ID: 1049388860

View in Genome Browser
Species Human (GRCh38)
Location 8:142357988-142358010
Sequence CCCTTTGCAGTGATGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 7, 1: 0, 2: 0, 3: 15, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049388860_1049388869 1 Left 1049388860 8:142357988-142358010 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388869 8:142358012-142358034 GGCGGGGTCTGCTGGGTTTCAGG No data
1049388860_1049388871 8 Left 1049388860 8:142357988-142358010 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388871 8:142358019-142358041 TCTGCTGGGTTTCAGGACAAGGG No data
1049388860_1049388867 -7 Left 1049388860 8:142357988-142358010 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388867 8:142358004-142358026 CAAAGGGCGGCGGGGTCTGCTGG No data
1049388860_1049388868 -6 Left 1049388860 8:142357988-142358010 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388868 8:142358005-142358027 AAAGGGCGGCGGGGTCTGCTGGG No data
1049388860_1049388873 21 Left 1049388860 8:142357988-142358010 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388873 8:142358032-142358054 AGGACAAGGGGAGCAGCCAGCGG No data
1049388860_1049388872 9 Left 1049388860 8:142357988-142358010 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388872 8:142358020-142358042 CTGCTGGGTTTCAGGACAAGGGG No data
1049388860_1049388870 7 Left 1049388860 8:142357988-142358010 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388870 8:142358018-142358040 GTCTGCTGGGTTTCAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049388860 Original CRISPR CCCTTTGCAGTGATGGCCGC TGG (reversed) Intronic
901956287 1:12788043-12788065 GCCATTGCAGTGATGCCCACTGG + Intergenic
905889721 1:41511437-41511459 CCCATTCCAGAGATGGCAGCTGG - Intronic
905941343 1:41866005-41866027 CCCGCTGCTGTGATGGCAGCTGG + Intronic
906035742 1:42749329-42749351 CCCCTGGCAGTGATGGCCATTGG - Intronic
906161268 1:43650585-43650607 GCCTTTGGAGTGATGCTCGCGGG + Intronic
919832367 1:201550940-201550962 ACCTTTGCAGTGAAGGCCTGAGG - Intergenic
1069569194 10:69484290-69484312 CCCTTTGCAGTGGTCACTGCCGG + Intronic
1071997877 10:91164162-91164184 CCCTCTGCAGTGATGACGCCCGG + Intronic
1072230893 10:93413145-93413167 CCCTTTGCAATGCTGGACTCTGG + Intronic
1074108870 10:110408629-110408651 CCCTTTGCTGTGAATGCCTCTGG + Intergenic
1075313005 10:121430403-121430425 CACTCTGCAGTGAAGGCCACGGG - Intergenic
1075564471 10:123493534-123493556 GCCTTTGCAGTGTTGACAGCAGG + Intergenic
1076348496 10:129797246-129797268 GCCTGTGCAGTGCTGGCCGTTGG - Intergenic
1076872263 10:133199886-133199908 GCCTGGGCAGTGATGGCCACAGG + Intronic
1078901499 11:15646894-15646916 CCATTTGCCCTGATGGCCACTGG + Intergenic
1081084745 11:38785814-38785836 CCCGTTGCATTGAGGGCTGCTGG + Intergenic
1083362510 11:62120731-62120753 CCCCTTGCATTGAGGGCCTCTGG - Intergenic
1087193650 11:95283015-95283037 CCCTTTTCATTGATGTCAGCAGG - Intergenic
