ID: 1049387751

View in Genome Browser
Species Human (GRCh38)
Location 8:142352900-142352922
Sequence GCATGTGCACACGTGTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049387751_1049387754 17 Left 1049387751 8:142352900-142352922 CCCACGCACACGTGTGCACATGC 0: 1
1: 0
2: 5
3: 35
4: 257
Right 1049387754 8:142352940-142352962 TGTGTCTACTCAGCGTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049387751 Original CRISPR GCATGTGCACACGTGTGCGT GGG (reversed) Intronic
900137413 1:1123964-1123986 GCATGTGCGCAGGTGTGTGCAGG - Intergenic
900179995 1:1307134-1307156 ACGTGTGCACAAGTGTGCATCGG - Intronic
900187472 1:1339136-1339158 GCCTGTGCACACGTCTGTGCAGG + Intronic
900285612 1:1898599-1898621 GCATGTGCACACACATGAGTTGG + Intergenic
900295256 1:1945925-1945947 GCATGTGTGCACGTGTGTGTGGG + Intronic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900593678 1:3470934-3470956 GCATGGGCAGGGGTGTGCGTGGG + Intronic
903301693 1:22383728-22383750 GGCTGTGCACACCTGGGCGTGGG + Intergenic
904402024 1:30263196-30263218 GCCTGTGGACACATGTGCCTGGG + Intergenic
904915486 1:33967450-33967472 GGGTGTGCACACTTGTGCCTGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
908481495 1:64544583-64544605 GTTTGTGCGCACGTGTGCATGGG - Intronic
910753287 1:90657683-90657705 GCATGTGTACAAGTATGTGTAGG - Intergenic
915381332 1:155443894-155443916 TCATGTGCACACATGTTCATAGG - Intronic
920293756 1:204943041-204943063 GCATGTGCACAATTGAGAGTGGG + Intronic
924014574 1:239706693-239706715 GTACATGCACACGTGTGTGTGGG - Intronic
1062901544 10:1150398-1150420 GCATGTGTACACGTGTGTGATGG - Intergenic
1064749220 10:18509426-18509448 ATATGTACACACGTGTGTGTGGG - Intronic
1066305011 10:34132334-34132356 ACATTTGTAAACGTGTGCGTAGG - Intronic
1066471694 10:35704074-35704096 GCATGGGTACACGTGTATGTTGG - Intergenic
1068795811 10:61078724-61078746 GCTTGTTCACACGTGTCTGTGGG - Intergenic
1069012208 10:63386636-63386658 GCAGGTGCCCACATGTGGGTGGG - Intronic
1069934170 10:71903821-71903843 GCATGTTCTCACTTGTGAGTGGG - Intergenic
1070676172 10:78413144-78413166 GCGCGTGCACATGTGTGTGTTGG + Intergenic
1071341450 10:84652425-84652447 GAATGTGTACACGTGTACATAGG - Intergenic
1072816167 10:98511606-98511628 GTGTGTGCGCACGTGTGTGTTGG + Intronic
1073059148 10:100723196-100723218 AGATGTGCACACCTGTGTGTTGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073084174 10:100877747-100877769 GCATGTGTACACGTGTGTACAGG - Intergenic
1074221950 10:111446623-111446645 GTATGTGCAGACGTGTGTGCAGG - Intergenic
1075284857 10:121174669-121174691 GTATGTGCACACTCATGCGTGGG - Intergenic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1076139326 10:128067041-128067063 GCATGTGCATGCATGTGTGTGGG - Intronic
1076365442 10:129918708-129918730 GCATGTGCACACAGATGTGTAGG - Intronic
1076461134 10:130648464-130648486 GCATGTGCACATGTGTGTGCAGG + Intergenic
1076778876 10:132713212-132713234 GGGTGTGCACACGTGTGTGTAGG + Intronic
1077234763 11:1475313-1475335 CCCTGTGCACACGTGTGATTGGG - Intronic
1077281032 11:1745924-1745946 GTGTGTGCACAAGTGTGTGTGGG - Intronic
1080813801 11:35733801-35733823 GGATGTGCACATGTGTGTTTTGG - Intronic
1084477933 11:69399386-69399408 GCATGTGTGCATGTGTGTGTAGG + Intergenic
1086772239 11:90780833-90780855 GCATGTGCACACATGTGATACGG - Intergenic
1088884282 11:113994775-113994797 GCATGGGCACAGGTGTGTGATGG - Intergenic
1090320136 11:125835948-125835970 GTCTGTGCATACGTGTGTGTGGG + Intronic
1091594919 12:1871541-1871563 GCGTGTGTACACGTGTGTGCTGG + Intronic
1091935643 12:4432530-4432552 CCATGTGCACACGTGTTCCGAGG + Intronic
1092299743 12:7235551-7235573 GTGTGTGCACACGTGTGTGTTGG - Intergenic
1092687465 12:11067253-11067275 TCATGTGTACACCTGTGTGTTGG - Intronic
1092940507 12:13403193-13403215 GCATGTGCATATGTGTGTGGGGG + Intergenic
1096428193 12:51521781-51521803 GTATGAGCACACATGTGCTTTGG - Intergenic
1096499999 12:52058951-52058973 GCATGTGCACACGTGTTCCCAGG - Exonic
1096520397 12:52181572-52181594 GCATGTGCCCACGTGTACAGGGG + Intronic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1103730596 12:123025229-123025251 GCATGTGCATCTGTGTGCCTAGG - Intronic
1103971164 12:124673663-124673685 GTGTGTGCACACCTGTGGGTGGG - Intergenic
1104759875 12:131290484-131290506 GCATGTGCACACGGGTACATGGG - Intergenic
1104820849 12:131676687-131676709 GCATGTGCACACGGGTACGTGGG + Intergenic
1104820853 12:131676767-131676789 GCATGTGCACACATGTACATGGG + Intergenic
1105014830 12:132780129-132780151 GTCTGTACACACGTGTGCCTGGG - Intronic
1105962217 13:25352535-25352557 GTATGTGCACATGTGTGAGGGGG + Intergenic
1107279455 13:38716825-38716847 GCCTGTGCACATGTGTGTTTTGG - Intronic
1109847509 13:68014907-68014929 GCATGTTCTCACATGTGAGTGGG + Intergenic
1111760418 13:92457075-92457097 GCATGTTCTCACGTGTAAGTGGG - Intronic
1112439389 13:99415172-99415194 GCATGTGCATGGGTGTGAGTGGG - Intergenic
1112877785 13:104066692-104066714 GCATGTGCACGGGTGCGCTTAGG - Intergenic
1113752502 13:112785986-112786008 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752519 13:112786109-112786131 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752535 13:112786232-112786254 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752551 13:112786355-112786377 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752601 13:112786724-112786746 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1116768798 14:49103270-49103292 GTATGTGCAAATGTGTGCCTTGG - Intergenic
1118693682 14:68363745-68363767 GTGTGTGCACACGCGTGTGTGGG + Intronic
1119853545 14:77883004-77883026 GTGTGTGCACACATGTGCGAAGG - Intronic
1120120388 14:80672512-80672534 GCATGTGTGCATGTGTGTGTAGG + Intronic
1121656584 14:95601511-95601533 GCATGTGTGCATGTGTGTGTGGG + Intergenic
1122088177 14:99321127-99321149 GCATGGGCACATGTGTGATTTGG - Intergenic
1122088230 14:99321476-99321498 GCATGTGTATAGGTGTGTGTGGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123984325 15:25631606-25631628 GCATGTGCAGGTATGTGCGTGGG + Intergenic
1124200186 15:27672757-27672779 GCATGTGCATGTGTGTGTGTGGG - Intergenic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1126110680 15:45172966-45172988 GCACGTGCGCATGTGTGCCTGGG - Intronic
1127271920 15:57409255-57409277 GCATTTGGAGACGTGTGAGTAGG + Intronic
1129460647 15:75698569-75698591 ACATGTACACACGTGTGTGGCGG + Intronic
1129724219 15:77893471-77893493 ACATGTACACACGTGTGTGGCGG - Intergenic
1130451817 15:84062395-84062417 GCATGTTCACACTTGTAAGTGGG - Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1131513824 15:93064561-93064583 GCCTGCGCACACGCGTGTGTGGG + Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1133668041 16:7989490-7989512 GCATGTGCATAGGTGTATGTGGG - Intergenic
1134265465 16:12688759-12688781 GCATGTTCCCACGTGTTCCTTGG - Intronic
1134853263 16:17499219-17499241 GCATGTGCACATGTGTGTATCGG - Intergenic
