 CAGAGGCTGGGACAGGATTCAGG + Intergenic
1180002107 21:44999843-44999865 CAGGTGCTGGGGCCGCTGTGCGG + Intergenic
1180106412 21:45621665-45621687 CAGGTGCTGGGAGAGGCTGCTGG - Intergenic
1180197916 21:46208494-46208516 CAGCTGCTGGGAAACGTGACTGG + Intronic
1180791613 22:18578085-18578107 CTAGTGCTGGGACCGCTGTCCGG - Intergenic
1180949902 22:19716224-19716246 CAGGAGCCAGGCCAGGTGTCTGG + Intronic
1181230127 22:21417225-21417247 CTAGTGCTGGGACCGCTGTCCGG + Intergenic
1181248522 22:21517641-21517663 CTAGTGCTGGGACCGCTGTCCGG - Intergenic
1181951072 22:26554309-26554331 CAGGGGCTGTGCCAGGTGTCAGG - Intronic
1183108225 22:35629792-35629814 CAGGCGCTGGGGCAGGTTCCAGG + Intronic
1183206838 22:36425467-36425489 CAGGTGTGGGGCCAGGTGTGGGG + Intergenic
1183261146 22:36796821-36796843 CGGCTGGTGGGGCAGGTGTCAGG + Intergenic
1183306121 22:37084146-37084168 CAGAGGCTGGGGCTGGTGTCAGG - Intronic
1183324382 22:37183564-37183586 CAGGCACTGTGACAGGTGGCAGG - Intronic
1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG + Intronic
1184038506 22:41929699-41929721 TATGTGCTGGGCCAGGTGCCGGG + Intergenic
1184057151 22:42060258-42060280 GAGGAGCTGGGACATGTGACAGG - Exonic
1184159311 22:42688479-42688501 CAGGAGCTGGAACAGTTGTTGGG + Intergenic
1184232380 22:43165511-43165533 CAGGTGCTGAGGCAGTTGCCGGG - Intergenic
1184347576 22:43923173-43923195 CGGGTGCTGGGGCTGGGGTCGGG - Intergenic
1184610224 22:45598704-45598726 CAGGTGCTGGGACAGTTCCCAGG - Intronic
1185104233 22:48858195-48858217 CGGGTGCTGTGACAGGTGGATGG - Intergenic
1185116492 22:48941143-48941165 CAGGTCCTGGGAAGGGTGACAGG - Intergenic
1185143591 22:49117278-49117300 CAGGGGCAGGGGCAGGGGTCGGG + Intergenic
1185217215 22:49608236-49608258 CCGGGGCTGGGACAGGTGGTGGG + Intronic
949938946 3:9139039-9139061 CAGGTGCTGGTACAGCTTTGGGG - Intronic
950850632 3:16059172-16059194 CAAGTGCTGGGAAGAGTGTCTGG + Intergenic
952820157 3:37479625-37479647 CATGTCCTGGGACATGTGGCAGG + Intronic
953067718 3:39489692-39489714 CAGGGGCTGGGACAGGAGCTGGG - Intronic
954107150 3:48415563-48415585 CAGGTGTTGGGCCAGGGGTGTGG - Exonic
954392702 3:50275869-50275891 CAGGGGGTGGGACAGGAGCCTGG - Intronic
954628815 3:52037325-52037347 CTGTAGCTGGGGCAGGTGTCAGG - Intergenic
954714021 3:52518241-52518263 CAGGTGCTGGGACAGGCACCAGG + Intronic
954759974 3:52866968-52866990 CAGGTGCAGGGAAAGGCGTGTGG + Intronic
955774648 3:62420456-62420478 CAGGAGCTGGGAGGGGTGTTGGG + Intronic
956054499 3:65284274-65284296 CAGGTACTCTGACAGGTGTTGGG - Intergenic
956378872 3:68644931-68644953 CAGCTGCTTGGAGAGGTGGCAGG - Intergenic
956403828 3:68907380-68907402 CAGCTGCTGATACAAGTGTCAGG + Intronic
957051911 3:75417950-75417972 CAGGTGCAGGGCTATGTGTCAGG + Intergenic
957602723 3:82359055-82359077 AAGGTGCTGGTATTGGTGTCTGG + Intergenic
958721002 3:97843416-97843438 CAGGAGGTGGGACGGGAGTCTGG + Intronic
959257293 3:104031410-104031432 CATGTGCTGGCACAGGAGCCGGG + Intergenic
