ID: 1049388931 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:142358260-142358282 |
Sequence | CTGCTGGGTTTCAGGACAAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049388923_1049388931 | 2 | Left | 1049388923 | 8:142358235-142358257 | CCATCACTGCAAAGGGCGGCGGG | 0: 5 1: 2 2: 0 3: 20 4: 134 |
||
Right | 1049388931 | 8:142358260-142358282 | CTGCTGGGTTTCAGGACAAGGGG | No data | ||||
1049388919_1049388931 | 9 | Left | 1049388919 | 8:142358228-142358250 | CCAGCGGCCATCACTGCAAAGGG | 0: 7 1: 0 2: 0 3: 15 4: 123 |
||
Right | 1049388931 | 8:142358260-142358282 | CTGCTGGGTTTCAGGACAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049388931 | Original CRISPR | CTGCTGGGTTTCAGGACAAG GGG | Intronic | ||
No off target data available for this crispr |