ID: 1049388887

View in Genome Browser
Species Human (GRCh38)
Location 8:142358080-142358102
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049388875_1049388887 9 Left 1049388875 8:142358048-142358070 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388887 8:142358080-142358102 CTGCTGGGTTTCAGGACAAGGGG No data
1049388879_1049388887 2 Left 1049388879 8:142358055-142358077 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388887 8:142358080-142358102 CTGCTGGGTTTCAGGACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr