ID: 1049389492

View in Genome Browser
Species Human (GRCh38)
Location 8:142360628-142360650
Sequence GCTCCCTTCAGGCTGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 283}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049389492_1049389510 29 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1049389510 8:142360680-142360702 TTGCAGGGCGCCGGGGGAAGCGG No data
1049389492_1049389505 20 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1049389505 8:142360671-142360693 AGATCCTGTTTGCAGGGCGCCGG No data
1049389492_1049389501 13 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1049389501 8:142360664-142360686 ACTGCCCAGATCCTGTTTGCAGG No data
1049389492_1049389502 14 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1049389502 8:142360665-142360687 CTGCCCAGATCCTGTTTGCAGGG No data
1049389492_1049389506 21 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1049389506 8:142360672-142360694 GATCCTGTTTGCAGGGCGCCGGG No data
1049389492_1049389508 23 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1049389508 8:142360674-142360696 TCCTGTTTGCAGGGCGCCGGGGG No data
1049389492_1049389507 22 Left 1049389492 8:142360628-142360650 CCCCCCACCAGCCTGAAGGGAGC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1049389507 8:142360673-142360695 ATCCTGTTTGCAGGGCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049389492 Original CRISPR GCTCCCTTCAGGCTGGTGGG GGG (reversed) Intronic
900093489 1:930672-930694 GCTCCATTCAGGCTCGTGACTGG + Intronic
900488576 1:2935201-2935223 GCTGCCCTCAGGCAGGTGGAGGG - Intergenic
901325603 1:8363485-8363507 GGCCCCTTCTGGCAGGTGGGTGG - Intronic
903131231 1:21280673-21280695 GCACCCCTCAGGCTGTTGGTGGG - Intronic
903226863 1:21898744-21898766 GGTCCCCTCAACCTGGTGGGGGG + Intronic
903282037 1:22255535-22255557 TCCCCCTTCAGGCTTGAGGGTGG + Intergenic
903734113 1:25519054-25519076 TCACCTTTCAGGCTGGAGGGTGG + Intergenic
903973825 1:27136608-27136630 GCTCCCTTCAGAGGGGAGGGAGG - Intronic
905662173 1:39736013-39736035 GCTCGCTTCAGGATGGGGGTTGG - Intronic
905869241 1:41393753-41393775 GCTCCCCTGAAGCTGGTGTGAGG - Intergenic
905898943 1:41567863-41567885 CCTGCCTTCAGGCTGATGGATGG + Intronic
906514976 1:46433575-46433597 GCTCCCTTCCAGCTGGGGTGAGG - Intergenic
907220636 1:52904830-52904852 GCTCCCTCCATCCTGGTAGGAGG - Exonic
911181147 1:94861888-94861910 GAACCCTTCAGGGTGGTGGAGGG + Intronic
912756045 1:112325571-112325593 GCTCCATTAAATCTGGTGGGGGG - Intergenic
913532091 1:119740655-119740677 GCTCCCTTACTACTGGTGGGAGG + Intronic
913706039 1:121423831-121423853 GGTCCATTCAGTCTGTTGGGGGG + Intergenic
914357913 1:146903923-146903945 GCTCCCTGCTGGCTGTTGGCTGG + Intergenic
914816702 1:151068669-151068691 GATCCCTTGACCCTGGTGGGTGG - Intronic
915311761 1:155008771-155008793 CCTCCCTCCAAGCTGGGGGGAGG + Intronic
915597107 1:156902098-156902120 ACTGCGTTCAGGATGGTGGGAGG + Intronic
