ID: 1049388864

View in Genome Browser
Species Human (GRCh38)
Location 8:142357995-142358017
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 5, 1: 2, 2: 0, 3: 20, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049388864_1049388871 1 Left 1049388864 8:142357995-142358017 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388871 8:142358019-142358041 TCTGCTGGGTTTCAGGACAAGGG No data
1049388864_1049388873 14 Left 1049388864 8:142357995-142358017 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388873 8:142358032-142358054 AGGACAAGGGGAGCAGCCAGCGG No data
1049388864_1049388870 0 Left 1049388864 8:142357995-142358017 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388870 8:142358018-142358040 GTCTGCTGGGTTTCAGGACAAGG No data
1049388864_1049388874 29 Left 1049388864 8:142357995-142358017 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388874 8:142358047-142358069 GCCAGCGGCCATCACTGCAAAGG No data
1049388864_1049388869 -6 Left 1049388864 8:142357995-142358017 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388869 8:142358012-142358034 GGCGGGGTCTGCTGGGTTTCAGG No data
1049388864_1049388872 2 Left 1049388864 8:142357995-142358017 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388872 8:142358020-142358042 CTGCTGGGTTTCAGGACAAGGGG No data
1049388864_1049388876 30 Left 1049388864 8:142357995-142358017 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388876 8:142358048-142358070 CCAGCGGCCATCACTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049388864 Original CRISPR CCCGCCGCCCTTTGCAGTGA TGG (reversed) Intronic
900134083 1:1106881-1106903 CCCCCGGCCCTGGGCAGTGAGGG + Intronic
900287430 1:1908441-1908463 CCTGCCACCCTCTGCAGTGATGG - Intergenic
900512788 1:3068391-3068413 CCCGCCGGCCTGGGCAGTGGCGG + Intergenic
900597649 1:3489799-3489821 CCCGGGGCCCTTTGCAGGGGTGG - Intergenic
902983240 1:20140108-20140130 CCCTCCACCCTTGGCAGTGTTGG - Intronic
906179333 1:43804875-43804897 TCCTCCACCCCTTGCAGTGAGGG - Intronic
907499010 1:54864965-54864987 CCTGCGGCCCTTTACAGTGCAGG + Intronic
911943226 1:104073477-104073499 CCCGGTGCCCTTTGCAGGCACGG - Intergenic
912824683 1:112894796-112894818 CCCGCCGGCCCCGGCAGTGAGGG + Intergenic
920878469 1:209858904-209858926 GCCGCCGCCCCGGGCAGTGAGGG - Intergenic
923172601 1:231431027-231431049 CCCGCCGGCCTGGGCAGTGAGGG - Intergenic
1063960436 10:11301547-11301569 CCCGACTCCCGTTCCAGTGAGGG + Intronic
1075376031 10:121978642-121978664 CCGGCTGCCCTGGGCAGTGAGGG - Intergenic
1078513841 11:12007176-12007198 CCCGCAGCCCTTTGTAGTTTGGG - Intronic
1079399658 11:20095976-20095998 CCGTCTGCCCTTTGCAGTGGTGG + Intronic
1081464162 11:43300915-43300937 CCTGCTGCCCATTGCAGTGCAGG - Intergenic
1081814541 11:45931132-45931154 CCTGCCGCCCTCAGCAGTGTCGG - Intronic
1083772833 11:64878030-64878052 CCCCCCGCCCCCTGGAGTGATGG + Intronic
1084204743 11:67584851-67584873 CCCGCAGCCCTCTGGAGTGGAGG + Intronic
1084967463 11:72752075-72752097 CCCGTAGCCCTTTGGCGTGAAGG - Intronic
1086390381 11:86357276-86357298 CCCTCCTCCCTTTGGAGTTAAGG + Intergenic
1088843975 11:113649597-113649619 CCGGCCGGCCTGGGCAGTGAGGG - Intergenic
1089179952 11:116576620-116576642 CCCCCTGCCCTCTGCAGTGCTGG - Intergenic