961465652 3:127079454-127079476 CAGGTGCTGAGAGGGGTTTCTGG + Intergenic
961532259 3:127547029-127547051 CACGTGCTGGGGCAGGAGGCAGG + Intergenic
961635852 3:128331801-128331823 CAGGTGCTGGGGAGGGTGTGGGG + Intronic
961708766 3:128810501-128810523 AAGGTGCTGGCACATGTTTCTGG + Intronic
962373413 3:134839966-134839988 GAGGTCCTGGGACAGGAGTAGGG + Intronic
963793163 3:149604804-149604826 CAGGTGGGAGGACAGGTGCCAGG + Intronic
964254938 3:154765851-154765873 CAGGTGCTGGTATGGGTGCCAGG + Intergenic
964981491 3:162687148-162687170 CAGCAGCTGGGACAGGTATGCGG - Intergenic
966212032 3:177463503-177463525 CAGGTGCCGTAGCAGGTGTCTGG + Intergenic
966212473 3:177467878-177467900 CAGGTGCCGTAGCAGGTGTCTGG + Intergenic
966267998 3:178069954-178069976 CAGGGGCTGGGAAGGGTGTTGGG + Intergenic
967407803 3:189136933-189136955 CAGGTGCTAGGATAGGTGTATGG + Intronic
967814888 3:193790270-193790292 CTGGTGCTGGGAAAGGTACCAGG + Intergenic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
967893116 3:194377135-194377157 CAGGAGCTGGGAGAGGAGTGGGG + Intergenic
968652286 4:1765000-1765022 CAGGTACTGAGGCAGGTGGCGGG + Intergenic
968703509 4:2067515-2067537 CAGGTGCTGGGGAAGCTCTCTGG + Exonic
969461345 4:7330836-7330858 CACGTGGTGGGAGAGGTGTTGGG - Intronic
969977359 4:11117228-11117250 CAGGTGCGGGGTGAGGGGTCTGG - Intergenic
970019955 4:11557112-11557134 CAGGTGCAGGTAAAGGTGTGTGG - Intergenic
971876737 4:32318225-32318247 CAGGTGGTGGCACAGGTGCCAGG + Intergenic
974691775 4:65305892-65305914 CAGGTGCAGGGAGAGTTGTTGGG - Intergenic
975579575 4:75894608-75894630 CAGCTCCTGAGACATGTGTCTGG - Intronic
975663513 4:76710349-76710371 CAGCTGCTGGGAGAGGAGTCGGG + Intronic
975711079 4:77160001-77160023 CAGCTGCTGGGTCAGTTCTCAGG + Intronic
975942046 4:79659740-79659762 CAGGTGTTGGGACAGTTGGAGGG + Intergenic
976377570 4:84362847-84362869 CTGCTGCTTGGGCAGGTGTCTGG - Intergenic
977939217 4:102840553-102840575 CAGAAGCTGGGAAAGGTGTCTGG + Intronic
979754390 4:124322970-124322992 CAGCTGCTGAGAGCGGTGTCTGG + Intergenic
981623805 4:146734533-146734555 CAGGACTTGCGACAGGTGTCTGG + Intronic
985675818 5:1230811-1230833 CAGGTGCTGGGACAGGCTGCGGG - Intronic
985709861 5:1422172-1422194 CAGGCCCTGGCAGAGGTGTCAGG + Intronic
985790869 5:1926333-1926355 CAGGGGCTGGGACAGGAGCAAGG - Intergenic
985881465 5:2641800-2641822 CAGGTGCTGGCCCAGGTGGGTGG - Intergenic
985921906 5:2984097-2984119 CAGGCACTGGGACAGGTCACGGG - Intergenic
986001284 5:3633004-3633026 CAGGTGCTGGGCCCGGTGATGGG + Intergenic
986038102 5:3960174-3960196 CAGGTGCTGGGAAATGTGTTTGG + Intergenic
986161199 5:5231077-5231099 CAGGTGTGGGGACAGGAGTGAGG - Intronic
988229271 5:28452868-28452890 TAGGAGCTGGGAAATGTGTCCGG + Intergenic
991548090 5:67805914-67805936 CAGGATCTGGGACAGGTGTGAGG + Intergenic
992438173 5:76775097-76775119 CAGGTGTGGTGGCAGGTGTCTGG + Intergenic
994038233 5:95227014-95227036 CAGAGGCTGGGAGAGGGGTCTGG - Intronic
995139768 5:108721970-108721992 CAGGTCCTGTGCCAGGTATCTGG - Intergenic
996398675 5:123036681-123036703 CAGGCTCTGGGACAGCTGACGGG + Exonic
998396964 5:141824966-141824988 CAGGGGCTGGGAGAGGTATTGGG - Intergenic
998694031 5:144616998-144617020 CTGGTGCTGGGAAAAGAGTCTGG + Intergenic
998924317 5:147105376-147105398 CAGGAGCTGTAACAGCTGTCTGG - Intergenic
999822334 5:155240418-155240440 CAGGAGCAGGGACAGGGGTTGGG - Intergenic
1001024584 5:168213478-168213500 CAGGGGCTGGGAGAGGTGGAGGG - Intronic
1001377383 5:171274660-171274682 TAGGTGCTGGGACAAGTATCAGG - Intronic
1001753167 5:174146849-174146871 CAGATCCTGGGCCAGGTGTTGGG - Intronic
1002088748 5:176792453-176792475 CAGGTGCTGCAGCAGGTGTTGGG + Intergenic
1002174522 5:177393988-177394010 CAGGTGTGGGGTCAGCTGTCAGG + Intronic
1002799068 6:504026-504048 CCCGTGCTGGGACAGGTGCTGGG + Intronic
1003145353 6:3505588-3505610 CAGCTGTTGGGAGAGGGGTCTGG - Intergenic
1003298310 6:4853777-4853799 CAGGTGTGGGGACAGGTGTGAGG - Intronic
1003515625 6:6816107-6816129 CAGGTGCTTGGACATGGGGCAGG + Intergenic
1003772049 6:9316460-9316482 CAGCTGCTGGGAGATGTGTTTGG + Intergenic
1004516600 6:16326865-16326887 CAGGTGCTGGGGCAGGCTGCCGG + Exonic
1006390338 6:33754612-33754634 CAGGTGCAGGGCCAGCTGCCAGG - Intergenic
1007057226 6:38898788-38898810 CAGGTGATGGGACAGGGGTAAGG + Intronic
1007366564 6:41398198-41398220 CAGGAGAAGGGACAGGTCTCGGG + Intergenic
1007400820 6:41601317-41601339 CTGGGGCTGGGGGAGGTGTCAGG - Exonic
1007698164 6:43747000-43747022 CAGGAGTTGGGGCAGGGGTCAGG + Intergenic
1007732268 6:43954423-43954445 GAGTGGCGGGGACAGGTGTCTGG - Intergenic
1010193948 6:73222193-73222215 CAGCTGCTGGGAGAGGGGTTTGG - Intronic
1010595710 6:77761238-77761260 AAAGTGCTGGGACAGGTCTGAGG - Exonic
1012291215 6:97458117-97458139 CAGGTGGTGGGAGAGGTGGGAGG - Intergenic
1012848189 6:104416236-104416258 CAGGTGTTGGCACAGATGTTTGG - Intergenic
1013276735 6:108592691-108592713 CAGAAGCTTGGACAGGTGTGAGG - Intronic
1013723999 6:113069851-113069873 CACGTGTTGGGAGAGGTGCCCGG - Intergenic
1014867501 6:126550468-126550490 CAGGTCCTGTGACAGGGGTGTGG + Intergenic
1015898004 6:138035400-138035422 GAGGTGGTGGCACAGCTGTCAGG - Intergenic
1016171516 6:141024024-141024046 CAGCTGCTGGGAGTGCTGTCAGG + Intergenic
1018045256 6:159960200-159960222 CAGATTCTGGGAAATGTGTCTGG - Intergenic
1018100615 6:160435953-160435975 CAGGTGCTAGGATAGAGGTCCGG + Intronic
1019376161 7:693407-693429 CGGGGGCTGGGGCGGGTGTCGGG - Intronic
1020114788 7:5470386-5470408 CAGGAGCTGGGGCAGCTGCCCGG - Intronic
1020976045 7:15007834-15007856 CAGGTGCTGGGAGTGATGCCTGG - Intergenic
1022518873 7:30993024-30993046 CAGGGACTGGGACAGATCTCTGG + Intronic
1022807934 7:33841921-33841943 CAGCTGTTGGGCCAGGTGCCAGG + Intergenic
1023141047 7:37102663-37102685 CATGTGCTGGTACACGTGTGTGG - Intronic
1023843586 7:44109386-44109408 GGGGTGCTGGGACAAGTGACTGG + Intronic
1024635965 7:51290755-51290777 AGGGTGCTGGCCCAGGTGTCTGG - Intronic
1024898527 7:54289737-54289759 CAGAGGCTGGGAGAGGTGTATGG + Intergenic