920309465 1:205040263-205040285 GCTCCCTTGGTGGTGGTGGGTGG - Intergenic
921055022 1:211536938-211536960 GCTCCCTGGAGGCTGGAGGCTGG + Intergenic
921447619 1:215265139-215265161 GCCACTTTCAGGCTGGTAGGAGG + Intergenic
922606312 1:226891909-226891931 GCTCCCTGCAGCCTGGGTGGAGG + Intronic
922711969 1:227841172-227841194 TCTCCCATCAGGCTGCTGGCTGG + Intronic
923572429 1:235128501-235128523 GCGGCCCACAGGCTGGTGGGAGG + Intronic
924385551 1:243495684-243495706 GCTCCCTTCTGACAGGTGGGCGG + Intronic
1062871013 10:904465-904487 GCTCACTTGAGCCTGGGGGGCGG + Intronic
1065972743 10:30818263-30818285 CATCCCTGCAGGCTGGCGGGTGG + Intergenic
1066186134 10:33012492-33012514 TCTCCCAGCAGGCCGGTGGGAGG + Intergenic
1067553963 10:47254782-47254804 GCTGCCCTCAGGCAGGTGGCTGG - Intergenic
1070534064 10:77362130-77362152 GCTCCCAGCAGGCTGGAGGAGGG + Intronic
1070683006 10:78462245-78462267 GCTCCCTTGGGGCTGGTGCCAGG + Intergenic
1071665699 10:87555167-87555189 GTTCCTTTCAGGCTAGAGGGTGG - Intergenic
1072311155 10:94156686-94156708 CCTCCCTAGAGGATGGTGGGTGG + Intronic
1072635655 10:97176278-97176300 GCTCCTTTGAGGCTGGCGAGAGG + Intronic
1073268633 10:102243277-102243299 GATCCCTTCAATATGGTGGGTGG - Intergenic
1074211418 10:111338886-111338908 GCTCACTTCAGGCCTGTGGGCGG + Intergenic
1074213438 10:111360405-111360427 GCGCCCCTCTGGCTGGTAGGAGG + Intergenic
1076426202 10:130369387-130369409 GCGCCGTTCTGGCTGCTGGGTGG + Intergenic
1076428903 10:130388039-130388061 CTTCCCTTCAGGTTGGAGGGTGG + Intergenic
1077186955 11:1239693-1239715 GGCCCCTGCTGGCTGGTGGGGGG + Intronic
1077249306 11:1554012-1554034 TCTTCCTTCAGACTGGTGGTGGG - Intergenic
1077328506 11:1973864-1973886 GCTGCCTGCAGGGTGGTGGGGGG + Intronic
1077481927 11:2818984-2819006 GCTCCTTTCAGGCTGGAGCTGGG - Intronic
1080279936 11:30545216-30545238 GCTCCCTACAGGATGGGAGGTGG + Intronic
1080850680 11:36066775-36066797 GCTCCCTCAGGGCTGTTGGGGGG + Intronic
1081642227 11:44764179-44764201 TCTCCATCCAGGCAGGTGGGAGG - Intronic
1082118746 11:48356102-48356124 GCTGGGTTCAGCCTGGTGGGTGG + Intergenic
1083290074 11:61684875-61684897 GCTGCCTTCAGGCTGTGGGAGGG + Intronic
1083897988 11:65629829-65629851 GCTCTGTCCAGGCTGGCGGGTGG + Intronic
1085038679 11:73314330-73314352 ACTCCCTACAGCCTGGGGGGCGG - Intronic
1085638986 11:78179452-78179474 GCTTCCCTCAGGCAGTTGGGTGG - Intronic
1087154361 11:94886231-94886253 GCTCCCTTCAGTCTGGCTGTGGG - Intergenic
1090258630 11:125303258-125303280 CATCCCTTCAGGGTGGTTGGAGG - Intronic
1090391059 11:126387588-126387610 GGTTGCTTCAGCCTGGTGGGTGG + Intronic
1090954870 11:131504846-131504868 GCTTCCTCCAGGCTGGAGCGGGG - Intronic
1202811484 11_KI270721v1_random:29043-29065 GCTGCCTGCAGGGTGGTGGGGGG + Intergenic
1091654522 12:2335743-2335765 CCTCCCTGCAGGCTGTTGTGAGG + Intronic
1091779283 12:3203895-3203917 GCTTCCTGCAGGCTGGTGCTTGG + Intronic
1092008341 12:5088203-5088225 TCTCCCTGCAGGCTGCTGGCAGG + Intergenic
