ID: 1049386886

View in Genome Browser
Species Human (GRCh38)
Location 8:142347338-142347360
Sequence GATCCCTCCCTCTGTGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049386886_1049386891 27 Left 1049386886 8:142347338-142347360 CCCAAGTCACAGAGGGAGGGATC 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1049386891 8:142347388-142347410 GATGAAGTGAGCCTCCAGCATGG No data
1049386886_1049386892 28 Left 1049386886 8:142347338-142347360 CCCAAGTCACAGAGGGAGGGATC 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1049386892 8:142347389-142347411 ATGAAGTGAGCCTCCAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049386886 Original CRISPR GATCCCTCCCTCTGTGACTT GGG (reversed) Intronic
900835814 1:5003108-5003130 GAGCCCTTCCTGTGTCACTTTGG - Intergenic
901045180 1:6392004-6392026 GAGCCCTGCCCCTTTGACTTTGG - Intronic
902717371 1:18281975-18281997 GACTCCTCCCTCTGTGACCCTGG + Intronic
903337827 1:22636709-22636731 GCCCCCTCCCTCTGGGACTCTGG - Intronic
903681151 1:25098114-25098136 GATCCCTCCCCATTTGAGTTGGG - Intergenic
903685808 1:25131076-25131098 GCTCCCTGGCTGTGTGACTTTGG - Intergenic
904157463 1:28496600-28496622 GTTCCCTCCATATGTCACTTTGG - Exonic
904472656 1:30745627-30745649 GTTGCCTCGCTCTGTGACTGTGG - Intronic
904987265 1:34562172-34562194 GTTCCCTCCCAGTGTAACTTAGG - Intergenic
905384077 1:37587422-37587444 GGTCGTTTCCTCTGTGACTTAGG + Exonic
910086795 1:83412524-83412546 CAACCCTCCCTCTGTGATATTGG - Intergenic
910172656 1:84394344-84394366 GATCTCTCCCAATCTGACTTAGG - Intergenic
913598119 1:120396911-120396933 GATCCCTCTCTGTGGGACATTGG - Intergenic
914089212 1:144482409-144482431 GATCCCTCTCTGTGGGACATTGG + Intergenic
914309401 1:146451806-146451828 GATCCCTCTCTGTGGGACATTGG - Intergenic
914592710 1:149121331-149121353 GATCCCTCTCTGTGGGACATTGG + Intergenic
917549984 1:176016574-176016596 TTTCCCTCCCTCTCTGAGTTAGG + Intronic
920436044 1:205947829-205947851 TATCTCTCTCTCGGTGACTTTGG - Intergenic
920519676 1:206613947-206613969 CTTCCCTGCCTGTGTGACTTTGG - Intergenic
922524472 1:226289386-226289408 GGTCTCTCTCTCTGTCACTTAGG + Intronic
922781371 1:228255707-228255729 CTTCCCTACCTGTGTGACTTGGG - Intronic
922969650 1:229725365-229725387 GCTCTCTACCTGTGTGACTTTGG + Intergenic
923259774 1:232257834-232257856 GCTCCCTCCCACTCTGCCTTGGG - Intergenic
924232762 1:241976224-241976246 CCCCACTCCCTCTGTGACTTTGG - Intergenic
924461755 1:244265983-244266005 GGTCCCCGCCTCTGTGACTGAGG + Intergenic
1063965044 10:11340121-11340143 TACCCCTCCCTCTGAGAGTTTGG + Intergenic
1066215819 10:33286321-33286343 CATCCTTCCCTCTGTGACACAGG - Intronic
1068510017 10:57953922-57953944 GCTACCTTCATCTGTGACTTAGG - Intergenic
1069603974 10:69728499-69728521 GCTCACTCCCTGTGTGACCTTGG + Intergenic
1069711329 10:70490722-70490744 GTTCCCTGCCTCTGTTTCTTGGG + Intronic
1071012739 10:80956645-80956667 AAAGCCTACCTCTGTGACTTTGG + Intergenic
1071059018 10:81548247-81548269 CACCCCTCCCTCTGGGAGTTTGG - Intergenic
1071302858 10:84269948-84269970 GTTCCCTTCCTGTGTGACTTTGG + Intergenic