1089014515 11:115155389-115155411 CCCTTTGCAGAGGTGGCTGCAGG + Intergenic
1089525202 11:119092676-119092698 GCCTTTTCAGTGATGTCCTCAGG + Intronic
1090740469 11:129654856-129654878 CCCTTGGCAGTGTTGGCCCAAGG - Intergenic
1093259517 12:16918000-16918022 CCCAGTGCTGTGATGGCTGCAGG - Intergenic
1096793420 12:54059351-54059373 CCCTCTGCTCTGGTGGCCGCTGG - Intergenic
1099530880 12:83779614-83779636 CCCCTTGCTCTGGTGGCCGCTGG + Intergenic
1102218280 12:111177309-111177331 TCTTTTGCAGAGATGGCTGCAGG - Intronic
1103225561 12:119284466-119284488 GCCTTTTCAGAGATGGCCGTTGG - Intergenic
1104972548 12:132538508-132538530 TCCCTGGCAGTGATGGCCACGGG + Intronic
1106129894 13:26931531-26931553 CTTTTTGCAGTGTTGGCTGCAGG - Intergenic
1110775623 13:79405662-79405684 CTCTTTGCAGGGATGGCAGTGGG - Intronic
1112435253 13:99387289-99387311 GCCTTTGCAGTGGTGGCCCGTGG + Intergenic
1113426979 13:110216269-110216291 CACCCTGCAGTGATGGCCCCAGG + Intronic
1120030612 14:79636740-79636762 CCCTTTGCAGTGATGGGCAGAGG - Intronic
1121010643 14:90518200-90518222 CGCTCTGCGGTGCTGGCCGCCGG - Intergenic
1121758338 14:96421934-96421956 CCCTTTGCATTGCGGGCTGCTGG - Intronic
1122635274 14:103126881-103126903 CCCTTTAGGGTGTTGGCCGCCGG + Intronic
1124791173 15:32728799-32728821 CCGATTGTTGTGATGGCCGCAGG + Intronic
1124987506 15:34636079-34636101 CACTTTGCAGTGAAGGCAACTGG - Intergenic
1125747305 15:42005617-42005639 CCCATTGCTGGGATGGCCCCAGG - Intronic
1126600664 15:50424271-50424293 CCCTTTTCGGTGAGGGCCGCGGG - Intergenic
1129959780 15:79673849-79673871 CCCTGTGCTGTTATTGCCGCAGG - Intergenic
1133622914 16:7543404-7543426 TCCTTGGCAGTGATAGCTGCTGG - Intronic
1138101824 16:54258079-54258101 CCAGTTGGAGTGATGGCCGCCGG - Intronic
1140734335 16:77884598-77884620 CTCTTTGCAGTGGTGGCAGGTGG + Exonic
1143619147 17:8071333-8071355 CCCTGTGCAGTGTTGGCTCCCGG + Intergenic
1144836447 17:18158915-18158937 CCCACTGCAGGGATGGCCTCAGG + Exonic
1147554250 17:41466276-41466298 CCTTCTGCAGGGATGGCTGCAGG - Intronic
1156450984 18:37266430-37266452 CCCCATGCAGTGCTGGCCCCAGG + Intronic
1156458525 18:37308156-37308178 CCCTTTCCAGTGATCCCTGCAGG + Intronic
1156463143 18:37332846-37332868 CCCTTGGCAGTGAGGGCCTCAGG - Intronic
1157278531 18:46329913-46329935 CCCCAGGCACTGATGGCCGCTGG - Intronic
1157666477 18:49491962-49491984 CCCTTTGCTGTCAGGGCTGCAGG + Intronic
1162186707 19:8910496-8910518 CCCATTCCAGTTATGGCTGCTGG - Exonic
1163006096 19:14397538-14397560 CCCCTTGGAGTGGTGGACGCTGG - Intronic
1163604425 19:18266260-18266282 TTCTTTGCCGTGATGGTCGCAGG + Exonic
1163632737 19:18425489-18425511 CCCCTTCCACTGATGGACGCAGG + Intronic
926298526 2:11585818-11585840 ACCTTTCCAGTGGTGGCCTCTGG + Exonic
927680028 2:25132970-25132992 CCTGGTGCAGGGATGGCCGCGGG - Exonic
929507838 2:42542251-42542273 CCCTTCGCAGAGATGGGCTCAGG - Intronic
932593619 2:73081154-73081176 GCCTTCGCAGTCATGGCCCCAGG + Intronic
933915662 2:86990501-86990523 CCCTTTGCATTGATGGTGGCTGG + Intronic
934007331 2:87779401-87779423 CCCTTTGCATTGATGGTGGCTGG - Intronic