1096987045 12:55766707-55766729 GCTCCCTTGAGCCTGGGAGGTGG - Intronic
1100353100 12:93803304-93803326 TTTCCCTTCAGGCTGGCTGGAGG + Intronic
1102445497 12:112999144-112999166 GCTCCGTTCAGGCAGGTGCCGGG + Intronic
1103437061 12:120935055-120935077 GCTCTGTTCAGGCTGGAGTGCGG + Intergenic
1103581105 12:121916223-121916245 GCTCCCTTCAGGAAGGTCAGAGG - Intronic
1103590723 12:121990313-121990335 GCACCCTTCAGGCCTATGGGTGG + Intronic
1104221480 12:126788704-126788726 GATTCCTTCTTGCTGGTGGGTGG + Intergenic
1104866420 12:131958276-131958298 GCTCTCTGCCGGGTGGTGGGAGG + Intronic
1104889441 12:132133171-132133193 GCCCCCGTCAGGCGGGGGGGAGG - Intergenic
1105701789 13:22940033-22940055 CCTCCCGGCAGGCTGGTGGAGGG - Intergenic
1106490446 13:30216660-30216682 CCTCCAGTCAGGCTGGTGGCAGG + Intronic
1107779790 13:43886591-43886613 GCTTACTTAAGGGTGGTGGGTGG + Intronic
1107881180 13:44833365-44833387 GGTCCCTCCAGGCTGGAGAGAGG + Intergenic
1111200170 13:84926640-84926662 ACTCCCTCCAGCCTGGTGTGTGG - Intergenic
1111441775 13:88291118-88291140 GCTCCCAACAGGCTGTTGTGAGG + Intergenic
1111442158 13:88293846-88293868 GCTCCCAACAGGCTGTTGTGAGG - Intergenic
1111706938 13:91761870-91761892 CCTCCCTGGAGGTTGGTGGGAGG + Intronic
1112423655 13:99276644-99276666 ACTTCCTGGAGGCTGGTGGGTGG + Intronic
1113650192 13:112028914-112028936 GCTCCCACCAGGCAGCTGGGTGG - Intergenic
1113925265 13:113938488-113938510 GCTCCTTAGAGGCAGGTGGGCGG - Intergenic
1114892020 14:26936811-26936833 GGTCCATTCAGTCTGTTGGGGGG + Intergenic
1115951244 14:38724639-38724661 GCTACCTTGAGGGTGGTGGCTGG - Intergenic
1116877754 14:50130244-50130266 GCTCCCTTTAGACTGGTAGTGGG + Intronic
1117427684 14:55618571-55618593 GCTCCTTTGAGTCTGATGGGTGG + Intronic
1117821861 14:59658038-59658060 GGACGCTTCAGGTTGGTGGGGGG + Intronic
1118485770 14:66213254-66213276 GAGGCCTTCAGGCTGGGGGGAGG - Intergenic
1119520177 14:75279215-75279237 GCTCCCTTGTGCCTGGAGGGAGG + Intronic
1119546871 14:75478300-75478322 ACTTCCTTCAGGCAGGAGGGAGG - Intergenic
1120528405 14:85604202-85604224 TCTCCTTTCATGCTGGTGGGTGG + Intronic
1121013698 14:90535836-90535858 GCTCCCTCCTGGCTTGCGGGTGG + Exonic
1121116417 14:91346280-91346302 CCTGCCTTCAGGCTGGGGGGCGG - Intronic
1121236910 14:92398353-92398375 GCTGGCAGCAGGCTGGTGGGCGG + Intronic
1122147758 14:99703363-99703385 GATCTCTTCAGGATGGTGAGTGG - Intronic
1122163268 14:99802110-99802132 GCTCACTGCAGGCGGGTAGGTGG + Intronic
1122287356 14:100659653-100659675 GCTCCCTCTAAGCTGGTGGGTGG + Intergenic
1124155017 15:27218094-27218116 GATCACTTGAGGCTGGAGGGTGG - Intronic
1126063287 15:44804616-44804638 GTTCCCTACAGGGTGGAGGGTGG + Intergenic
1126563988 15:50075707-50075729 GTTTCCTTCAGGTGGGTGGGTGG - Intronic
1128458667 15:67849373-67849395 GCTCCATTCAGTCAGTTGGGGGG + Intergenic
1129768427 15:78185342-78185364 GGTCCCTCCATGCTGGTGGGGGG - Intronic
1130583229 15:85157333-85157355 TCTCCCCGCAGGTTGGTGGGTGG + Intergenic
