ID: 1049387751 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:142352900-142352922 |
| Sequence | GCATGTGCACACGTGTGCGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049387751_1049387754 | 17 | Left | 1049387751 | 8:142352900-142352922 | CCCACGCACACGTGTGCACATGC | No data | ||
| Right | 1049387754 | 8:142352940-142352962 | TGTGTCTACTCAGCGTCCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049387751 | Original CRISPR | GCATGTGCACACGTGTGCGT GGG (reversed) | Intronic | ||