ID: 1049388901

View in Genome Browser
Species Human (GRCh38)
Location 8:142358140-142358162
Sequence CTGCTGGGTTTCAGGACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049388893_1049388901 2 Left 1049388893 8:142358115-142358137 CCATCACTGCAAAGGGCGGCAGG 0: 2
1: 5
2: 3
3: 19
4: 189
Right 1049388901 8:142358140-142358162 CTGCTGGGTTTCAGGACAAGGGG No data
1049388890_1049388901 9 Left 1049388890 8:142358108-142358130 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388901 8:142358140-142358162 CTGCTGGGTTTCAGGACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049388901 Original CRISPR CTGCTGGGTTTCAGGACAAG GGG Intronic
No off target data available for this crispr