1131154023 15:90063812-90063834 GCGCCCTTGAGGTTGGCGGGAGG + Intronic
1132207652 15:99997582-99997604 CCTCCCGTCTGGCAGGTGGGTGG - Exonic
1132601835 16:776239-776261 GCTCCTTTCAGGCTGCAGGAGGG - Intronic
1132723788 16:1330154-1330176 CCCACCCTCAGGCTGGTGGGAGG + Intergenic
1133034879 16:3028989-3029011 GAGCCCCTCAGGCTGGTGCGGGG + Intronic
1135194525 16:20383482-20383504 GCTCCCAGCAGGCTTGTGGGAGG - Intronic
1135237463 16:20771096-20771118 GCTCTTTTCAGGCTGGAGTGCGG + Intronic
1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG + Intergenic
1139668259 16:68473295-68473317 GCTCCCATCAAGGAGGTGGGTGG + Intergenic
1139702309 16:68715566-68715588 ACTCCCTGCAGGCTGGAGTGGGG - Intronic
1139976271 16:70813369-70813391 GCTCCCTGCTGGCTGTTGGCTGG - Intronic
1141110792 16:81269214-81269236 GCTCCCTTCAGACGTGGGGGTGG - Intronic
1141518385 16:84561578-84561600 GCTCCCTGCAGGCTGGAGGAAGG - Intergenic
1141962680 16:87420141-87420163 GCACCTTTCTGGCTGGTGGGTGG - Intronic
1142135913 16:88452014-88452036 GCTCCCAGCAGGCTGGCGGGTGG + Intergenic
1142680917 17:1548173-1548195 GGTCCCTTCCGGCTGATGGTGGG - Intronic
1143514292 17:7411646-7411668 CCTCCCTACAGCCTTGTGGGGGG + Intronic
1143639532 17:8188243-8188265 GCTCCCTTGGGGCTGGTGCTGGG - Intergenic
1144623729 17:16833885-16833907 CCTACCTGCAGGCCGGTGGGAGG + Intergenic
1145973279 17:28969537-28969559 GCTCTCTGCAGGGTGGTGGGTGG + Intronic
1146844342 17:36173842-36173864 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146856647 17:36261777-36261799 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146863970 17:36326598-36326620 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1146872557 17:36385688-36385710 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146879915 17:36436773-36436795 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146943490 17:36859561-36859583 GCTCCCCTCAGGACGGTGAGAGG - Intergenic
1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147075441 17:37986312-37986334 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147078362 17:38006747-38006769 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147086966 17:38065858-38065880 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG + Intergenic
1147102911 17:38189821-38189843 GCTCCCTTGACCCTGGCGGGGGG - Intergenic
1147140828 17:38459757-38459779 GCTCCCTGCAGGCTGCCAGGTGG - Intronic
1147578063 17:41613817-41613839 CCCACCTGCAGGCTGGTGGGAGG + Intronic
1148782041 17:50128005-50128027 GCTCCCATCTGATTGGTGGGGGG - Intronic
1151782792 17:76258497-76258519 GCGCCCTGCAGGATGGTGGGTGG - Intergenic
1151996245 17:77611102-77611124 GCTCCCTTCTCGGTGGAGGGAGG - Intergenic
1152202041 17:78952827-78952849 GCTCCCTTTGGGCTCGGGGGTGG - Intergenic
1152592417 17:81220206-81220228 GCACCCCTCTGGCTGGTGGCAGG + Intronic
1152730942 17:81969595-81969617 GCACCCTCCAGGCAGGTGAGTGG - Intergenic