1071457121 10:85859541-85859563 TATCCCTCCAACTTTGACTTTGG + Intronic
1072521016 10:96230208-96230230 GGTCCCTCTCTCTGTGGCTCCGG + Intronic
1072623898 10:97098805-97098827 GATCCCTCCATTTGGGAATTGGG - Intronic
1074436042 10:113435317-113435339 GATCCTTCCCTCTCAGCCTTCGG + Intergenic
1074774588 10:116757651-116757673 GATTTCTTGCTCTGTGACTTTGG + Intergenic
1074900494 10:117812412-117812434 GATTCCTGCCTCTGTGCCTTTGG + Intergenic
1075999497 10:126904227-126904249 GGTCCCTACCTCTGTGAGGTAGG - Intergenic
1079290057 11:19179946-19179968 GATCATGCCCCCTGTGACTTAGG + Intergenic
1080864580 11:36182040-36182062 CTTCCCTCCCTCTCTGACTTTGG + Intronic
1081658659 11:44874524-44874546 GAATCCTTGCTCTGTGACTTGGG - Intronic
1081755832 11:45543753-45543775 GATACCTCTTTCTATGACTTTGG + Intergenic
1083304176 11:61754159-61754181 TTTCTCTCCCTCTGTGACTTGGG + Intronic
1083894142 11:65611779-65611801 GTCCCCTCCCCCTGTGCCTTCGG + Intronic
1083958885 11:66002911-66002933 TATCACTCCCTCTGTGACCTTGG - Intronic
1084380822 11:68811630-68811652 GCTCCCTCTTCCTGTGACTTGGG + Intronic
1086265667 11:84994748-84994770 GATGCCTCCCTTTTTGGCTTTGG - Intronic
1087974268 11:104525260-104525282 AGTCCCTCTCTCTGTGACTTTGG + Intergenic
1089688431 11:120171235-120171257 CATTCCTCCATCTGTGACCTCGG - Exonic
1090029324 11:123194388-123194410 CTTCCTTCCCTGTGTGACTTGGG + Intronic
1090051912 11:123387448-123387470 GAACACTGCCTCAGTGACTTTGG - Intergenic
1090182877 11:124716472-124716494 GATACCTCACTCTGTGAGCTAGG - Intergenic
1090480946 11:127067542-127067564 CACCCCTCCCTCTGTGTCTTAGG + Intergenic
1091333767 11:134751556-134751578 GATTCCTCCCGCTGTTCCTTTGG - Intergenic
1091353238 11:134914387-134914409 GATCCCTCCCTAGGGTACTTGGG + Intergenic
1091597108 12:1885493-1885515 GATTCCTCCCTCTGTGATGGAGG - Intronic
1091783973 12:3231254-3231276 GTTCCCTAACTCTGTGACCTTGG + Intronic
1092054573 12:5498249-5498271 GATCCCTCATTCTGTAATTTTGG + Intronic
1094070588 12:26408580-26408602 GTTCTCTCTCTCTGTGCCTTGGG + Intronic
1094253513 12:28394816-28394838 GATCCCTGGCTTTGTCACTTAGG + Intronic
1094296616 12:28914363-28914385 GCTTCCTCCCTCTTTAACTTTGG - Intergenic
1096720007 12:53514189-53514211 GTCCCCTCCCTCTGTGGCCTTGG + Exonic
1098586945 12:72165173-72165195 CATTGCTCTCTCTGTGACTTTGG + Intronic
1100135942 12:91553425-91553447 GTTCCGTCCCACTTTGACTTGGG - Intergenic
1100276730 12:93078256-93078278 CCTCTCTCCCTCTGTTACTTGGG - Intergenic
1100443300 12:94637982-94638004 CATGCCTCCCTCTGTGCCTGTGG - Intronic
1101417994 12:104525516-104525538 GTTCTCTACCTGTGTGACTTGGG + Intronic
1102483778 12:113242418-113242440 GTTTCCTCCCTCTGTGACCTTGG + Intronic
1102601375 12:114033237-114033259 GCCCCCTCCCAGTGTGACTTGGG + Intergenic
1102973448 12:117189783-117189805 GCACACTCCCTCTGTGACCTTGG - Intronic
1104367172 12:128188335-128188357 GATCCCTTCCACAGAGACTTTGG - Intergenic
1107912802 13:45121212-45121234 GACCTCTCCTTCTGTGAGTTTGG - Intronic
1108528148 13:51303315-51303337 GCCCCCTCCCTCTGGTACTTAGG - Intergenic
