ID: 1049388901 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:142358140-142358162 |
| Sequence | CTGCTGGGTTTCAGGACAAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049388893_1049388901 | 2 | Left | 1049388893 | 8:142358115-142358137 | CCATCACTGCAAAGGGCGGCAGG | 0: 2 1: 5 2: 3 3: 19 4: 189 |
||
| Right | 1049388901 | 8:142358140-142358162 | CTGCTGGGTTTCAGGACAAGGGG | No data | ||||
| 1049388890_1049388901 | 9 | Left | 1049388890 | 8:142358108-142358130 | CCAGCGGCCATCACTGCAAAGGG | 0: 7 1: 0 2: 0 3: 15 4: 123 |
||
| Right | 1049388901 | 8:142358140-142358162 | CTGCTGGGTTTCAGGACAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049388901 | Original CRISPR | CTGCTGGGTTTCAGGACAAG GGG | Intronic | ||
| No off target data available for this crispr | |||||