1135548276 16:23379942-23379964 GCATGTGTGCACGGGTGTGTGGG + Intronic
1135836394 16:25829645-25829667 GCATGTTCTCACGTGTAAGTGGG - Intronic
1136054537 16:27678642-27678664 GCATGTGACCCCGTGTGGGTTGG - Intronic
1137482110 16:48861003-48861025 GCATGTTCCCACTTGTGAGTGGG + Intergenic
1137592326 16:49701248-49701270 GCATGCGCACGTGTGTGTGTAGG + Intronic
1138440045 16:57028805-57028827 ACATGTGCACACCTATGAGTGGG - Intronic
1139183848 16:64779784-64779806 ACATGTGAACACTTGTGTGTAGG - Intergenic
1140958578 16:79890859-79890881 GCATGTGCTCATGTATGTGTGGG - Intergenic
1141481541 16:84309835-84309857 GCGTGTGTACATGTGTGTGTGGG + Intronic
1141571608 16:84937367-84937389 GCATGTTCACACTTGTAAGTGGG - Intergenic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1141707278 16:85673778-85673800 TCATGTGCACACATGGGCGGGGG + Exonic
1141721369 16:85757397-85757419 GCATGTTTTCACGTGTGTGTTGG - Intergenic
1141928919 16:87187704-87187726 ACATGTGTGCACGTGTGGGTGGG + Intronic
1141928971 16:87188132-87188154 GTGTGTGTACATGTGTGCGTGGG + Intronic
1142106386 16:88305425-88305447 GCATGTGTGCACGTGTGTGAGGG - Intergenic
1142127588 16:88417842-88417864 GCGTGAGCCCACGTGTGCATGGG + Intergenic
1142201644 16:88763910-88763932 GCAGGTGTACAGGTGTGCCTGGG - Intronic
1142268357 16:89076436-89076458 GCATGTGTACTCGTGTACATAGG + Intergenic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1143369276 17:6428413-6428435 GCACGTGCACACGTGCGGGCTGG - Exonic
1143452544 17:7044111-7044133 GCAGGTGCATGCGTGTGAGTAGG - Intergenic
1143461999 17:7109771-7109793 GCATATGCACATGTGAGAGTGGG - Intronic
1143835267 17:9686951-9686973 GCATGTGCATGCGTGTGTGTGGG + Intronic
1143928309 17:10393045-10393067 GCAGGTGCATACGTGTCAGTAGG + Intronic
1144492935 17:15730714-15730736 GCAAGTGGTCACGTGCGCGTGGG - Intergenic
1144907319 17:18645939-18645961 GCAAGTGGTCACGTGCGCGTGGG + Intronic
1146681796 17:34813761-34813783 GCATGTACACACGTGTCTGAAGG + Intergenic
1147055863 17:37834484-37834506 GCATGTGCACATATGTGGGTGGG - Intergenic
1150068062 17:62128077-62128099 GCATGTTCTCACTTGTGAGTGGG - Intergenic
1152285980 17:79413660-79413682 GCAGGTGCACACCTGGGCGATGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152855055 17:82660541-82660563 GTGTGTGTACACGTGTGTGTAGG - Intronic
1154379064 18:13833392-13833414 TTGTGTGCACACGTGTGTGTTGG + Intergenic
1155999071 18:32364396-32364418 GCATGTGTGTACGTGTGGGTAGG - Intronic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1159695379 18:71551279-71551301 GCATGTGCATATGTGTACATGGG + Intergenic
1159910577 18:74141862-74141884 GCATGTGGAGACTTGTGCCTGGG - Intronic
1160263900 18:77321983-77322005 GCACGCGCACACGTGTGCTGGGG + Intergenic
1160590176 18:79940147-79940169 GCATGTTCTCACGTGTAAGTGGG + Intronic
1160900268 19:1424408-1424430 TCAGGTGCACACGTGTGCTCAGG + Intronic
1161170358 19:2809639-2809661 GGATGTGCACACGCGTGTGCTGG - Intronic
1161978016 19:7616758-7616780 GCGTGTGGGCACGTGTGCATGGG + Intronic
1162926850 19:13934765-13934787 GCCTGTGCATAAGTGTGCATGGG + Intronic
1163699479 19:18780227-18780249 CCATGAGCACATGGGTGCGTGGG - Exonic
1165060583 19:33203290-33203312 GCATGTGAACACATGTAAGTAGG + Intronic
924991846 2:319239-319261 GTGTGTGGACACGTGTGTGTGGG + Intergenic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925750877 2:7090018-7090040 GCAGGGGCACAGGTGTGCCTGGG - Intergenic
926125912 2:10271738-10271760 GCATGTGTGCATGTGTGCATGGG - Intergenic
926140991 2:10368189-10368211 GTGTGTGCATACGTGTGTGTAGG + Intronic
926140995 2:10368270-10368292 GTGTGTGCATACGTGTGTGTAGG + Intronic
927637501 2:24826763-24826785 ACATATACACACGTCTGCGTGGG + Intronic
927848234 2:26482949-26482971 GCATGTGTGCACGTGTGAGTGGG + Intronic
927848242 2:26483041-26483063 GCATGTGTGCATGTGTGAGTGGG + Intronic
928359140 2:30648832-30648854 ACATATACACACGTGTGCATAGG - Intergenic
929032843 2:37664829-37664851 GCATGTGCTCACTTGTAAGTGGG + Intronic
929825939 2:45309823-45309845 GCATGTACACATGTGTGCATGGG + Intergenic
932485706 2:72083093-72083115 GCACGTGCACAGGTGTGCCCAGG + Intergenic
936075674 2:109400201-109400223 GCATGTGTGCAAGTGTGTGTAGG - Intronic
936631911 2:114212536-114212558 GCATGTGCATGAGTGTGTGTGGG + Intergenic
936964079 2:118109601-118109623 ATGTGTGCACACGTGTGTGTTGG + Exonic
940028930 2:149240095-149240117 GCATGTGCATACAGGTGCTTTGG + Intergenic
940038169 2:149330947-149330969 GCGTGTGTACTCGTGTGTGTTGG + Intronic
948183680 2:236002417-236002439 GCATGTGCACATGTGTGAGTAGG + Intronic
948808742 2:240464405-240464427 ACAGGTGCACACGTGGGTGTGGG + Intronic
1173054322 20:39596761-39596783 GTGTGTGCACACGTGTGTGTGGG + Intergenic
1174889871 20:54380065-54380087 GTATGTGCGCACGTGTGTGTGGG - Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1176106063 20:63388071-63388093 GCATGTGCATATGTGTGTGTGGG - Intergenic
1176408783 21:6436548-6436570 GCAGGTACACACCTGTGCATGGG - Intergenic
1177154783 21:17490640-17490662 GCATGTTCTCACTTGTGAGTGGG - Intergenic
1179684276 21:43044870-43044892 GCAGGTACACACCTGTGCATGGG - Intergenic
1182090819 22:27593590-27593612 GCATGTGCACATGCATGTGTAGG + Intergenic
1184868940 22:47221016-47221038 GCATATGTACACGTGTGCACAGG - Intergenic
949184568 3:1174882-1174904 GTGTGTGCACACGCGTGTGTGGG - Intronic
950260903 3:11542990-11543012 GCCTGTGCACACGTGTGGGCTGG - Intronic
952076177 3:29700878-29700900 GCATGTGTACACGTATACGTTGG + Intronic
953229471 3:41051873-41051895 ACACGTGCACATGTGTGTGTTGG + Intergenic
953541680 3:43824700-43824722 GTGTGTGCACAGGTGTGCTTAGG + Intergenic
953553200 3:43921133-43921155 GCATATGCACATTTGTGCGGTGG + Intergenic
954727341 3:52624469-52624491 GCATGTGGACACCTATGCATTGG - Intronic
954749449 3:52805409-52805431 GCCTGTGTGCACGTGTGGGTGGG + Intronic
955257765 3:57351420-57351442 ACATGTGCACACGTTTCTGTTGG - Intronic
958109335 3:89119761-89119783 GTATGTGCACATGTGTGTTTGGG + Intronic
960050467 3:113234373-113234395 GCATGTGCACACATGTGTGTAGG + Intronic
962924212 3:139976840-139976862 GCATGTGCACACATGTGTGTTGG + Intronic
964006842 3:151840423-151840445 GTGTGTGCACACATGCGCGTGGG - Intergenic
964561407 3:158000702-158000724 GCATGTGCTCACTTGTAAGTGGG + Intergenic
968490415 4:887980-888002 GCGTCTGCACATGTGAGCGTGGG - Intronic
968544739 4:1193019-1193041 GCATGTCCACATATGTGTGTGGG - Intronic
968731781 4:2272482-2272504 ACATGTGCGCACGTGTGAGTGGG + Intronic
968909202 4:3468164-3468186 GCATGTGAATACCTGTGTGTGGG + Intronic
969584031 4:8081599-8081621 GCATGTGCATCTGTGTGCATAGG + Intronic
971769945 4:30883073-30883095 ACATGTGCACACATGTGCACGGG + Intronic
972351436 4:38239790-38239812 GAGTGTGCACACGTGTGTGAAGG + Intergenic
973838873 4:54840921-54840943 ACACGTGCACACATGTGTGTGGG + Intergenic
976375212 4:84338583-84338605 GCATGTGCACACTGGTGGGGTGG + Intergenic
980994117 4:139764332-139764354 GCATGTGCACAGGAGTAAGTAGG - Intronic