1109456365 13:62596821-62596843 AATCTCTCCCTCTAAGACTTAGG - Intergenic
1116878249 14:50136498-50136520 GAACCCGCCCTCTGTGATGTGGG - Intronic
1116948806 14:50859835-50859857 AATCCCTCCCTTTCTGCCTTTGG + Intronic
1118811501 14:69278032-69278054 AAGCCCTCCCTCTGTGACCCAGG + Intronic
1120103615 14:80470828-80470850 GTTCCATCCCCCTGTGATTTGGG + Intergenic
1122023762 14:98859784-98859806 GTTCCCTCCCTCTGTGGATCTGG - Intergenic
1126065840 15:44825675-44825697 GATCCTTCCCTCTGGGAAATGGG + Intergenic
1126093994 15:45074891-45074913 GATCCTTCCCTCTGGGAAATGGG - Exonic
1126671705 15:51121254-51121276 ACTGCCTCCCTCTGTGACCTTGG - Intergenic
1127643795 15:60940060-60940082 GATCCTCCCATGTGTGACTTTGG - Intronic
1128098923 15:64981647-64981669 GATCTCTCCCTCTGTTGCTCAGG - Intronic
1128495132 15:68193702-68193724 GCTGCTTCCCACTGTGACTTTGG - Exonic
1130063661 15:80587603-80587625 CATCCCTGCCTCTGTGACCTAGG + Intronic
1131509977 15:93044503-93044525 GATGCCTCCCTGTGTGGCTGGGG + Intronic
1133669139 16:8000359-8000381 CATCCCTCCCTGAGTGATTTTGG + Intergenic
1133964845 16:10523244-10523266 TATCCCTCCTTCTGTGGATTGGG - Intergenic
1136405793 16:30046199-30046221 CATCCAAGCCTCTGTGACTTTGG + Intronic
1143892352 17:10112236-10112258 CATCCCTCGCTGTGTGTCTTCGG - Intronic
1144519316 17:15943976-15943998 CATCCCTCCCTCTCTGCCTGTGG - Intergenic
1145857505 17:28175575-28175597 AGTACCTCCCTTTGTGACTTAGG + Intronic
1146013596 17:29214921-29214943 TATCACTTCCTGTGTGACTTTGG + Intergenic
1146164417 17:30576693-30576715 CCTCCCTCTCTCTGTGCCTTGGG - Intergenic
1146602419 17:34229490-34229512 TCTCCCTCACTCTGTTACTTGGG + Intergenic
1147120351 17:38331846-38331868 GACCCCTCCCTCTGAGCCTCTGG + Intronic
1147364275 17:39950360-39950382 CTTCCCTCCCTATGTGACCTTGG - Intergenic
1148688439 17:49513391-49513413 GATTCCTCCCTCTGAGTCTCTGG - Exonic
1149650248 17:58272019-58272041 CTTCCCTCCCTCTATGACCTTGG - Intronic
1150438734 17:65174284-65174306 GCTCACTGCCTCGGTGACTTCGG - Intronic
1153239580 18:3018245-3018267 GCTCACTGCCTCTGTGTCTTGGG - Intergenic
1153752252 18:8244869-8244891 GATACCTCACTCTGTGGTTTAGG + Intronic
1154982887 18:21518531-21518553 GAAGCCTACCTCGGTGACTTTGG + Intronic
1157480693 18:48051717-48051739 GAGCCCTCACTTTGTGACTGAGG - Intronic
1158425470 18:57336414-57336436 GATCACTCCCTCTTTGAAATGGG - Intergenic
1164719443 19:30421703-30421725 GATCTCTCACCCTGTGACTTAGG - Intronic
1165426014 19:35745851-35745873 GATCCTTGCATCTGTTACTTAGG + Exonic
1165566647 19:36735011-36735033 GATCTCTCCCTCTGTGGCCCAGG - Intronic
1165717357 19:38055074-38055096 GCTTCCTAACTCTGTGACTTTGG + Intronic
1166316644 19:41993196-41993218 GATTCCTCCCTGTGTGTCTGGGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167314489 19:48755800-48755822 GATCCTTCTCTCTGAGACTCAGG + Intronic
1167496187 19:49819797-49819819 GATAGATCCCTCTGTGGCTTGGG + Intronic
1168085701 19:54044185-54044207 GATCCCTTGTTCTGTGTCTTGGG - Intronic
925605714 2:5657923-5657945 GATTCCTCTCTATGTGATTTTGG - Intergenic
925739793 2:6995518-6995540 GTTCCCTACCTCTGAGATTTTGG - Intronic
926339987 2:11897209-11897231 GATTTCTCCCTCTGTTAATTTGG + Intergenic
927318435 2:21714598-21714620 GAGCCCTCCCTCTGTCACCCAGG + Intergenic
927998403 2:27503048-27503070 TATCCCTCCCTCTGGTACTGAGG + Intronic
929019920 2:37542335-37542357 GATCCCTACCTATGTCACTTAGG - Intergenic
931694552 2:64861941-64861963 GAGCCCTCCATCTGTGCCCTGGG + Intergenic
933665791 2:84963845-84963867 CTTTCCTCCCTCTGTGAATTAGG + Intergenic
933976897 2:87519118-87519140 CACCTCTCACTCTGTGACTTTGG + Intergenic
935887246 2:107635560-107635582 TCCCCCTCCCTCTGTGACTCTGG - Intergenic
935887478 2:107637840-107637862 GAAGCCACCCTCTGTGAATTAGG + Intergenic
936316920 2:111431686-111431708 CACCTCTCACTCTGTGACTTTGG - Intergenic
936573731 2:113636581-113636603 GTTTCTTCCCTCTGTGACTATGG - Intronic
937327635 2:121000976-121000998 ATTCCTTGCCTCTGTGACTTTGG - Intergenic
937676888 2:124600943-124600965 GATTCCTACTTCTGTGCCTTTGG - Intronic
937788520 2:125931125-125931147 GCTCACTACCTCTGTGACCTTGG + Intergenic
938108509 2:128549300-128549322 GTTTCCTCACTGTGTGACTTGGG + Intergenic
939310554 2:140469849-140469871 GATTACTAGCTCTGTGACTTTGG + Intronic
939740525 2:145900897-145900919 GATGCCTTCCTTTGTTACTTCGG + Intergenic
940498824 2:154468928-154468950 GACCCCTCCCTTTGAAACTTGGG + Intergenic
940749566 2:157611225-157611247 GGGCCCTTCCTCTTTGACTTTGG + Intronic
941159311 2:162017866-162017888 GCTCACTAGCTCTGTGACTTAGG + Intronic
941774556 2:169377992-169378014 GATCTCTCACTCTGTCACCTAGG - Intergenic
946396444 2:219445853-219445875 AATCCCACCCTCAGGGACTTAGG - Intronic
947177262 2:227380467-227380489 GTACCCTGCCTCTGTGACTGTGG - Intronic
948018187 2:234707238-234707260 GGTCTCTACCTCTGTGAGTTTGG + Intergenic
948333475 2:237190201-237190223 GAACCCTCCCTCAGTCACCTTGG - Intergenic
948602959 2:239117708-239117730 GACCCCTCGATCTGGGACTTTGG - Intronic
1169789842 20:9398053-9398075 GTGGCCTCTCTCTGTGACTTGGG + Intronic
1171180711 20:23088618-23088640 GATCCCTGCCTCTGTGATCCTGG + Intergenic
1172631285 20:36379736-36379758 GCTTCCTTGCTCTGTGACTTTGG + Intronic
1172809130 20:37634427-37634449 GATTCCTCCCTCACTGACTGTGG - Intergenic
1173785535 20:45790342-45790364 AATCCCTCCCTCTGTTATTTGGG - Intronic
1174481072 20:50831836-50831858 GCTCCCTCCCTCTGCAGCTTGGG - Intronic
1175246867 20:57587483-57587505 GATCCAGCCCTGTGTGACCTTGG - Intergenic
1179367913 21:40775580-40775602 GATCCCTCTCTCTGAGAGCTGGG + Intronic
1179537832 21:42063649-42063671 AATCCCTCCCTCTAAGACTCTGG + Intronic
1180948919 22:19712066-19712088 GCTCCCTTACTCTGGGACTTTGG - Intergenic
1184499481 22:44863190-44863212 GGGCCCTCCCTCTGTGACCCTGG - Intergenic
1184597754 22:45524508-45524530 CATCCCTCCCTCTGGGGCCTTGG + Intronic
1185413054 22:50696061-50696083 GATCCGTAGCTCTGTGACTCTGG - Intergenic
1185426446 22:50774298-50774320 GTTTCTTCCCTCTGTGACTATGG + Intronic
949401993 3:3674638-3674660 TATCACTTACTCTGTGACTTTGG - Intergenic
