ID: 1049390206

View in Genome Browser
Species Human (GRCh38)
Location 8:142363794-142363816
Sequence GTCTTCACCCTGAGATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049390206_1049390210 3 Left 1049390206 8:142363794-142363816 CCCAGAGATCTCAGGGTGAAGAC 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1049390210 8:142363820-142363842 GCACGCCCTCGCAAGAGACCGGG No data
1049390206_1049390209 2 Left 1049390206 8:142363794-142363816 CCCAGAGATCTCAGGGTGAAGAC 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1049390209 8:142363819-142363841 CGCACGCCCTCGCAAGAGACCGG No data
1049390206_1049390213 18 Left 1049390206 8:142363794-142363816 CCCAGAGATCTCAGGGTGAAGAC 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1049390213 8:142363835-142363857 AGACCGGGATACCCAATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049390206 Original CRISPR GTCTTCACCCTGAGATCTCT GGG (reversed) Intronic
902561209 1:17278704-17278726 GTCTTTGCCCTGGGACCTCTGGG - Intronic
904373803 1:30066823-30066845 GTCTCCACCCTGAGATGAATGGG + Intergenic
904411257 1:30326206-30326228 CCCTTCACCCTGAAATGTCTGGG - Intergenic
904552033 1:31326790-31326812 GTTTTAATCCTGAGATCTATAGG + Intronic
905481276 1:38263827-38263849 GTCTTCACACTGAGAACTCAGGG - Intergenic
907950492 1:59178682-59178704 GCCTTGGCCTTGAGATCTCTTGG - Intergenic
909598548 1:77435420-77435442 CTCTTCACCCTGTGATCCCCTGG - Intronic
910778698 1:90902837-90902859 CTTATCACCCTGAGCTCTCTGGG - Intergenic
911076074 1:93876621-93876643 ATCTTTACCCTGAGATGTGTTGG + Exonic
913014606 1:114720137-114720159 GTCTTACTCCTGAGATCTCAGGG - Intronic
913160282 1:116139133-116139155 GTCTTTCCCCTGAGATCTGAGGG + Intergenic
915698360 1:157767470-157767492 GTCCTCACCCTCAGGTCTCCTGG - Exonic
916205633 1:162313800-162313822 AGCTTCAACCTGAGATCACTGGG - Intronic
916450231 1:164913661-164913683 GTCTGCACAATGAGATGTCTTGG - Intergenic
917641737 1:176989642-176989664 GTCTTCTCTCTGAGCTCTGTAGG - Intronic
917659373 1:177163061-177163083 GTCTTCACACTGAAAACACTAGG - Intronic
919882646 1:201910962-201910984 GAGTTCACACTCAGATCTCTTGG + Intronic
921031297 1:211337294-211337316 CTCTTCACCCTGATATCTGAAGG - Intronic
921065697 1:211620831-211620853 GTCTTCACCACAAGGTCTCTGGG + Intergenic
922155600 1:223038050-223038072 GTCTTCCCCCTGAGCTGTCGAGG + Intergenic
923149672 1:231221741-231221763 GTAATCACCCTGAGATTTCCTGG - Intergenic
923227943 1:231956723-231956745 GTCTCCATCCTGCGATGTCTGGG + Intronic
1063401772 10:5752908-5752930 GACTTCATCCTGAGGTCGCTGGG + Intronic
1064345953 10:14533065-14533087 GTCTTCACCCTGAGGGCCATGGG + Intronic
1074461556 10:113642715-113642737 ATCTTGACCCTGAGTCCTCTGGG - Intronic
1075206766 10:120455864-120455886 CTCTAGACCCTGAGATATCTGGG + Intergenic
1076510622 10:131011585-131011607 GTCCTCACCCCGAGGGCTCTGGG - Intergenic
1077095448 11:797188-797210 CTCTCCGCCCTGGGATCTCTGGG - Intronic
1077557451 11:3232426-3232448 GGCTCCACCCAGAGATCTCGTGG - Intergenic
1079024964 11:16939879-16939901 GGACTCACCCTGAGCTCTCTGGG + Intronic
1079220848 11:18559743-18559765 GTATTTTCCATGAGATCTCTGGG - Intronic
1080388614 11:31824987-31825009 GGCTTTTCCCTGAGTTCTCTGGG + Intronic
1080622208 11:33996324-33996346 GTCCTCACCCGAAGATCCCTGGG - Intergenic
1085912908 11:80849697-80849719 GTCTTCATATTGACATCTCTTGG - Intergenic
1088982722 11:114878155-114878177 GCTTTCACCCTGAGGTGTCTGGG + Intergenic
1090197720 11:124831253-124831275 GTCCTCACCCTGGGATGTCTTGG - Intergenic
1090668906 11:128932586-128932608 GTCTGCACCCAGCGTTCTCTAGG - Intergenic
1091936672 12:4440391-4440413 ATCTTCACCCTGTGACCGCTGGG + Intronic
1092148892 12:6233491-6233513 GTTTTTCCCATGAGATCTCTTGG + Intronic
1092165241 12:6338335-6338357 GGCCTCCCCCTGTGATCTCTCGG + Intronic
1096765623 12:53886539-53886561 GTCTGCACCCTTCCATCTCTGGG + Intergenic
1096819144 12:54220357-54220379 GTCTTCTCCCAGACAGCTCTTGG + Intergenic
1099013578 12:77320289-77320311 GTCCTCAAACTGTGATCTCTGGG + Intergenic
1100047372 12:90399112-90399134 GCATTCAGCCTGAGATCTTTTGG + Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101897331 12:108766628-108766650 GACTTGACCCTGAGGGCTCTGGG - Intergenic
1103245803 12:119456182-119456204 GACTTCACCCTGAGAACAGTAGG + Intronic
1104589512 12:130073169-130073191 GGCTACACTCTGAGATCACTGGG - Intergenic
1105431128 13:20339011-20339033 GTGTTCACCCTGAGCACTCACGG - Intergenic
1106099508 13:26682273-26682295 GGCTTCACACTGGGATCTCAAGG - Intronic
1108186631 13:47894497-47894519 GTTTTCTTCCTGAGATGTCTGGG - Intergenic
1114964111 14:27935375-27935397 GTCTTCTACCTGAAATTTCTAGG + Intergenic
1119437134 14:74604985-74605007 GGCTTCTCCTGGAGATCTCTAGG + Intronic
1121301899 14:92878350-92878372 GTCTGCATCCTGAGCTCTGTGGG - Intergenic
1127487668 15:59434582-59434604 GTCCTCACTCTTACATCTCTGGG + Intronic
1128078169 15:64841378-64841400 GTCTTCTCCCTGGAACCTCTGGG - Intergenic
1128144344 15:65324239-65324261 TTCTTCAGCCTGAGGCCTCTGGG + Intergenic
1130894302 15:88158490-88158512 GTCCTCACCCTGAGGTCTATTGG + Intronic
1132640156 16:974552-974574 GTCTTCAGCCTGCGTGCTCTTGG - Intronic
1133169346 16:3971456-3971478 GTCTTCCCACTGAGGACTCTTGG - Intronic
1134099731 16:11443592-11443614 GTCTTCTTCCTGACACCTCTAGG - Intronic
1138717508 16:59040840-59040862 GTCTTCAAGCTAAGCTCTCTTGG + Intergenic
1138815108 16:60194664-60194686 CTCTTCACCCAGAGATCACAAGG + Intergenic
1140227796 16:73092764-73092786 GTCTTCACCCTGCTATTTATGGG + Intergenic
1147320757 17:39644452-39644474 GTCTTGACCCTGGGCTGTCTGGG - Intronic
1147532682 17:41294445-41294467 GTCTACAATCTGAGATGTCTTGG - Intergenic