984897832 4:184557689-184557711 GCATGTTCTCACTTATGCGTGGG + Intergenic
985345126 4:188996587-188996609 GCATGTGCTCACTTGTAAGTGGG - Intergenic
985564925 5:610874-610896 GTATGTGCAGAGGTGTGTGTAGG - Intergenic
985683588 5:1270102-1270124 ACATGTGCACACGTGTCCCTCGG + Intronic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986719239 5:10548756-10548778 GCATGTGTTAGCGTGTGCGTTGG + Intergenic
988458740 5:31413040-31413062 GTGTGTGCTCATGTGTGCGTTGG - Intronic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
994606628 5:101975525-101975547 GCATGTGCTCACTTATACGTGGG - Intergenic
994674895 5:102808396-102808418 GTATGTGCATAGGTGTGTGTGGG + Intronic
996948801 5:129100436-129100458 TCATGTGCAAATGTGTGTGTAGG + Intronic
998176900 5:139907003-139907025 GCATGTGCACATGTGTGTATGGG + Intronic
1000292057 5:159879639-159879661 GCATATGCATGCGTGTGTGTGGG + Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1001799602 5:174531530-174531552 GTGTGTGCACACCTGTGCCTGGG + Intergenic
1002365041 5:178703228-178703250 CCCTGTGCACAGGTGTGCGGAGG + Intergenic
1002567829 5:180121772-180121794 GTCTGTACACACGTGTGCGGTGG + Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1003991969 6:11495036-11495058 GCATGTGCACAATTGTCCCTGGG + Intergenic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1006667633 6:35707780-35707802 GCATGTTCTCACATGTACGTAGG - Intronic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1009013646 6:57873635-57873657 GGATGTGCACACGTATGTATGGG + Intergenic
1012928966 6:105297064-105297086 GCATGTACACAGGTGTGTCTGGG - Intronic
1015293506 6:131564133-131564155 GCATGTGCAGACGTATCCATTGG + Intergenic
1019295734 7:273049-273071 GTGTGTGCACACGAGTGTGTGGG - Intergenic
1019352991 7:563893-563915 ATGTGTGCACACGTGTGCATGGG + Intronic
1019356637 7:583368-583390 GAGTGTGCACATGTGTGAGTGGG - Intronic
1021485890 7:21168180-21168202 CCATGTGCACATGTGTGTGGGGG + Intergenic
1021580454 7:22147263-22147285 GCATGTGTGCACGTGGGGGTAGG - Intronic
1022203662 7:28142295-28142317 GCATGTGCATATGTGTCTGTTGG - Intronic
1022481491 7:30746218-30746240 GCACATGCACGCGTGTGGGTGGG - Intronic
1023321725 7:39005552-39005574 GCATGTGTGCACGTGTATGTAGG + Intronic
1025969600 7:66309870-66309892 TTATGTGCACATGTGTGCATGGG + Intronic
1031709900 7:125032324-125032346 GCATGTTCTCACTTGTACGTGGG - Intergenic
1032688486 7:134259174-134259196 GCATGTTCACATGTGTGTTTGGG - Intronic
1034331299 7:150284994-150285016 CCATGTGACTACGTGTGCGTGGG + Intronic
1034536046 7:151726497-151726519 TCATGGGCACTCTTGTGCGTTGG - Intronic
1038075667 8:24070560-24070582 TCATGTGGACACGTGTACCTGGG + Intergenic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1041341602 8:56852086-56852108 GAATGTGAACAAGTGTGCATGGG + Intergenic
1042216462 8:66433194-66433216 GCAAGTGCACAAGTCTGCCTGGG + Intronic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1047415408 8:124660932-124660954 GCGTGTGTGTACGTGTGCGTGGG - Intronic
1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG + Intergenic
1048533811 8:135274160-135274182 GCAGGTGCCCATGTGTGGGTGGG - Intergenic
1048856633 8:138692090-138692112 GCATGTGTACACGTTTGTGGAGG + Intronic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049325982 8:142021720-142021742 GCAGGTGCACACATGTCTGTGGG + Intergenic
1049356312 8:142190306-142190328 GCATGTGCACATATGTGTGGGGG - Intergenic