1152791685 17:82283556-82283578 GCTCACTTGGGGCAGGTGGGAGG - Intergenic
1152891336 17:82883296-82883318 TTTCCCTTTAGGCTGGTAGGAGG + Intronic
1157378936 18:47193243-47193265 GCTCACTCCTGGCAGGTGGGTGG - Intergenic
1157506218 18:48228542-48228564 GCCACTCTCAGGCTGGTGGGTGG - Intronic
1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG + Intronic
1160317496 18:77860735-77860757 GCTCTCTGCAGGCTGGACGGAGG + Intergenic
1160377145 18:78421723-78421745 GCTCTCCTGAAGCTGGTGGGTGG - Intergenic
1160549038 18:79681293-79681315 GCCCCCTGCGTGCTGGTGGGTGG + Intronic
1160754474 19:750540-750562 GCTCCCTCAGGGCTGCTGGGAGG - Intergenic
1160816868 19:1040139-1040161 GCTCCCTGCCTGCTGCTGGGCGG + Exonic
1161007353 19:1943175-1943197 GTTCCCTTCACCCCGGTGGGAGG + Intronic
1161532343 19:4797542-4797564 GCTCCCTTGAGACTGGGGTGGGG + Exonic
1161699377 19:5786639-5786661 GCTCCCATCAGGGTGGTACGAGG + Intronic
1162735649 19:12745598-12745620 TCTCCCCTCAGGCTGGTGAAGGG + Exonic
1163514138 19:17752993-17753015 GCTCCCTTGAGCCTGGGAGGTGG + Intronic
1163839388 19:19596836-19596858 GCTCACTTCAGCCTCCTGGGTGG - Intronic
1164144221 19:22500617-22500639 GCTTCCTGCTGGCTGGTGGGTGG - Intronic
1164544199 19:29145536-29145558 GCACCCAGCAGGCTGGTGGTGGG + Intergenic
1164627241 19:29737727-29737749 GGACCGCTCAGGCTGGTGGGAGG - Intergenic
1168180389 19:54658729-54658751 CCTCCCTTCTGGCTGCTGTGTGG + Intronic
925055848 2:856820-856842 ACTCTCCTCAGGCTGGGGGGAGG - Intergenic
926146302 2:10398929-10398951 GCTCCAGTAAGGCTGGTGGATGG - Intronic
926215080 2:10901324-10901346 CCTGCCTGCAGGCAGGTGGGAGG - Intergenic
926435827 2:12836542-12836564 CCTCCTCTCAGGCGGGTGGGAGG + Intergenic
928345447 2:30489779-30489801 GCTCTCTTCAGGATGGGGTGGGG - Intronic
930748239 2:54906595-54906617 GGTCCCTGCAGGCAGGTGAGGGG + Intronic
931670711 2:64644435-64644457 CCCGCCCTCAGGCTGGTGGGAGG - Intronic
932343119 2:70979005-70979027 GCCCCCGCCTGGCTGGTGGGCGG - Intronic
934991726 2:98926396-98926418 GCTCCCAAGAGGATGGTGGGAGG - Intronic
937550413 2:123081757-123081779 GCTCTCTGCAGGGTGGTGGCAGG + Intergenic
938279879 2:130056304-130056326 GCTCGCTGTAGGGTGGTGGGAGG - Intergenic
938330831 2:130447019-130447041 GCTCGCTGTAGGGTGGTGGGAGG - Intergenic
938359115 2:130674484-130674506 GCTCGCTGTAGGGTGGTGGGAGG + Intergenic
938435514 2:131281133-131281155 GCTCGCTGTAGGGTGGTGGGAGG + Intronic
940324133 2:152407436-152407458 CCTCCCTTCAGGGGTGTGGGTGG + Intronic
940910534 2:159206152-159206174 GCTCCTTTCAGGATCCTGGGTGG - Intronic
942349486 2:175038076-175038098 GCTCCCTTCCCGGGGGTGGGCGG + Intergenic
944334900 2:198520790-198520812 GATCCCTTGAGGCTGGAAGGTGG - Intronic
945244053 2:207702042-207702064 GCTCCCTTCAGGCTGTGGGCTGG - Intergenic
948436372 2:237956577-237956599 GCTCCCTCCGGGCTGCTGGCCGG + Intergenic
948489541 2:238303675-238303697 GCTCCCTGCAGACCTGTGGGCGG + Intergenic
948896515 2:240930296-240930318 GCTCCCTGCAGCCTGGTGCCTGG - Intronic