1151177643 17:72301858-72301880 GTTGTCACCCTGAGAGTTCTGGG + Intergenic
1151181525 17:72332463-72332485 GTCTTCAGCCTGTGCTCTCATGG - Intergenic
1156127357 18:33922115-33922137 GTCTTCTCTCAGAGATCTCTTGG - Intronic
1158227109 18:55212912-55212934 CTCTTCACTCAGAGAACTCTGGG + Intergenic
1158942196 18:62415032-62415054 AGATTCACCCTGACATCTCTAGG + Intergenic
1160804301 19:985084-985106 GTGTGCCCGCTGAGATCTCTTGG + Intronic
1161301687 19:3545767-3545789 GTCTGAACCCTGAGTTCTGTGGG + Intronic
1164710897 19:30356576-30356598 ATCTTCACCATGAGATCTCTGGG + Intronic
1166970362 19:46563107-46563129 CCCTTCTCCCTGAGGTCTCTTGG - Intronic
1168125286 19:54279360-54279382 GTCTTCACCCAGTGATCTCCTGG - Exonic
1168377607 19:55893545-55893567 ATCTTCTCCCTGACATCTGTGGG - Intronic
926805237 2:16704260-16704282 GTCTTAAGCCTCATATCTCTTGG + Intergenic
928406827 2:31021244-31021266 GTCTTCTCCCTCAGACCTGTGGG + Intronic
928410634 2:31051495-31051517 GTCTTGAGCTTGAGATCTGTAGG - Intronic
933293838 2:80468185-80468207 GACTTCGCCCTGATAACTCTTGG - Intronic
933432301 2:82198443-82198465 ATTTTCACCCTTAGCTCTCTGGG - Intergenic
938196778 2:129335543-129335565 ATCTTCACCCTGAAATCTGTGGG + Intergenic
938809246 2:134837028-134837050 ATATTAACCCTGAAATCTCTAGG + Intergenic
939222459 2:139319969-139319991 ATATTGACCCTGAAATCTCTTGG + Intergenic
944871509 2:203916956-203916978 GTCTTTACCTTGGGAACTCTGGG + Intergenic
945413254 2:209538104-209538126 GTCTTCACGCAGAAATCTGTTGG + Intronic
948117256 2:235502477-235502499 GTGGCCACCCTGAGCTCTCTGGG + Intronic
1170787750 20:19482161-19482183 GTCTTCACCCTTAGAGCAATGGG - Intronic
1171263962 20:23755289-23755311 GTCATCTCCTTGACATCTCTGGG + Intergenic
1171273156 20:23832135-23832157 GTCATCTCCTTGACATCTCTGGG + Intergenic
1172136471 20:32689928-32689950 GTCTCCTCCCTCAGCTCTCTGGG - Intergenic
1173362457 20:42356747-42356769 TTCTTCATCCTGAGAGCTCTGGG - Intronic
1175610461 20:60347142-60347164 GTCTTCATGCTGTTATCTCTGGG - Intergenic
1178638034 21:34322418-34322440 GTCCCCACCCTGAGCTCTCCTGG + Intergenic
1182992681 22:34782955-34782977 TTCTTCACCCTGAGAACCCCAGG - Intergenic
1183276466 22:36901164-36901186 GTCTCCACCTTGAGCTTTCTAGG - Intergenic
1185000076 22:48239983-48240005 GTCTGAACCCTGAGAACTCCAGG + Intergenic
952220238 3:31317115-31317137 GTCTTCAGCCTGAGCAGTCTGGG + Intergenic
956500072 3:69873135-69873157 GGCTTCACACTGAGATCTTCTGG - Intronic
957546401 3:81643873-81643895 GTCTTCACCCTGGGATGAATGGG - Intronic
959268377 3:104172234-104172256 GTCATCACCCTGGGAGCTGTTGG + Intergenic
960262918 3:115588684-115588706 GTCCTCACCCTAATATCTCCTGG + Intergenic
963350779 3:144148596-144148618 TTCTTCTCCTTCAGATCTCTGGG + Intergenic
965221040 3:165925654-165925676 TTCTTCCCCCTAACATCTCTAGG - Intergenic