935770973 2:106420314-106420336 CCCTTTGCATTAATGGTGGCTGG - Intronic
935814002 2:106829476-106829498 CCCTTTGCAGGGATGGCTAAAGG - Intronic
935995783 2:108771056-108771078 CCCTTTGCATTGATGGTGGCTGG + Intronic
936130890 2:109840758-109840780 CCCTTTGCATTGATGGTGGCTGG + Intronic
936213807 2:110530727-110530749 CCCTTTGCATTGATGGTGGCTGG - Intronic
936422945 2:112385287-112385309 CCCTTTGCATTGATGGTGGCTGG - Intronic
936964699 2:118116328-118116350 CCCCTTGCAGTTAGGGCCACAGG - Intergenic
937105866 2:119312086-119312108 CCCTCAGCAGTGCCGGCCGCAGG + Intronic
942468770 2:176237910-176237932 CCCTTTGCAGACATGTCCTCTGG - Intergenic
948233761 2:236371228-236371250 GGCTTTGCAGTGCTGGCCTCTGG + Intronic
948979650 2:241486530-241486552 CACTCAGCAGTGATGGCTGCAGG + Intronic
1169328851 20:4700114-4700136 CCCTTGGCACTGATGGGCACTGG + Exonic
1172130594 20:32652376-32652398 CCCTTTGCATGGAGGGCTGCTGG - Intergenic
1174061564 20:47836609-47836631 CCCTTTGCAATGGTGCCTGCAGG + Intergenic
1174069962 20:47892716-47892738 CCCTTTGCAATGGTGCCTGCAGG - Intergenic
1174156428 20:48518511-48518533 CCCTTTGCAATGGTGCCTGCAGG + Intergenic
1176118751 20:63444792-63444814 TCCATTGCGGTGCTGGCCGCCGG - Exonic
1176135586 20:63520799-63520821 CCATTTGCAGAGAAGACCGCGGG - Exonic
1176172055 20:63700524-63700546 CCCTTTGCTGTGAAGACAGCGGG + Exonic
1178947866 21:36962894-36962916 CCCTGTGCTGTGATGGCTGTAGG - Intronic
1179902570 21:44401659-44401681 CTCTCTGCTGTGACGGCCGCAGG + Exonic
1184655793 22:45941557-45941579 CCCAATGCAGTGAGGGCAGCTGG + Intronic
1184773988 22:46614226-46614248 CGCTGTGCAATGATGGCCGCTGG + Intronic
1184981228 22:48097224-48097246 CCCCTTGCAATGAGGGCCCCAGG + Intergenic
953584341 3:44186295-44186317 GCCTTTGCTGTGCTGGCCCCAGG - Intergenic
953854256 3:46488889-46488911 CCATTTCCAGTGAGGGCCACGGG + Intergenic
958615882 3:96493382-96493404 TTCTTTGGAGTGATGGCAGCAGG + Intergenic
960519280 3:118636742-118636764 CCCTTTGTAGTGATGGCTTCTGG - Intergenic
961439842 3:126946103-126946125 CCCCTTGCAGCCATGGCCTCTGG - Intronic
961650227 3:128413474-128413496 TCCTTTGCAGAGGGGGCCGCAGG - Intergenic
967107980 3:186269333-186269355 CCCTTTGAAGTGGTGGCCTTTGG + Intronic
968049144 3:195642227-195642249 CCCTTTGCAATGGTGTCTGCAGG - Intergenic
968098253 3:195947403-195947425 CCCTTTGCAATGGTGTCTGCAGG + Intergenic
968106765 3:196006915-196006937 CCCTTTGCAATGGTGTCTGCAGG + Intergenic
968305472 3:197647707-197647729 CCCTTTGCAATGGTGTCTGCAGG + Intergenic
974782870 4:66576029-66576051 CCCTTTACAATGATGGACTCAGG - Intergenic
978371517 4:108034094-108034116 GCCTCTGCAGTGGTGGCCGGAGG + Intronic
981769992 4:148298357-148298379 CCCTGAACAGTGATGGCTGCCGG + Intronic
985505712 5:279070-279092 CCCTTTGCAATGGTGTCTGCAGG - Intronic
985742493 5:1626850-1626872 CCCTTTGCAATGGTGTCTGCAGG + Intergenic
985788599 5:1913108-1913130 CCCCCTGCAGGGATGGCTGCAGG - Intergenic
986203264 5:5599088-5599110 ACATTTTCAGTGATGGCCTCAGG - Intergenic
