ID: 1049388916

View in Genome Browser
Species Human (GRCh38)
Location 8:142358200-142358222
Sequence CTGCTGGGTTTCAGGACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049388904_1049388916 9 Left 1049388904 8:142358168-142358190 CCAGCGGCCATCACTGCAAAGGG 0: 7
1: 0
2: 0
3: 15
4: 123
Right 1049388916 8:142358200-142358222 CTGCTGGGTTTCAGGACAAGGGG No data
1049388908_1049388916 2 Left 1049388908 8:142358175-142358197 CCATCACTGCAAAGGGCGGCGGG 0: 5
1: 2
2: 0
3: 20
4: 134
Right 1049388916 8:142358200-142358222 CTGCTGGGTTTCAGGACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049388916 Original CRISPR CTGCTGGGTTTCAGGACAAG GGG Intronic
No off target data available for this crispr