955498141 3:59557867-59557889 GATACCTCACTCTGTGGCATTGG - Intergenic
955527758 3:59838536-59838558 GATCCCTCCATCTCTTACTCTGG + Intronic
955665416 3:61344694-61344716 GATCCTTTCCTCAGGGACTTGGG + Intergenic
956451906 3:69383583-69383605 GAGGTCTCCCTCTGTCACTTAGG + Intronic
956756136 3:72388773-72388795 GAACCCTAAGTCTGTGACTTTGG + Intronic
961172685 3:124809361-124809383 GAGGTCTCCCTCTGTGAGTTTGG + Intronic
962607670 3:137045905-137045927 GATCCCTTCCTCTGTGTTCTTGG + Intergenic
963015630 3:140821420-140821442 CATCCCCTCCTCTGTCACTTTGG + Intergenic
967080960 3:186048934-186048956 GGTCCCTGGCTTTGTGACTTAGG - Intronic
968123324 3:196141494-196141516 GGCCCCTCCATCTGTGACCTTGG - Intergenic
969651797 4:8472398-8472420 ACTCCTTCCCACTGTGACTTCGG - Intronic
969659730 4:8519505-8519527 GATCCCTCACTCTGGGAGATGGG + Intergenic
969869759 4:10097330-10097352 GCTCCCTTCCTCTGCCACTTTGG + Intronic
970340734 4:15103867-15103889 GAAACTCCCCTCTGTGACTTTGG - Intergenic
971413759 4:26403212-26403234 AATCCATCCCTTTGTGAATTGGG - Intronic
972724219 4:41732116-41732138 GCTCCCTCCCCCTGTGCCTTTGG - Intergenic
972901312 4:43687602-43687624 GATCTCTATCCCTGTGACTTGGG + Intergenic
976102250 4:81577971-81577993 ACTCCCTTGCTCTGTGACTTTGG + Intronic
977330596 4:95632544-95632566 GACCCTTCCTTCTCTGACTTTGG + Intergenic
978287470 4:107095425-107095447 GATTCCTCCCTCTTCAACTTGGG + Intronic
980991196 4:139740100-139740122 GTACCCTTCCTCTGGGACTTAGG - Intronic
981756419 4:148145435-148145457 GGTTACTCTCTCTGTGACTTGGG - Intronic
982057801 4:151570242-151570264 GTTTCATCCCTCTGTGCCTTAGG + Intronic
983283762 4:165713500-165713522 GCTTCCTGCCTCTGTGACCTTGG - Intergenic
985795338 5:1957957-1957979 AATCCCTCCATCTCTGAATTTGG - Intergenic
986770163 5:10965729-10965751 GATCCTTAGCTCTGTGAGTTTGG - Intergenic
986938121 5:12917186-12917208 GATTCCTCCCTCTGGAACTAAGG + Intergenic
992558583 5:77927967-77927989 CATCTATCCCTCTGTGACTTTGG + Intergenic
993351684 5:86857667-86857689 GATGCCTCACTCTGTCACCTAGG + Intergenic
994666233 5:102708830-102708852 AATCCCTCCCTCCCTGACCTTGG - Intergenic
994952536 5:106482846-106482868 GACCCCACCCTCAGAGACTTAGG + Intergenic
995222852 5:109670561-109670583 TCTCCCTCCTTCTTTGACTTTGG - Intergenic
997180576 5:131824492-131824514 GATGTCTCTCTCTGTTACTTAGG - Intronic
998398159 5:141832922-141832944 CCTCCCTCCCACTGTGACCTTGG - Intergenic
1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG + Intergenic
1004982884 6:21046240-21046262 TTTCCTTCCCTCCGTGACTTTGG + Intronic
1005026473 6:21467207-21467229 TAACACTCCCTCTGTGGCTTCGG + Intergenic
1007270411 6:40631960-40631982 GCTCCCTCCCTTTGTGTCTCTGG + Intergenic
1007766961 6:44166347-44166369 CAACCCTCACTCTGTGACCTCGG + Intronic
1012072990 6:94646701-94646723 GATCCCTGCCTCTAAGAGTTTGG - Intergenic
1013328970 6:109079001-109079023 GATGGCTCCCTCTTTGAATTTGG - Intronic
1013767488 6:113591911-113591933 GTACCCTTCCTCTGTGAGTTGGG - Intergenic
1016393806 6:143601582-143601604 GAACCCTCTCTCTATGACTTTGG + Intronic