989624661 5:43417738-43417760 CCCAGTGCAGAGATGGCAGCAGG - Intergenic
998812295 5:145978409-145978431 TCCTTTGCAGGGATGTCCACAGG + Intronic
1002401624 5:178994427-178994449 CTGTTTGCGGTGAGGGCCGCGGG - Exonic
1002785565 6:397214-397236 GCCTTGCCAGTGGTGGCCGCGGG - Exonic
1002842005 6:914218-914240 CCTTCTGCAGAGATGGCTGCTGG + Intergenic
1002863206 6:1097788-1097810 CCCGATGCAGTGATGGTCACGGG - Intergenic
1009592425 6:65689824-65689846 CCCATTGCATTGAGGGCTGCTGG - Intronic
1015459968 6:133478823-133478845 CCCTTTGCTGTGACAGCTGCTGG + Intronic
1022414356 7:30165278-30165300 CACTGTGCAGTGATGGCCACAGG + Intergenic
1023232496 7:38049871-38049893 CCCCAGGCAGTGATGGCCCCAGG + Intergenic
1025232880 7:57214467-57214489 CCCTTTGCAATGGTGCCTGCAGG - Intergenic
1028811425 7:95091738-95091760 CCCTTTGCAGTTGTGGGGGCAGG + Intronic
1032084938 7:128878972-128878994 CCCAGTGCAGGGATGGCAGCAGG - Intronic
1032559760 7:132876683-132876705 TGCTTTGCAGTGATAGCCCCAGG - Intronic
1034265965 7:149780778-149780800 GCGTGTGCAGGGATGGCCGCTGG + Intergenic
1035269291 7:157710558-157710580 CCCTGTGCAGTGAGGGCCACAGG + Intronic
1036794201 8:11743528-11743550 CCCTGGGCACTGCTGGCCGCTGG - Intronic
1038074527 8:24056963-24056985 TCCTTGGCAGAGAAGGCCGCTGG - Intergenic
1038926452 8:32145483-32145505 CCCTTTTCTGTGATGCCTGCTGG + Intronic
1040796266 8:51292745-51292767 CCCACTGCAGTGATGGTGGCAGG - Intergenic
1047755833 8:127917764-127917786 GCCTCTGCAGTGGTGGCAGCTGG + Intergenic
1049388845 8:142357928-142357950 CCCTTTGCAGTGATGGCCGCTGG - Intronic
1049388860 8:142357988-142358010 CCCTTTGCAGTGATGGCCGCTGG - Intronic
1049388875 8:142358048-142358070 CCCTTTGCAGTGATGGCCGCTGG - Intronic
1049388890 8:142358108-142358130 CCCTTTGCAGTGATGGCCGCTGG - Intronic
1049388904 8:142358168-142358190 CCCTTTGCAGTGATGGCCGCTGG - Intronic
1049388919 8:142358228-142358250 CCCTTTGCAGTGATGGCCGCTGG - Intronic
1049388934 8:142358288-142358310 CCCTTTGCAGTGATGGCCGCTGG - Intronic
1058402010 9:104630300-104630322 CCCTGTGCAGTGGTGGGCACCGG + Intergenic
1058670451 9:107356853-107356875 CCCTCTCCAGTGATGGCAGGAGG - Intergenic
1061712421 9:132497500-132497522 CCCTTCTCAGTAATGGCCCCGGG + Intronic
1061791399 9:133061063-133061085 CCCTCTGCAGTGATGGGAACAGG - Intergenic
1061795077 9:133081630-133081652 CCCTCTGCAGTGATGGGAACAGG - Intronic
1185446007 X:258348-258370 ACCATTGCAGTGTTGGCAGCTGG - Intergenic
1185455909 X:310818-310840 CCTTTTGCAGTGACAGCCTCAGG + Intronic
1190232402 X:48592440-48592462 CCCTGTGAAGTGATTTCCGCTGG + Intronic
1190599684 X:52077668-52077690 CCCATTGCAGTGAAAGCCCCAGG + Intergenic
1190608510 X:52170182-52170204 CCCATTGCAGTGAAAGCCCCAGG - Intergenic
1191123839 X:56933262-56933284 CCCTTGGTAGTGGTGGCCACAGG + Intergenic
1193619919 X:83738797-83738819 CCCATTGCTGTGATTGCCTCAGG + Intergenic
1197114737 X:122818588-122818610 CCCTTTGCTGTGGGGGTCGCGGG - Intergenic
1199545618 X:149005048-149005070 CCCTTCCTAGTGATGGCCTCTGG + Intergenic