949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG + Intergenic
1169007582 20:2221410-2221432 GCTGCCTTCTGTTTGGTGGGAGG + Intergenic
1170796825 20:19554888-19554910 GCTCCCTTTAAATTGGTGGGTGG - Intronic
1172181864 20:33008457-33008479 GTTCCCTCCAGGCTGGAGTGGGG + Intronic
1172291286 20:33778915-33778937 TCTCCCTTCAGAGTGGTTGGTGG + Intronic
1172587299 20:36093558-36093580 ACTCCCTGCTGGCAGGTGGGCGG + Intronic
1173888084 20:46479351-46479373 GCTCTGTTCAGTCTGTTGGGGGG - Intergenic
1175238340 20:57527489-57527511 GCTCATTTAAGGCAGGTGGGAGG + Intergenic
1175806424 20:61831699-61831721 GGTCCCTCCAGGCTCCTGGGCGG + Intronic
1177427168 21:20938315-20938337 GCTCTCTTCAGACTGGTGTAGGG + Intergenic
1179787294 21:43737217-43737239 ACGCCCTTCAGGCTGGGGGGTGG + Intronic
1180041901 21:45284353-45284375 GCTTCTTTTAGGCTAGTGGGAGG + Intronic
1182130334 22:27845704-27845726 GCTCCCTTCTGGATGCTGGCAGG + Intergenic
1183298173 22:37044287-37044309 GCTCCCTTCAGCCAGCAGGGTGG - Intergenic
1183346221 22:37309836-37309858 GCTCCCTTCAAGCTGACTGGGGG + Intronic
1184822293 22:46918383-46918405 GGTCCCCTGTGGCTGGTGGGTGG - Intronic
1185072838 22:48666778-48666800 TCTCCCAGCAGGCTGGAGGGAGG - Intronic
950196653 3:11014231-11014253 GCTTTCTTCAGGCTGGTGCTTGG - Intronic
950449737 3:13058932-13058954 GCTGCCCTCAGCCAGGTGGGTGG + Intronic
950679917 3:14577997-14578019 TCAGCCTTCAGGCTGGTGAGAGG + Intergenic
950709187 3:14802918-14802940 GCCCCTTTCAGCTTGGTGGGAGG + Intergenic
951915186 3:27793184-27793206 GCTCCCAGCACCCTGGTGGGAGG + Intergenic
952788092 3:37176025-37176047 GCTCCCACCGGGCTGGCGGGAGG + Intronic
952818479 3:37465891-37465913 CCTCCTTTCAGGCTGATGTGGGG + Intronic
954773863 3:52998935-52998957 GCTCCCTCCATGGTGGTCGGTGG - Intronic
954797838 3:53170502-53170524 GGGCCCTGCAGGCAGGTGGGCGG + Intronic
955699002 3:61664742-61664764 GCTCCCTTGAGCCTGGGAGGCGG + Intronic
958268115 3:91463957-91463979 GCTTCCTTGAGGGTGGAGGGTGG - Intergenic
962270624 3:133975495-133975517 GGACCCTTCTGGCTGCTGGGTGG - Intronic
962352126 3:134663921-134663943 CCTCCCTTCTGGCTGTAGGGAGG - Intronic
962712557 3:138100155-138100177 CCTCCCTGGAGGCTGGAGGGTGG - Intronic
963678140 3:148340102-148340124 GCTCCCTTGAGTCTGGGAGGTGG + Intergenic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
965197491 3:165620660-165620682 GGTCCATTCAGTCTGTTGGGGGG - Intergenic
967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG + Intronic
967054308 3:185815534-185815556 GATCTCTTCAGGCTGTGGGGAGG + Intronic
967113645 3:186317697-186317719 GCCCCGCTCAGCCTGGTGGGAGG - Intronic
968579855 4:1384860-1384882 GCTTCCCCCAGGCTTGTGGGTGG + Intronic
969056992 4:4408281-4408303 GCATCCTCCAGGCTGCTGGGAGG + Intronic
969482921 4:7456455-7456477 TCACCCTTCAGGCTTATGGGTGG - Intronic
969517453 4:7655535-7655557 GCTTCCTTCAGCCTGTGGGGTGG - Intronic
969618357 4:8266623-8266645 GCTCTGCTCAGGCTGATGGGTGG - Intergenic