1049367052 8:142244944-142244966 GCGTCTGCACACAGGTGCGTGGG - Intronic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1051766199 9:20526656-20526678 GAATGTGCATATGTGTGTGTGGG - Intronic
1055752827 9:79526582-79526604 GCATGTGTACCCATGTGTGTTGG + Intergenic
1057207452 9:93182210-93182232 GCATGTGTACAAGTGTGGGTGGG + Intergenic
1057630334 9:96714913-96714935 GCAAGTGCACAGATGTGCCTAGG + Intergenic
1060304230 9:122396393-122396415 GCATGTTCTCACTTATGCGTGGG + Intergenic
1060497811 9:124130845-124130867 CCATGTGGACACGTGTGCCTGGG + Intergenic
1061869332 9:133512375-133512397 ACATGTGTGCACGTGTGTGTAGG + Intergenic
1062197974 9:135285094-135285116 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198003 9:135285279-135285301 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198016 9:135285342-135285364 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198027 9:135285405-135285427 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198039 9:135285465-135285487 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198051 9:135285528-135285550 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198064 9:135285591-135285613 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198075 9:135285654-135285676 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198104 9:135285839-135285861 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198117 9:135285902-135285924 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198126 9:135285965-135285987 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198154 9:135286091-135286113 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198167 9:135286154-135286176 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198221 9:135286524-135286546 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198234 9:135286587-135286609 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062267050 9:135691776-135691798 GTGTGTGCACACGCGTTCGTGGG - Intergenic
1062285035 9:135769061-135769083 GCGTGTGCACACGTGGGTGACGG + Intronic
1062285042 9:135769101-135769123 GCGTGTGCACACGTGGGTGTCGG + Intronic
1062285050 9:135769141-135769163 GCATGTGCACACGTGGGTGACGG + Intronic
1062285063 9:135769219-135769241 GCACGTGTGCACGTGTGTGTCGG + Intronic
1062285079 9:135769301-135769323 GCGTGTGCACACGTGGGTGACGG + Intronic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062546448 9:137065730-137065752 GCATGAGCTCACCTGTGGGTGGG + Intronic
1187666680 X:21619827-21619849 GCATGTGAACCCATGTGTGTTGG - Intronic
1187799715 X:23047808-23047830 GTATGTGCACACATGTGTGTAGG - Intergenic
1188879367 X:35472799-35472821 GCATGTCCACACTTATGGGTGGG - Intergenic
1189029528 X:37436494-37436516 GCATGTAGACACTTGTGAGTTGG + Intronic
1189075996 X:37915168-37915190 GCACGTGCACAGGCGTGTGTTGG + Intronic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1192239378 X:69317240-69317262 GTATGTGCACAAGTGTGCTAGGG - Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196047953 X:111275771-111275793 GTATGTGCTCACGTGTGTGGTGG - Intergenic
1196644712 X:118105070-118105092 GTGTGTGCACAGGTGTGTGTTGG - Intronic
1198110807 X:133501315-133501337 GCATTTTGACACGTGTGTGTGGG + Intergenic
1199399731 X:147384023-147384045 GCATGCTCACAGGTGTGAGTGGG + Intergenic
1201398396 Y:13574940-13574962 GCATGTTCTCACTTGTGAGTGGG + Intergenic
1202353784 Y:24023945-24023967 ACATGTGCAAAAGTGTGCATCGG - Intergenic
1202516995 Y:25646170-25646192 ACATGTGCAAAAGTGTGCATCGG + Intergenic