ID: 1049389492

View in Genome Browser
Species Human (GRCh38)
Location 8:142360628-142360650
Sequence GCTCCCTTCAGGCTGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049389492_1049389507 22 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC No data
Right 1049389507 8:142360673-142360695 ATCCTGTTTGCAGGGCGCCGGGG No data
1049389492_1049389506 21 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC No data
Right 1049389506 8:142360672-142360694 GATCCTGTTTGCAGGGCGCCGGG No data
1049389492_1049389505 20 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC No data
Right 1049389505 8:142360671-142360693 AGATCCTGTTTGCAGGGCGCCGG No data
1049389492_1049389510 29 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC No data
Right 1049389510 8:142360680-142360702 TTGCAGGGCGCCGGGGGAAGCGG No data
1049389492_1049389508 23 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC No data
Right 1049389508 8:142360674-142360696 TCCTGTTTGCAGGGCGCCGGGGG No data
1049389492_1049389502 14 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC No data
Right 1049389502 8:142360665-142360687 CTGCCCAGATCCTGTTTGCAGGG No data
1049389492_1049389501 13 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC No data
Right 1049389501 8:142360664-142360686 ACTGCCCAGATCCTGTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049389492 Original CRISPR GCTCCCTTCAGGCTGGTGGG GGG (reversed) Intronic