969620245 4:8275292-8275314 AGTCCCTTCAGGCTGCTGTGTGG - Intronic
979485635 4:121267027-121267049 CCTTCCTTCAGTCTGGTGGGGGG + Intergenic
981505277 4:145492665-145492687 CCTCCCTTGAGGTTGGAGGGTGG + Intronic
985856201 5:2429392-2429414 GCTCCCTTCAGACTGGTGGAAGG + Intergenic
986737254 5:10676973-10676995 GCTTGCTTAGGGCTGGTGGGGGG - Intergenic
987272480 5:16326278-16326300 GCTCCATTAAGGCTGCAGGGGGG - Intergenic
988780043 5:34512272-34512294 CCTCCCTTCAGGCTGAGGGATGG + Intergenic
989330438 5:40251956-40251978 GCTTGCTTGAGGCTGGAGGGTGG - Intergenic
992683940 5:79180717-79180739 GCTTCCTTAAGGATGGAGGGTGG + Intronic
995980519 5:118097305-118097327 TTTCCCTTCAGGTTGGTGTGGGG - Intergenic
997405500 5:133643482-133643504 ACTTCCTTCAGGCTGATGTGTGG + Intergenic
998044209 5:138973051-138973073 GATCCCTTCAGCCAGGTGGCAGG - Intronic
999313348 5:150568124-150568146 GATCCCTTCAGCCCGGGGGGAGG - Intergenic
999482433 5:151961075-151961097 GCTACCTTCTGTCTGCTGGGGGG + Intergenic
999763694 5:154722376-154722398 GCTCTCCCCAGGCTGGTGGGTGG + Intronic
1000601051 5:163274774-163274796 GATCCATTCAGTCTGTTGGGGGG + Intergenic
1001915345 5:175555672-175555694 GTTTTCTTGAGGCTGGTGGGTGG - Intergenic
1003499628 6:6693917-6693939 TCGCCTATCAGGCTGGTGGGTGG + Intergenic
1005708916 6:28484956-28484978 GATCGCTTGAGGCTGGGGGGTGG + Intergenic
1007384046 6:41508677-41508699 GATCCCTGGAGGCTGGAGGGAGG - Intergenic
1008050427 6:46895322-46895344 GGTGCTTTCAGGCTGGTGTGTGG - Intronic
1008987088 6:57557609-57557631 GCTTCCTTGAGGGTGGAGGGTGG + Intronic
1009175046 6:60450176-60450198 GCTTCCTTGAGGGTGGAGGGTGG + Intergenic
1011195505 6:84775006-84775028 GCTGCCTTCAGCCAGGTGGAGGG - Intergenic
1014651932 6:124050504-124050526 GCTCCCTTCAGCCTGGCTTGGGG + Intronic
1016513411 6:144868304-144868326 GGTCCATTCAAGCTGGTTGGGGG + Intergenic
1017994002 6:159515366-159515388 GCTGCCTTGAGGGTGGAGGGTGG - Intergenic
1018694983 6:166383553-166383575 GGTCCCTCCAGGGTGGCGGGCGG + Intergenic
1019274132 7:167004-167026 GCTCCTTTCAGGTTGCTGGTAGG - Intergenic
1019628304 7:2032665-2032687 GGTCCCTCGAGCCTGGTGGGAGG - Intronic
1024638407 7:51309711-51309733 GCTTCCTTCTTGCTGGTGGAGGG - Intronic
1025139389 7:56449756-56449778 TCTCCCCTCAGGCTGATAGGTGG + Intergenic
1025212126 7:57025808-57025830 GCTCCCTGCAGGGAGGTGGGTGG + Intergenic
1025239301 7:57257846-57257868 TCTCCCCTCAGGCTGATAGGTGG + Intergenic
1025659828 7:63551020-63551042 GCTCCCTGCAGGGAGGTGGGTGG - Intergenic
1026247447 7:68633763-68633785 GCTCCATTCAGTTGGGTGGGGGG + Intergenic
1026897978 7:74021598-74021620 GCTCCCTGCAGGCGGCTGTGTGG + Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029151678 7:98484709-98484731 GGTCACTTGTGGCTGGTGGGTGG + Intergenic
1029628301 7:101734134-101734156 TCTGCCTGCAGGCTGGTGGCTGG + Intergenic
1030517517 7:110556947-110556969 GCTTCCTTCAGGTTTCTGGGAGG + Intergenic