1026804989 7:73423991-73424013 CAGGGGCTGGCCCAGGAGTCAGG + Intergenic
1029189653 7:98762450-98762472 CAGCGGCAGGGACAGGGGTCTGG + Intergenic
1030646154 7:112064106-112064128 CAGGTGCTGGCAGAGGTATGGGG + Intronic
1030650560 7:112111977-112111999 CAGGTGTTGGTACAGTTGTGTGG - Intronic
1031972122 7:128072672-128072694 CAGGGGCTGGGGGAGGTGGCGGG - Intronic
1032550365 7:132778922-132778944 CAGGTACTGTTCCAGGTGTCAGG - Intergenic
1033369911 7:140698135-140698157 CTGGAGCTGGGGCAGGTGTGGGG + Intronic
1034692050 7:153021757-153021779 CAGGACCTGGGACAGAGGTCAGG + Intergenic
1034959933 7:155358830-155358852 CAGGGGCTGGGGCAGGAGCCCGG - Intronic
1035027545 7:155835896-155835918 CAGGTGGTGTCACAGGTGCCTGG - Intergenic
1035537984 8:406978-407000 CAGGTGCGGGCCCAGGTGGCCGG + Exonic
1035667223 8:1388214-1388236 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667233 8:1388265-1388287 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667241 8:1388316-1388338 GAGGTGCTGGTTCAAGTGTCAGG + Intergenic
1035667251 8:1388367-1388389 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667278 8:1388519-1388541 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667310 8:1388671-1388693 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667320 8:1388722-1388744 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667338 8:1388824-1388846 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667365 8:1388976-1388998 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035667374 8:1389026-1389048 GAGGCGCTGGTTCAGGTGTCAGG + Intergenic
1035725030 8:1818909-1818931 CATGTGCAGAGACCGGTGTCAGG - Intergenic
1036760581 8:11506058-11506080 CAGGTTTTGGGCCAGGTGCCAGG + Intronic
1038425666 8:27462407-27462429 CAGGAGCTGGGGCAGGGGTCAGG + Intronic
1039920769 8:41892844-41892866 CAGGTACTGAGCTAGGTGTCAGG + Intronic
1040491329 8:47925005-47925027 CACGTGTTGGGACAGCTGTCTGG - Intronic
1041504762 8:58584181-58584203 CAGGTGCTGTGACATGTATATGG - Exonic
1042019874 8:64360412-64360434 AAGGTGCAGGGCCAGGAGTCAGG - Intergenic
1043490743 8:80746701-80746723 CAGGTGCTGTGAGAGGGATCAGG + Intronic
1043706653 8:83358694-83358716 CAGGTGCTTGGGCTGGTCTCTGG + Intergenic
1046648553 8:116811799-116811821 CAGGCTCTGTGACAGGTGTTGGG + Intronic
1048307629 8:133295278-133295300 CAGGCGCTGGGCCAGGGGCCAGG + Intronic
1048587252 8:135786066-135786088 AGGGTGCTGGGAAAGGTGGCTGG - Intergenic
1048967370 8:139624635-139624657 CATGTGCTGGGACATGGGGCTGG - Intronic
1049385861 8:142342667-142342689 CAGGTGCTGGGACAGGTGCTGGG - Intronic
1049385877 8:142342742-142342764 CAGGTGCTGGGACAGTTGCCTGG - Intronic
1049385895 8:142342830-142342852 CAGGTGCTGGAACAGGTGTCCGG - Intronic
1049385902 8:142342865-142342887 CAGGTGCTGGGACAGGTGTCCGG - Intronic
1049385917 8:142342929-142342951 CAAGTGCTGGGACAGGTGCTGGG - Intronic
1049385928 8:142342994-142343016 CAGGTGCTGGGACAGGTGCAGGG - Intronic
1049519467 8:143080657-143080679 AAGGTGCTGGGAGAGGGGTCCGG + Exonic
