ID: 1049387751

View in Genome Browser
Species Human (GRCh38)
Location 8:142352900-142352922
Sequence GCATGTGCACACGTGTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049387751_1049387754 17 Left 1049387751 8:142352900-142352922 CCCACGCACACGTGTGCACATGC No data
Right 1049387754 8:142352940-142352962 TGTGTCTACTCAGCGTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049387751 Original CRISPR GCATGTGCACACGTGTGCGT GGG (reversed) Intronic