1017067213 6:150540139-150540161 AATGCCTCACTCTGTGACTTGGG + Intergenic
1019771074 7:2883821-2883843 GCTGCCTCCCTCAGTGACTTAGG + Intergenic
1020485173 7:8712479-8712501 AATTCTTCCCTCTGTGTCTTGGG + Intronic
1020512878 7:9081896-9081918 AAAGCCTCCCTCTGTCACTTAGG + Intergenic
1021411164 7:20331074-20331096 GATGCCTCGCTCTGTGCCTGCGG + Intronic
1023966912 7:44967547-44967569 GATCCTTCTCTCTGTGCCCTCGG - Intronic
1024199005 7:47087919-47087941 GATTGCTCCATCTGGGACTTGGG - Intergenic
1027303674 7:76869005-76869027 CAACCCTCCCTCTGTGATATTGG - Intergenic
1030551538 7:110967480-110967502 AAAACTTCCCTCTGTGACTTGGG + Intronic
1031010760 7:116524486-116524508 CATCCCTCCCTCTGTGAAACAGG + Intergenic
1034097143 7:148419831-148419853 GGACCCTCCCTGTGTGACCTTGG + Exonic
1035812618 8:2505160-2505182 CATCACTCGGTCTGTGACTTCGG - Intergenic
1037118723 8:15257178-15257200 GTTCTATCCCTCTGTGACTTTGG - Intergenic
1037577812 8:20224450-20224472 CATCCCTCCCTTTATGAGTTAGG + Intronic
1038415755 8:27394151-27394173 GATCCCTCACTCTCTGGGTTGGG + Intronic
1038415893 8:27395678-27395700 GATCCCTCCCTCTCTGGGTGGGG + Intronic
1039443763 8:37613922-37613944 GATCCCTGGCCCTGTGACATGGG + Intergenic
1039944726 8:42119535-42119557 GTTCCCTCCCTCTTTGGGTTGGG - Intergenic
1043565351 8:81541625-81541647 GATCCCTTACTCTGTGCCTGTGG + Intergenic
1046222648 8:111236139-111236161 GTTCCTTCCCTCTCTGCCTTAGG + Intergenic
1047342746 8:123998936-123998958 GGTCCCTCCCTTTGTGACAATGG + Intronic
1048179165 8:132179718-132179740 GAACTCTGCCTCTGTGACGTTGG - Intronic
1048936905 8:139365024-139365046 GATCCTTCCCTCACTGCCTTTGG - Intergenic
1049345978 8:142138845-142138867 GATCCCTCCTCCTGTGTCCTAGG - Intergenic
1049386886 8:142347338-142347360 GATCCCTCCCTCTGTGACTTGGG - Intronic
1051641473 9:19228675-19228697 GATCCCCCCCTCTGTCACCCAGG - Intergenic
1051796209 9:20873529-20873551 GATTCCGCCCTCTGAGAATTAGG + Intronic
1053319845 9:37087043-37087065 GATCCTTCCCTTTGTGGCTTTGG - Intergenic
1053422679 9:37989645-37989667 GACCGCTCACTCTGTGACTTTGG - Intronic
1060770375 9:126327450-126327472 CATCACTGCCTCTGTGACCTGGG + Intronic
1060905058 9:127297162-127297184 TCTCCCTCCCTCTGTCACCTAGG + Intronic
1061818462 9:133209524-133209546 GGGCCCTGCCTCTGTGGCTTGGG - Intergenic
1062241988 9:135545837-135545859 GGGCCCTCCCTCTGTGGCTCGGG + Intergenic
1062315269 9:135964130-135964152 GTCCCCTCCCTCTTTGACTTTGG - Intergenic
1185531793 X:826051-826073 AAGGCCTCCCTCAGTGACTTCGG + Intergenic
1186733766 X:12439299-12439321 AATCCCTTTCTCTGTGACCTAGG + Intronic
1188165777 X:26861690-26861712 GGTCCTTCCTGCTGTGACTTTGG + Intergenic
1188302173 X:28518289-28518311 CAGCCCTCCCTCAGAGACTTGGG + Intergenic
1188530534 X:31135438-31135460 GGTCCTTTCCTCTGTTACTTGGG + Intronic
1190331568 X:49238970-49238992 GCTCACTCACTCTGTGACTTTGG + Intronic
1192798561 X:74444534-74444556 TCTCCCTCCCTCCCTGACTTTGG + Intronic
1197899426 X:131354228-131354250 GATCTCTGAGTCTGTGACTTGGG - Intronic
1198004930 X:132483295-132483317 GATCCCCACCTCTGTGCCATGGG + Intronic