ID: 1049386725

View in Genome Browser
Species Human (GRCh38)
Location 8:142346670-142346692
Sequence GTAGGTCACAAGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049386718_1049386725 2 Left 1049386718 8:142346645-142346667 CCTGTTCTTCCCGGGACGTGTCC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data
1049386712_1049386725 22 Left 1049386712 8:142346625-142346647 CCCCGCGTGCCTGTCTGCAACCT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data
1049386713_1049386725 21 Left 1049386713 8:142346626-142346648 CCCGCGTGCCTGTCTGCAACCTG 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data
1049386711_1049386725 27 Left 1049386711 8:142346620-142346642 CCAGACCCCGCGTGCCTGTCTGC 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data
1049386715_1049386725 13 Left 1049386715 8:142346634-142346656 CCTGTCTGCAACCTGTTCTTCCC 0: 1
1: 0
2: 1
3: 19
4: 363
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data
1049386714_1049386725 20 Left 1049386714 8:142346627-142346649 CCGCGTGCCTGTCTGCAACCTGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data
1049386722_1049386725 -8 Left 1049386722 8:142346655-142346677 CCGGGACGTGTCCTGGTAGGTCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data
1049386721_1049386725 -7 Left 1049386721 8:142346654-142346676 CCCGGGACGTGTCCTGGTAGGTC 0: 1
1: 0
2: 1
3: 3
4: 50
Right 1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049386725 Original CRISPR GTAGGTCACAAGGATGCTGC TGG Intronic
No off target data available for this crispr