1031656917 7:124367470-124367492 GCTAACTTCAGGGTAGTGGGAGG + Intergenic
1033802003 7:144912590-144912612 GATCCCTTCAGTCAGTTGGGGGG + Intergenic
1034761435 7:153675470-153675492 GCTCCCTTCAGTTTGCTGAGTGG - Intergenic
1036402874 8:8426058-8426080 GTTCCCTCCAGGCTGGAGGAAGG + Intergenic
1037889236 8:22614744-22614766 GCTGCCTTCATCCTGATGGGTGG + Intronic
1038533668 8:28338628-28338650 TCTCTCTTCAGGCTTGTGGGAGG - Intronic
1043516644 8:81000969-81000991 GCCCCCTTGAGGCTTGTGTGAGG - Intronic
1045751135 8:105485220-105485242 GCTCCCTGCAGGCTGGCTGTTGG - Intronic
1048045294 8:130767206-130767228 GCTCCCATAATCCTGGTGGGAGG - Intergenic
1048375255 8:133817601-133817623 CCTCCTTTCAGGCTGATGGTGGG - Intergenic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049686098 8:143939902-143939924 GAGCCCTTCAGTCTGTTGGGGGG - Intronic
1049847903 8:144812587-144812609 GGTCACTTCAGTCTGCTGGGGGG + Intergenic
1049854134 8:144851019-144851041 TCAGGCTTCAGGCTGGTGGGGGG + Exonic
1051488923 9:17638820-17638842 GATCCCTTCAGACTGGGGGAGGG + Intronic
1051593832 9:18803551-18803573 GTGCCCTTCAGACAGGTGGGCGG - Intronic
1051647802 9:19287465-19287487 GATCACTTGAGCCTGGTGGGGGG - Intronic
1052232429 9:26170224-26170246 GCTCACTTCATGGTGGGGGGAGG - Intergenic
1052798838 9:32948821-32948843 TCTCCCTAGAGGCTGGAGGGTGG + Intergenic
1053354404 9:37433959-37433981 GCTCCTTGCAGGCTGGGGTGGGG - Intronic
1056722364 9:89082788-89082810 GGTCCCTTCAGACAGGAGGGCGG - Intronic
1057214215 9:93219147-93219169 CCTGCCATCAGGCTGGAGGGAGG - Intronic
1057705609 9:97392937-97392959 GCTCCCTGGGGGCTGGTGGAGGG - Intergenic
1058795770 9:108496931-108496953 GCTGCCTTCAGGGTGGTTGTTGG + Intergenic
1060428547 9:123527028-123527050 TCTCCCTTCATCCTAGTGGGTGG + Intronic
1061355590 9:130102391-130102413 GCCTGGTTCAGGCTGGTGGGGGG - Intronic
1061405680 9:130391937-130391959 GCTCCCTGCTTGATGGTGGGAGG - Intronic
1062636297 9:137493412-137493434 CCTGCCTTCAGGGTCGTGGGTGG - Intronic
1187045795 X:15646796-15646818 GCTGCGGACAGGCTGGTGGGGGG - Intronic
1187267798 X:17751870-17751892 GCACCCTTCAACCTGGTCGGTGG + Exonic
1188123771 X:26342576-26342598 GCCCACTTGAGGGTGGTGGGGGG - Intergenic
1190430728 X:50375760-50375782 TCTCCCTTGAAGCTGGTGGGAGG + Intronic
1192201862 X:69071324-69071346 GCTGCCTTCCAGCTCGTGGGTGG - Intergenic
1193428757 X:81373946-81373968 GCCCACTTGAGGGTGGTGGGTGG - Intergenic
1196084620 X:111671881-111671903 GCTCCTTTCAGGCTGCTGGTGGG + Intronic
1197567999 X:128112330-128112352 GCTTACTTGAGGGTGGTGGGTGG + Intergenic
1199592706 X:149482691-149482713 GCTCCCTTCCAGCTGGTGAGAGG - Exonic
1200059061 X:153476021-153476043 GCCCCCCTCAGGCTGTGGGGTGG - Intronic
1202275684 Y:23117246-23117268 GCGCACTTCAGGCAGGAGGGTGG + Intergenic
1202290344 Y:23303445-23303467 GCGCACTTCAGGCAGGAGGGTGG - Intergenic
1202428676 Y:24750965-24750987 GCGCACTTCAGGCAGGAGGGTGG + Intergenic
1202442115 Y:24919124-24919146 GCGCACTTCAGGCAGGAGGGTGG - Intergenic