1089730216 11:120514550-120514572 CCCTTCGCCCTCTCCAGTGATGG + Intronic
1090820526 11:130337613-130337635 CCTGCCGCCCCGGGCAGTGAGGG - Intergenic
1091915735 12:4271089-4271111 CCCGGCGCCCTCTGCATTCATGG - Intergenic
1092596339 12:10009263-10009285 GCCGCGGACCTTTGCGGTGAGGG - Intronic
1095776697 12:46018124-46018146 CCTGCCGCCCTGGGCAATGAGGG + Intergenic
1096235671 12:49924456-49924478 CGTGCCGCCCTTTGCAGTCAAGG - Intergenic
1097989739 12:65823043-65823065 CCAGCTGCCCTTTGCAGAGCTGG - Intergenic
1099188211 12:79538916-79538938 TCCGCCTGCCTTGGCAGTGATGG - Intergenic
1101963290 12:109265619-109265641 CCCGCCACCCTGTGCAGTCTGGG + Intronic
1102179872 12:110904497-110904519 CTCCCCGCCCTCTGCAGTGGTGG + Intronic
1103459670 12:121093761-121093783 ACCGCCGCCCCGGGCAGTGAGGG - Intergenic
1105696853 13:22897670-22897692 CTCGCCGCCATTAGCAGGGACGG + Intergenic
1105777643 13:23678065-23678087 CCCGCCGGCCTGAGCAGTGAGGG - Intergenic
1105821607 13:24085658-24085680 CCCGACTCCCTTTCCAGGGAGGG + Intronic
1107652582 13:42559876-42559898 CCCGCAGCCCCGGGCAGTGACGG + Intergenic
1109201862 13:59440017-59440039 CCTGCCGGCCTGGGCAGTGAGGG + Intergenic
1111556182 13:89884082-89884104 CCCGCCGCCCCAGGCAGTGAGGG - Intergenic
1114155540 14:20099305-20099327 ACCGCCGCCCCGGGCAGTGAGGG + Intergenic
1116015030 14:39395882-39395904 CCCCCCACCCTTTTCTGTGATGG - Intergenic
1120030615 14:79636747-79636769 CCTTTCTCCCTTTGCAGTGATGG - Intronic
1120209877 14:81624020-81624042 CCTGCCGCCCCGGGCAGTGAGGG - Intergenic
1120769666 14:88365278-88365300 CCCGCCTCCCTTTGAAGTTCAGG - Intergenic
1122778595 14:104134174-104134196 CCCGTTGGCCTTTGCAGAGAAGG - Intergenic
1123931152 15:25172272-25172294 CCACCCCCGCTTTGCAGTGATGG + Intergenic
1124387853 15:29225002-29225024 CCCGCCGGCCCGGGCAGTGAGGG - Intronic
1129374012 15:75116206-75116228 CCCACCGCCCCGGGCAGTGAGGG - Intronic
1131212687 15:90511066-90511088 CCCACCGCCCCGGGCAGTGAGGG + Intergenic
1131969419 15:97876683-97876705 GCCACGGCCCCTTGCAGTGAGGG - Intergenic
1136505426 16:30699574-30699596 CCTGCGGGCCTTTCCAGTGAGGG - Intronic
1144128081 17:12221012-12221034 CCCGCCGGCCCGGGCAGTGAGGG + Intergenic
1144263851 17:13549213-13549235 GCCGCAGACCTTCGCAGTGAGGG - Intronic
1148685179 17:49496821-49496843 CCCGCCGACCTTTGCCGAGTCGG - Intronic
1149626484 17:58083816-58083838 CCCGCAGCCCTTGGCGTTGACGG + Intronic
1151318635 17:73339079-73339101 CCAGACCCCCTTGGCAGTGAGGG - Intronic
1152877425 17:82794937-82794959 CCCGCCACCATCTGCAGTAAGGG - Intronic
1156463146 18:37332853-37332875 CCCTCTGCCCTTGGCAGTGAGGG - Intronic
1156481055 18:37436689-37436711 CCTGCAGCCCTTTGAAGGGATGG + Intronic
1157384289 18:47248289-47248311 ACCGCCGCCCTTGGCAGAGCTGG - Intronic
1157612821 18:48968994-48969016 CCCGGCCCCCCTTGGAGTGAGGG + Intergenic
1160429510 18:78801764-78801786 CCAGCCTCCCTTGGCAATGAAGG - Intergenic
1161669857 19:5600708-5600730 CCTGCCGCTCTGTGCAGTGGGGG - Intronic
1161766632 19:6212226-6212248 CTCGCTGCCCTTTGTAGTGTTGG + Intergenic
1166140229 19:40801364-40801386 CCAGCCGCCCTGCGCAGTGGCGG - Exonic
1167710544 19:51107947-51107969 CCCGCCGCCCTGCGCAGAGTCGG + Intronic
929624123 2:43388943-43388965 CCCCCCGCCCGTAGCAGTGGTGG + Intronic
929687825 2:44049605-44049627 CCCTCAGCCCTTTTCAGTGGAGG + Intergenic
933531626 2:83518279-83518301 CCCGCCTGCCTGGGCAGTGAGGG + Intergenic
934754871 2:96817754-96817776 CCCCCCCCCATTTGCAGGGAGGG + Intronic
937334098 2:121050294-121050316 CCCACAGCCCTTTGCAGTCAGGG + Intergenic
938881588 2:135594978-135595000 CCCCCCCCCCTTTTCAATGAAGG + Intronic
939003130 2:136758567-136758589 CCCGCCTCCCCAGGCAGTGAGGG + Intergenic
943024214 2:182608555-182608577 CGCGCCGCACCTGGCAGTGAGGG + Intergenic
943790036 2:191921738-191921760 CCCGCTGCCCCAGGCAGTGAGGG + Intergenic
943906121 2:193502662-193502684 CCCGCCGCCACGGGCAGTGAGGG - Intergenic
947073414 2:226316322-226316344 CCCGCCACCCTTTTGAGTAAAGG + Intergenic
948021777 2:234739074-234739096 CCCTCCTCCCTTTGCAGTTCAGG + Intergenic
948804914 2:240449326-240449348 CCGGCGGCCCTTTGCAGCGTGGG - Intronic
1168944288 20:1738735-1738757 CCCCCCACCCTCTGCAGGGAGGG - Intergenic
1169645355 20:7803770-7803792 CCCGCCGGCCCGGGCAGTGAGGG - Intergenic
1171973439 20:31578815-31578837 CCCGCCGCCCCAGGCAGTGAGGG - Intergenic
1173464312 20:43268948-43268970 CCTCCCGCCTTCTGCAGTGATGG - Intergenic
1177795895 21:25778464-25778486 CCTGCCGCCCCAGGCAGTGAGGG + Intergenic
1183935196 22:41257960-41257982 CACGGCGCCCTTCTCAGTGAAGG + Exonic
1184911793 22:47540190-47540212 CCCAAGGTCCTTTGCAGTGAGGG + Intergenic
1185282232 22:49977841-49977863 CCTGCCGCCCTTTGCAGAGCAGG + Intergenic
953429809 3:42829839-42829861 CCCGGTGCCCTTTGCAGTCAAGG - Intronic
954226202 3:49182875-49182897 CCCCCCGCCCCGGGCAGTGAGGG - Intronic
960519284 3:118636749-118636771 CCCTCTCCCCTTTGTAGTGATGG - Intergenic
962568229 3:136685759-136685781 CCCCCAACCCTTTGCAGTCATGG - Intronic
962998131 3:140651531-140651553 CCCGCCGGCCCAGGCAGTGAGGG + Intergenic
963554656 3:146772453-146772475 GCCACCGCCCTGGGCAGTGAGGG + Intergenic
964802893 3:160574197-160574219 CCCACCGGCCCTGGCAGTGAGGG - Intergenic
965092239 3:164179356-164179378 CCGCCGGCCCTGTGCAGTGAGGG + Intergenic
966096800 3:176213672-176213694 CCCGCCGCCCCGGGCAATGAGGG - Intergenic
974128449 4:57724091-57724113 CCTGCTGCCTTTTGTAGTGATGG - Intergenic
974892302 4:67896814-67896836 CCTGCCGCCGCTGGCAGTGAGGG - Intergenic
975028058 4:69576586-69576608 CCGCCCGCCCTGGGCAGTGAGGG - Intergenic
975298812 4:72766007-72766029 CCACCCGCCCCTGGCAGTGAGGG + Intergenic
975702015 4:77075773-77075795 CCCGCCGCCCTATGGCGAGAGGG - Exonic
976565529 4:86547405-86547427 CCCACCGCCCGGGGCAGTGAGGG + Intronic
980739259 4:136929121-136929143 ACCTCCGCCCTGTGCAGTGAGGG + Intergenic
983064096 4:163189967-163189989 CCCGCCGGCCCTGGCAATGAGGG - Intergenic
984241836 4:177227780-177227802 CCCACCGGCCTGGGCAGTGAGGG - Intergenic
986993277 5:13578618-13578640 CCCGCCGGCCCGGGCAGTGAGGG + Intergenic
987099170 5:14577364-14577386 CCCGCCAGCCCTGGCAGTGAGGG + Intergenic
987113836 5:14711583-14711605 CCTGCTGCCCTTTCCAATGAGGG + Intronic
989559672 5:42836477-42836499 CCAGCCACCCTGGGCAGTGAGGG + Intronic
990869471 5:60415563-60415585 CCCGCCACCCCGGGCAGTGAGGG + Intronic
992487579 5:77210844-77210866 CCCGCTGCCACCTGCAGTGAGGG - Intronic
993770279 5:91917385-91917407 CCCGCCGCCCGGGGCAATGAGGG + Intergenic
994251527 5:97542132-97542154 CCCGCCGCCCTGGGCACTGAGGG - Intergenic
1000903552 5:166936467-166936489 CCCACCGCCATGGGCAGTGAGGG - Intergenic