965498527 3:169428836-169428858 GTTTTCACCCTGACATCACCTGG + Intronic
966497654 3:180599471-180599493 TTCTTCACCTTTATATCTCTAGG + Intergenic
967827619 3:193890710-193890732 GCCTTGACCCTGAAGTCTCTAGG + Intergenic
968041411 3:195592215-195592237 GGCTGCAGCCTGAGATGTCTTGG + Intergenic
969154366 4:5197041-5197063 GTCTTCACCTTCAGGTCTTTGGG + Intronic
969476304 4:7424351-7424373 GTCTCCAGCCTGGGCTCTCTGGG + Intronic
977220220 4:94329308-94329330 GGCTTCACACTGAGGTCACTTGG + Intronic
982407460 4:155036321-155036343 GTCTTCACCCTCAGATGTGCTGG + Intergenic
983292994 4:165830158-165830180 GTCTTCACCATCTGTTCTCTGGG + Intergenic
985371569 4:189290558-189290580 GTTTTCTCCCTGAGATCTAATGG - Intergenic
985824191 5:2180600-2180622 CTGTTCACCCTGAGAGCTCGGGG - Intergenic
986145392 5:5072802-5072824 GTTTCCAGCCTGAAATCTCTGGG + Intergenic
986670277 5:10137530-10137552 CTCTTCCCCCTGATTTCTCTAGG + Intergenic
987588606 5:19892641-19892663 CTCTTCACCTTGTGTTCTCTTGG + Intronic
989146847 5:38258208-38258230 GTCCTCACCCTGAAATCTTGGGG - Intergenic
997009378 5:129858801-129858823 GTCTTGACCCTAGGATCACTAGG - Intergenic
997304269 5:132826469-132826491 GCCTTTACCCTGAGACCTCCTGG + Exonic
998529043 5:142868366-142868388 GTCTTCACCTCCAGAGCTCTGGG + Intronic
999124298 5:149235636-149235658 ATCTTGACCTTGAGAGCTCTTGG - Intronic
1000830745 5:166098171-166098193 GTATTCATCTTGAGAACTCTTGG + Intergenic
1001953642 5:175833365-175833387 TTCTTCACCACGAGTTCTCTGGG - Intronic
1002127832 5:177060084-177060106 GCCTTCACCCTGAGAGCACTGGG + Intronic
1006108238 6:31729306-31729328 GTCTTCCTCCTGCCATCTCTAGG + Exonic
1006269107 6:32950353-32950375 GTCTGCACCCTGTGTTCTTTTGG - Intronic
1006358317 6:33573551-33573573 GTCTCCTCCCTCAGCTCTCTGGG - Exonic
1008053084 6:46920065-46920087 GTCTTCACTCTACGTTCTCTGGG + Intronic
1008400807 6:51060334-51060356 GTGTTCTCCCTGAGAACACTGGG + Intergenic
1009496738 6:64358524-64358546 GTTTTCATCCTGAGATCTGAGGG - Intronic
1013607191 6:111761362-111761384 TCCTTCACCCTGAAATCTTTTGG - Intronic
1013692702 6:112665323-112665345 GTCAGCACCCTAGGATCTCTGGG + Intergenic
1013777819 6:113698703-113698725 GCTTTCACCCTGAGCTCTGTTGG + Intergenic
1014711701 6:124814225-124814247 TTCTTCTCCCTGAGGTCTTTAGG + Intronic
1015708828 6:136117471-136117493 GTTTTCAAACTGAGATCTCAGGG + Intronic
1017164254 6:151391997-151392019 GGCTTCTGCTTGAGATCTCTTGG + Intergenic
1019176661 6:170162697-170162719 GTCTGCTCCGTGAGTTCTCTGGG - Intergenic
1021674611 7:23067739-23067761 GTCTTCACCTCGAGATTTCCTGG + Intergenic
1024494078 7:50022968-50022990 GTCTTAACCCTGAGAACTTGTGG - Intronic
1025721822 7:64023372-64023394 GTATTCACCCTGAGATATTCAGG - Intergenic
1029115881 7:98236845-98236867 GTCTTCCCACTGAGCTCGCTGGG + Exonic