1049549095 8:143248354-143248376 CACGTGCAGTGACAAGTGTCTGG + Intronic
1052426596 9:28313056-28313078 CAGATGTTGAAACAGGTGTCAGG - Intronic
1053005473 9:34601322-34601344 CAGAGGCTGAGACAGGAGTCTGG + Intergenic
1053352856 9:37424786-37424808 GAGGGGCGGGGACAGGTGTGCGG + Intronic
1054854769 9:69886687-69886709 CAGAGGCTGGGACAGTTGTGGGG + Intronic
1055407202 9:75987473-75987495 AAGGTGCTGGGTTAGGTTTCTGG - Intronic
1056193434 9:84206667-84206689 CAGGAGCTGAGACAGCTGTAAGG + Intergenic
1056496097 9:87156905-87156927 CAGGTTCTAGGACAGGTAGCTGG - Exonic
1057484967 9:95475659-95475681 CAGGTACTGGGAGTGGTGTTTGG + Intronic
1058186170 9:101858021-101858043 CAGGGGGTTGGGCAGGTGTCAGG + Intergenic
1059351808 9:113670798-113670820 CAGGGTCTGGGCCAGGTGTGGGG - Intergenic
1060177608 9:121508544-121508566 CAGGTGCTGGGAAAGGGATTTGG - Intergenic
1060555568 9:124505715-124505737 CAGGAGCTGGGAGAGGAGCCCGG + Intronic
1060897261 9:127225586-127225608 GAGGTGCAGGGACGGGTGTCGGG + Intronic
1061662048 9:132136737-132136759 CAGCTCCTGGGACAGGTGCTCGG - Intergenic
1061729850 9:132605265-132605287 CAGGTTCTGTGACAGGTGCTGGG + Intronic
1061745616 9:132737958-132737980 CAGGTGCTGGGACAGCCTTGTGG + Intronic
1061872736 9:133529330-133529352 CAGGAGCTGGGAGAGGGGTTGGG + Intergenic
1062096580 9:134706913-134706935 AAGGTGCTGGGACAGGGGCTAGG - Intronic
1062276302 9:135733173-135733195 CAGGTGCGGGGGCAGGTATGAGG - Intronic
1062276322 9:135733234-135733256 CAGGTGCAGGGGCAGGTATGGGG - Intronic
1062276338 9:135733282-135733304 GAGGTGCAGGGGCAGGTGTGGGG - Intronic
1062276360 9:135733342-135733364 CAGGTGTGGGGGCAGGTGTGAGG - Intronic
1062276375 9:135733391-135733413 CAGGTGCAGGGGCAGGTATGGGG - Intronic
1062276429 9:135733532-135733554 CAGGTGCAGGGGCAGGTATGGGG - Intronic
1062276443 9:135733568-135733590 CAGGTGTGGGGGCAGGTGTGAGG - Intronic
1062278812 9:135742971-135742993 CAGGTGCTGGGGCTGGAGACAGG + Intronic
1062365575 9:136207122-136207144 CAGCTGGCGGGAGAGGTGTCTGG - Exonic
1062601437 9:137320243-137320265 GAGGGGCTGGCACAGGTGGCAGG + Intronic
1185892484 X:3833741-3833763 CAGGTTCTGGAGCAGGTGGCGGG - Intronic
1185897592 X:3872160-3872182 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1185902711 X:3910592-3910614 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1186203898 X:7181600-7181622 CATGGGCTGTGATAGGTGTCTGG - Intergenic
1189108285 X:38259308-38259330 CAGAAGCTGGGACAGGTGCATGG - Intronic
1189494817 X:41499516-41499538 CAGGTGCTTGGACCAGTATCTGG - Intergenic
1194147080 X:90278408-90278430 CATGGGCTGGGACATGTGACAGG + Intergenic
1199265729 X:145823434-145823456 CAGCTGCTGGGACAGGTGAGAGG - Exonic
1200144895 X:153921404-153921426 CAGGCGCTGGGCCAGGGGCCCGG + Exonic
1200493483 Y:3855175-3855197 CATGGGCTGGGACATGTGACAGG + Intergenic
1200933315 Y:8716434-8716456 CAGGGGCTGTGACAGATGCCTGG - Intergenic
1201144140 Y:11053546-11053568 GTGGTGCTGAGACAGATGTCAGG - Intergenic