1001636440 5:173213553-173213575 CCCGCCAGCCTGGGCAGTGAGGG + Intergenic
1003425727 6:5997150-5997172 CCCGCCGCCCGCTGCGGGGAGGG - Intergenic
1003868480 6:10383618-10383640 CCCGCCGCCCTCTGCAGCCTAGG + Intergenic
1003897017 6:10617269-10617291 CCCGCCGCCCGGGGCAGTGAGGG - Intronic
1004647939 6:17580855-17580877 CCCGCCGGCCTGGGCAGTGAGGG + Intergenic
1006642489 6:35496486-35496508 CCCGCCGCCCTTTGGACTCCCGG - Intronic
1013694807 6:112689574-112689596 CCCACCGCCCCGGGCAGTGAGGG - Intergenic
1017383529 6:153857191-153857213 GCCGCCACCCTGGGCAGTGAGGG - Intergenic
1019451654 7:1101747-1101769 CCCGCAGCTCTCTGCAATGAGGG + Intronic
1019647604 7:2139402-2139424 CCCCCCACCCTCAGCAGTGAAGG + Intronic
1020008278 7:4793636-4793658 CCCGCCAGCCTGGGCAGTGAGGG + Intronic
1020241457 7:6398314-6398336 CCCGCCTGCCTTTGCGGTAAGGG + Intronic
1020784448 7:12556410-12556432 CCCGCCGCCCCCGGCAGTGAGGG - Intergenic
1024741773 7:52362759-52362781 CCCGCCGCCCAGGGCAGTGAGGG + Intergenic
1031605526 7:123763423-123763445 CCCGCCACCCCGGGCAGTGAGGG - Intergenic
1033839933 7:145360888-145360910 CCTGCCGCCCCGGGCAGTGAGGG - Intergenic
1036801364 8:11794911-11794933 CCCGCCGGCCAGGGCAGTGAGGG + Intergenic
1042137519 8:65645697-65645719 CCCCCCCCCCTTTGTAGAGATGG + Intronic
1045743344 8:105387538-105387560 CCGCCCGCCCTAGGCAGTGAGGG - Intronic
1048576036 8:135690665-135690687 CCCGCCGGCCCCGGCAGTGAGGG - Intergenic
1048756250 8:137741365-137741387 GCTGCAGACCTTTGCAGTGAGGG - Intergenic
1049178034 8:141206107-141206129 CCCGCCGTCCCTGGCAGGGAGGG - Intergenic
1049278209 8:141730487-141730509 ACCGCGACCCTTTGGAGTGAAGG - Intergenic
1049284033 8:141764947-141764969 CCCACTCCCCTTTGCAGTGAAGG + Intergenic
1049388849 8:142357935-142357957 CCCGCCGCCCTTTGCAGTGATGG - Intronic
1049388864 8:142357995-142358017 CCCGCCGCCCTTTGCAGTGATGG - Intronic
1049388879 8:142358055-142358077 CCCGCCGCCCTTTGCAGTGATGG - Intronic
1049388893 8:142358115-142358137 CCTGCCGCCCTTTGCAGTGATGG - Intronic
1049388908 8:142358175-142358197 CCCGCCGCCCTTTGCAGTGATGG - Intronic
1049388923 8:142358235-142358257 CCCGCCGCCCTTTGCAGTGATGG - Intronic
1049388937 8:142358295-142358317 CCTGCCGCCCTTTGCAGTGATGG - Intronic
1052693555 9:31848588-31848610 CCAGCCGGCCTGTGCACTGAGGG + Intergenic
1057544582 9:96007955-96007977 CCCGCAGCTCTTTGGAGTGCTGG + Intronic
1058235694 9:102487192-102487214 CCCACCGCCCTGGGCAGTGAGGG - Intergenic
1058941190 9:109814093-109814115 CCCACTACCGTTTGCAGTGAAGG + Intronic
1059376271 9:113883997-113884019 CCCCCCGCCCTGTACAGTGAAGG + Intronic
1059791160 9:117642980-117643002 CCCGCCGGCCCGGGCAGTGAGGG - Intergenic
1060301459 9:122376809-122376831 CCCACCACCCTGTTCAGTGAAGG - Intronic
1061791402 9:133061070-133061092 CGCACAGCCCTCTGCAGTGATGG - Intergenic
1061795080 9:133081637-133081659 CGCACAGCCCTCTGCAGTGATGG - Intronic
1187031914 X:15496999-15497021 CCCCACGGCCTTTGCATTGATGG - Intronic
1192186755 X:68952265-68952287 CCCGCCGGCCTGGGCAGTGAGGG + Intergenic
1196197929 X:112855108-112855130 CCCACCGCCCCGGGCAGTGAGGG - Intergenic
1200053132 X:153445203-153445225 CTCGCTGGCCTTGGCAGTGAAGG + Exonic
1200213721 X:154358226-154358248 CCCGGCGTCCTTTGCATCGATGG + Exonic
1202137108 Y:21676916-21676938 CCTGCCGCCCTGGGCAATGAGGG - Intergenic