1029175601 7:98662380-98662402 GGCTACAGCCTGAGCTCTCTGGG + Intergenic
1029225369 7:99023256-99023278 GTGTTCTCCCATAGATCTCTGGG - Intergenic
1033139687 7:138814450-138814472 GTCTTCATCCAGAGATGGCTTGG - Intronic
1033537559 7:142326087-142326109 GTCCTCACCCTAAGATTTCCAGG - Intergenic
1033539843 7:142346239-142346261 GTCCTCAACCTAAGATTTCTTGG - Intergenic
1034070467 7:148179812-148179834 GACTTGAGCCTGAGGTCTCTTGG - Intronic
1036767456 8:11557834-11557856 GTTTGCACCCTCAGATCTCTCGG - Intronic
1037370328 8:18170438-18170460 GTTTTCAGCCTGGGATCACTTGG - Intergenic
1037792388 8:21957141-21957163 GTCTGCACACTGAAATTTCTCGG + Intronic
1037976929 8:23220435-23220457 GTCTTCAGCCTCCAATCTCTGGG - Intronic
1037977085 8:23221361-23221383 GTCTTCAGCCTCCAATCTCTGGG + Intronic
1038197011 8:25377807-25377829 GTCTTCCCCCTGTGAACTCGGGG + Intronic
1041405673 8:57496683-57496705 GTCTTCACATTGAAATCTCCTGG - Intergenic
1042689330 8:71479731-71479753 GTCTTCACCTTCACATCTCAGGG - Intronic
1042783325 8:72517589-72517611 TTCTTCACCCTCATCTCTCTTGG - Intergenic
1046592851 8:116226824-116226846 TTTTTCAGCCTGAGATCTATGGG + Intergenic
1049390206 8:142363794-142363816 GTCTTCACCCTGAGATCTCTGGG - Intronic
1054789997 9:69247859-69247881 TTTTTCTCCCTGAGATCACTTGG - Intronic
1057948959 9:99354424-99354446 TTCCTCACCCTGAGAACCCTAGG + Intergenic
1058351211 9:104026622-104026644 CTCTTCATCCTGAAATCTATTGG + Intergenic
1060454857 9:123782442-123782464 GTCTTCACACTGTAATCTTTGGG - Intronic
1061302234 9:129711992-129712014 GGTTTCCCCCTGAGATTTCTTGG - Intronic
1061804557 9:133130899-133130921 GACTTCGCCCTGGCATCTCTGGG - Intronic
1062293860 9:135813160-135813182 GGCTTGACCCTGAGATTCCTGGG - Intronic
1203698629 Un_GL000214v1:118074-118096 GTCTTCACCCCCAGACCCCTGGG - Intergenic
1203699548 Un_GL000214v1:124225-124247 GTCTTCACCCCCAGACCCCTGGG - Intergenic
1203700496 Un_GL000214v1:130508-130530 GTCTTCACCCCCAGACCCCTGGG - Intergenic
1203701411 Un_GL000214v1:136528-136550 GTCTTCACCCCCAGACCCCTGGG - Intergenic
1203569840 Un_KI270744v1:120462-120484 GTCTTCACCCCCAGACCCCTGGG - Intergenic
1189097157 X:38152430-38152452 GTCCTCACCATGTGGTCTCTTGG + Intronic
1189145952 X:38654990-38655012 GTGTTCACCCTCAAAACTCTTGG - Intronic
1194319044 X:92420457-92420479 TCCTTCAGCCTGAGATCTTTCGG + Intronic
1194671439 X:96738383-96738405 CTCTTCAGCCTCAGAACTCTGGG - Intronic
1198799815 X:140437451-140437473 GTCCTTACCCTAAGATCACTAGG - Intergenic
1200627178 Y:5533606-5533628 TCCTTCAGCCTGAGATCTTTTGG + Intronic
1201603017 Y:15751262-15751284 GTCATCACCCTGAATACTCTAGG + Intergenic
1202231367 Y:22662530-22662552 GTCATCACCCTGAGAAGTCAGGG - Intergenic
1202311791 Y:23533635-23533657 GTCATCACCCTGAGAAGTCAGGG + Intergenic
1202559011 Y:26136959-26136981 GTCATCACCCTGAGAAGTCAGGG - Intergenic